ID: 1091686537

View in Genome Browser
Species Human (GRCh38)
Location 12:2566653-2566675
Sequence AACCACAGGCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 438}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091686520_1091686537 16 Left 1091686520 12:2566614-2566636 CCTCCTGGTAACTCAGCCCCAAG 0: 1
1: 0
2: 2
3: 13
4: 213
Right 1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 438
1091686532_1091686537 -9 Left 1091686532 12:2566639-2566661 CCAGGGGAGGGCATAACCACAGG 0: 1
1: 0
2: 1
3: 12
4: 196
Right 1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 438
1091686529_1091686537 -1 Left 1091686529 12:2566631-2566653 CCCAAGGCCCAGGGGAGGGCATA 0: 1
1: 1
2: 2
3: 30
4: 225
Right 1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 438
1091686530_1091686537 -2 Left 1091686530 12:2566632-2566654 CCAAGGCCCAGGGGAGGGCATAA 0: 1
1: 0
2: 5
3: 23
4: 231
Right 1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 438
1091686528_1091686537 0 Left 1091686528 12:2566630-2566652 CCCCAAGGCCCAGGGGAGGGCAT 0: 1
1: 0
2: 2
3: 35
4: 311
Right 1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 438
1091686531_1091686537 -8 Left 1091686531 12:2566638-2566660 CCCAGGGGAGGGCATAACCACAG 0: 1
1: 0
2: 1
3: 18
4: 154
Right 1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 438
1091686522_1091686537 13 Left 1091686522 12:2566617-2566639 CCTGGTAACTCAGCCCCAAGGCC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 37
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091686537 Original CRISPR AACCACAGGCAGAAGGTGGA GGG Intronic
900272640 1:1799849-1799871 AACCACAGCCAGAAAGCGAAAGG + Intronic
900703451 1:4061894-4061916 AACCACAAAAACAAGGTGGACGG + Intergenic
901142638 1:7044811-7044833 AACCACAGGCGGGAAGAGGAGGG - Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901325504 1:8362912-8362934 ACCCACAGGCAGAAGCCTGAAGG + Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902184196 1:14712846-14712868 AAGCACAGGGAAAAGGTGGGGGG - Intronic
902546062 1:17190993-17191015 ACCTACAGGCAGAAGGTTCAAGG + Intergenic
902778921 1:18692199-18692221 AAGAAAAGGAAGAAGGTGGAAGG + Intronic
902826270 1:18976452-18976474 AATCCCAGGCAAAAGGTGGAAGG + Intergenic
903563727 1:24248647-24248669 AACCACACGTTGAAGATGGATGG - Intergenic
905220273 1:36441361-36441383 CACCACAGGCACAAAGAGGAAGG + Intronic
905453767 1:38073785-38073807 AGGCACCGGCAGAAGTTGGAGGG - Intergenic
905472130 1:38201146-38201168 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
905514515 1:38552288-38552310 AAACACATGGAGAAGGTGTATGG - Intergenic
905884962 1:41486781-41486803 AACCATAGGGAGAAGAGGGAAGG + Intergenic
905998152 1:42400095-42400117 AAGCAAAGGGAGATGGTGGAAGG + Intronic
906319435 1:44807233-44807255 GGCCAAAGGCAGAAGGTGGAAGG - Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
910094476 1:83505293-83505315 AACCACAGTCAGAAAGAGAAGGG - Intergenic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913332159 1:117676704-117676726 AACCAGATGCCGGAGGTGGAAGG + Intergenic
913662928 1:121020799-121020821 AACCACAGGCGGAACCTGCACGG + Intergenic
915328901 1:155097066-155097088 GACAACAGGCAGAATGGGGAGGG - Intergenic
915599095 1:156911355-156911377 AACCAGAGGCAGAGGTTGCAGGG - Intronic
916052923 1:161048720-161048742 AAGCCCAGGTAGAAGCTGGAAGG - Exonic
916197019 1:162234090-162234112 AAACACAGGCAGAATGTGATTGG + Intronic
916660666 1:166920451-166920473 AAAAACAGGCAGAAAGTTGAAGG - Intronic
916759475 1:167803572-167803594 AATCACAGCCAGATGGAGGAGGG + Intergenic
916780516 1:168022707-168022729 TACCAGAGGCACAAGGTGCAAGG - Intronic
917665526 1:177221975-177221997 GACCACAGGATGAAGGTGAAAGG + Intronic
918014523 1:180620174-180620196 TCCCAATGGCAGAAGGTGGAAGG - Intergenic
918867293 1:189919151-189919173 ACCCACAGGCTGAAGGTAAATGG - Intergenic
919981281 1:202644052-202644074 AACAAAAGGCAGATGCTGGAGGG + Intronic
920430477 1:205915412-205915434 AACCACAGGAAGGAAGTGGGAGG + Intronic
920606703 1:207396033-207396055 AGCCAGAGGCAGAAGGAAGATGG + Intergenic
920735185 1:208527136-208527158 GGCCGCAGGCAGAAGGTGGGTGG - Intergenic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
924024260 1:239816487-239816509 AGGCACAGGCAGAAGAGGGAGGG + Intronic
924587830 1:245375454-245375476 AACCAGAGAGAGGAGGTGGAAGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066148396 10:32587359-32587381 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1066331300 10:34426383-34426405 AAGCACATGCAAAAAGTGGATGG - Intronic
1067838082 10:49653906-49653928 GCCCACAGGCAGGAGGAGGAGGG - Intronic
1069647312 10:70010368-70010390 AACTACAGGAAGAAGTTGGGAGG + Intergenic
1070225902 10:74505232-74505254 AACCAAAAGCAAAAGGTGGAAGG - Intronic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1070956359 10:80466043-80466065 AACCACAGACAGAATCTGTAAGG + Intronic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072618073 10:97062911-97062933 AACCCCAGGGGGAAGGTGAAAGG + Intronic
1072837105 10:98726948-98726970 ATGCACTGGCAAAAGGTGGAAGG + Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073332341 10:102678767-102678789 AGCCCAAAGCAGAAGGTGGAGGG + Intronic
1074865776 10:117543613-117543635 AGCCAGGGGTAGAAGGTGGACGG - Exonic
1075551648 10:123397110-123397132 AACCACAGTCAGAAGGAGAAGGG - Intergenic
1075809160 10:125211875-125211897 AACCACAGGCTACAAGTGGAGGG - Intergenic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076368567 10:129937193-129937215 AACCACAGGCCGTAGGGGGCCGG + Intronic
1076693668 10:132236801-132236823 AACCCCAGGCACCAGGTCGAGGG - Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077028217 11:451037-451059 AACCACAGGCAGAATGACGGGGG - Intronic
1077063626 11:628130-628152 ATCCACAGACAGAAAGTGGACGG - Intergenic
1077608291 11:3626981-3627003 AACTACAGGCAAAATTTGGAGGG + Intergenic
1078464672 11:11541443-11541465 AACTACAGGTGGAAGGTGGATGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081559532 11:44200529-44200551 AACCACAGTCTGAAGCTGGGGGG - Intronic
1082776910 11:57252505-57252527 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1083094427 11:60234936-60234958 AAACACAGGCTGAAAGTGAAGGG + Intronic
1083262151 11:61528985-61529007 AACCACAGGAAGCAGCTGGGAGG + Intronic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1084104245 11:66970632-66970654 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1084118565 11:67056044-67056066 AAACACAGTCAGATGGGGGAGGG - Intergenic
1084912115 11:72398511-72398533 AAACACGGACAGACGGTGGAAGG - Intronic
1085126398 11:74005421-74005443 CACCACAGGCAGGATGTGGTAGG - Intronic
1085930736 11:81080056-81080078 AACCAGAGGGAGGAGGTAGAGGG - Intergenic
1086178245 11:83918413-83918435 TACCACAGGAAGAATGGGGATGG - Intronic
1087686596 11:101272556-101272578 AACCCCTGGCACCAGGTGGAAGG + Intergenic
1087917764 11:103830736-103830758 AGCAGAAGGCAGAAGGTGGAAGG - Intergenic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089184233 11:116604006-116604028 AGCCCCAGGCAGAACCTGGAGGG + Intergenic
1089556068 11:119316577-119316599 ATGCCCAGGCAGAAGGGGGAAGG + Intronic
1090357805 11:126151580-126151602 GACCACAGGTAGAGGGAGGAAGG + Intergenic
1090500237 11:127254146-127254168 ACCCAGAAGCCGAAGGTGGAGGG - Intergenic
1090859540 11:130640633-130640655 GACCCCAGACAGTAGGTGGAAGG + Intergenic
1091025170 11:132135485-132135507 GAGAACAGGCAGAAGGTGTAAGG + Intronic
1091192840 11:133708717-133708739 AGTCAGAGGCACAAGGTGGAGGG - Intergenic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1093009702 12:14093663-14093685 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1093790114 12:23238862-23238884 AACCATAGGCAGATGCTAGAAGG + Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1096160342 12:49371474-49371496 CACAACAGCCAAAAGGTGGAAGG - Intronic
1096380505 12:51153799-51153821 CACAACAGCCAAAAGGTGGAAGG - Intronic
1097680550 12:62645218-62645240 AGCCACAGGGAGATGGTGGTGGG - Exonic
1098651772 12:72979587-72979609 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1099224545 12:79953962-79953984 ACACACAGGCTGAAGGTGAAGGG - Intergenic
1099520012 12:83648909-83648931 AGACACAGGGAGAAGGTGGCTGG - Intergenic
1100234050 12:92639837-92639859 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1101103337 12:101416994-101417016 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1101657586 12:106736761-106736783 AACCAGAGGCACAAGTGGGATGG - Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102398600 12:112609488-112609510 AACAATAGGCAGGAGGTGGAAGG - Intronic
1103613702 12:122139221-122139243 AGCCACTTGCAGAAGGTGCAGGG + Intronic
1103786341 12:123436116-123436138 CACCTCAGGAAGGAGGTGGAGGG - Exonic
1103922311 12:124405366-124405388 AACCAGAGGGTGAGGGTGGAAGG - Intronic
1103967153 12:124647054-124647076 AATCACCGGCAGCAGATGGAGGG + Intergenic
1104328656 12:127824044-127824066 ATCCACAGGAAGCAGGTGGTGGG - Intergenic
1105005578 12:132718724-132718746 AGCCGGAGGCAGAAGGTGGTTGG - Intronic
1106864725 13:33950966-33950988 AGCCACAGGTAGAAGTTGTATGG - Intronic
1109150506 13:58842090-58842112 AATTACAGCAAGAAGGTGGAGGG - Intergenic
1110506345 13:76292063-76292085 AAGCAAAGGCAGGAGATGGAAGG + Intergenic
1110573419 13:77030070-77030092 TGCAACAGGCAGAAGCTGGAAGG + Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113885057 13:113654466-113654488 AAGCACAGGAAGTAAGTGGATGG + Intronic
1113885188 13:113655131-113655153 ACCCAGAGGCAGAACGTGGCCGG - Intronic
1114901658 14:27068009-27068031 ATCCCGTGGCAGAAGGTGGAAGG + Intergenic
1117434517 14:55703343-55703365 AATCACAGGCTGAGGATGGAGGG + Intergenic
1117666268 14:58059527-58059549 ATCCACAGGCAGCAGCTGAAGGG - Intronic
1118151975 14:63199516-63199538 AGCCATGGACAGAAGGTGGATGG - Intergenic
1118782561 14:69018664-69018686 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1119429042 14:74553805-74553827 AGCCAGAGGCAGAAGGTTGAGGG + Intronic
1119604328 14:76001799-76001821 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1120829364 14:88984515-88984537 TGCCCCAGGAAGAAGGTGGAGGG - Intergenic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1121794579 14:96724451-96724473 TTCCACAGGCAGAGGGTTGAAGG - Intergenic
1121835557 14:97088941-97088963 AGGCAGAGGCACAAGGTGGAAGG + Intergenic
1122091794 14:99345803-99345825 AACCCCATGCAGAAGGAGGAGGG + Intergenic
1122229429 14:100298253-100298275 AACCACAAGCGGAGGGTGGGGGG + Intronic
1123460482 15:20465897-20465919 AACCCCCTGCAGAAGGTGGGAGG + Intergenic
1123657580 15:22534519-22534541 AACCCCCTGCAGAAGGTGGGAGG - Intergenic
1124269830 15:28270395-28270417 AACCCCCTGCAGAAGGTGGGAGG + Intronic
1124311490 15:28629717-28629739 AACCCCCTGCAGAAGGTGGGAGG - Intergenic
1124496983 15:30192787-30192809 AACAAAAGGCAGATGCTGGAGGG + Intergenic
1124746593 15:32345860-32345882 AACAAAAGGCAGATGCTGGAGGG - Intergenic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1127214409 15:56809570-56809592 AATCACAGGCAGAAGGACCAAGG - Intronic
1127406610 15:58655349-58655371 AAGCATGGGCAGAAGGTGAAGGG + Intronic
1128434878 15:67636946-67636968 AAAAGCAGGCAGAAGTTGGAAGG + Intronic
1128564062 15:68687769-68687791 ATCCCATGGCAGAAGGTGGAGGG + Intronic
1128625092 15:69193203-69193225 ACCTCCAGGCAGAAGCTGGAGGG + Intronic
1128634865 15:69296749-69296771 AATCACAGGCAGGATCTGGAAGG - Intergenic
1128763906 15:70239189-70239211 AACCCCAAGCAGAAGCTGCAAGG + Intergenic
1129037955 15:72662320-72662342 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129211934 15:74074911-74074933 CACCTGAGGCAGGAGGTGGAAGG - Exonic
1129398469 15:75266173-75266195 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129402077 15:75290449-75290471 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129461633 15:75702807-75702829 AGCCACAGACAGAAGACGGATGG + Intronic
1129723219 15:77889039-77889061 AGCCACAGACAGAAGACGGATGG - Intergenic
1129729060 15:77919225-77919247 CACCTGAGGCAGGAGGTGGAAGG - Intergenic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1130554466 15:84913157-84913179 TACCACCGCCAGAAAGTGGAAGG - Intronic
1130902009 15:88214387-88214409 AGCCACACGCAGAGGGAGGAAGG - Intronic
1131686467 15:94773288-94773310 AACTACAGGCACCAGGTGCAGGG - Intergenic
1132318833 15:100910218-100910240 AGCCACAGGGATAAGGGGGAAGG - Intronic
1133854567 16:9537416-9537438 TACAAGAGGCAGAAGGTAGAGGG - Intergenic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1134814882 16:17197630-17197652 AAAAGCAGGCAGAACGTGGAAGG + Intronic
1135407759 16:22210223-22210245 CTCCAGAGTCAGAAGGTGGATGG + Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1137499110 16:48996998-48997020 AACCACTGGCAGAACCTGCAGGG + Intergenic
1137565752 16:49531560-49531582 ACCCCCAGGCAGAAAGAGGAGGG + Intronic
1138398727 16:56728945-56728967 AACCACACACAGAAGGGTGAGGG - Intronic
1138897010 16:61218846-61218868 CAACACTGGCAGAAGCTGGAGGG - Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140408955 16:74729918-74729940 AACCACAGGCAGGGAGAGGAGGG + Intronic
1141126312 16:81403614-81403636 AGTCACAGGGAGAAGGTGGCCGG - Intergenic
1142764830 17:2059101-2059123 AACCACAGGAAGAGGCGGGAGGG - Exonic
1143306049 17:5947507-5947529 AACAAAGGGCAGAAGGTGTAGGG - Intronic
1143347982 17:6264063-6264085 AACTACACGAGGAAGGTGGAAGG + Intergenic
1143374428 17:6458902-6458924 AAGGACAGGAAGAAGATGGAAGG - Intronic
1143805724 17:9424519-9424541 AACCAGAGGCAGGGGGAGGAAGG - Intronic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1144153850 17:12478575-12478597 TACCACAGGCAGAGGGTTAAGGG + Intergenic
1144654125 17:17024774-17024796 AAGCACAGGCAGAAACTGTAGGG + Intergenic
1144813488 17:18017372-18017394 AGCCACAGGCAAAAGGAGGCCGG + Intronic
1145254733 17:21316384-21316406 AGCCACAGGAAGACGGGGGAGGG - Intergenic
1145321867 17:21771581-21771603 AGCCACAGGAAGACGGGGGAGGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146582611 17:34052533-34052555 AGCCACAGAAAGAGGGTGGAAGG - Intronic
1146820145 17:35978218-35978240 TACTTCAGGCAGCAGGTGGATGG + Exonic
1146833513 17:36090517-36090539 AACCACAGGGATAGGGTTGATGG + Intergenic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1147549450 17:41429189-41429211 AGGAACAGGCAGTAGGTGGAAGG + Intergenic
1148960976 17:51392540-51392562 AACCACCATCACAAGGTGGAGGG + Intergenic
1149340672 17:55682940-55682962 AACCCTAGGCTGAAGGTGTAGGG + Intergenic
1150162687 17:62912566-62912588 ATCCCACGGCAGAAGGTGGAAGG - Intergenic
1150579451 17:66458864-66458886 AAGCAAAGGCAAAAGGGGGAAGG + Intronic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151568635 17:74915019-74915041 AACCAGAGGCAGCAGGATGAGGG - Intergenic
1151934207 17:77251862-77251884 AACCACAGGGAGAAAATAGACGG - Intergenic
1152152208 17:78609297-78609319 AACCCCAGGCAGAAGGGCCAGGG + Intergenic
1152276079 17:79358278-79358300 AACAACAGGCACAAGGGGGAAGG + Intronic
1152391894 17:80008409-80008431 AACCACAACCAGAAGCTGGCCGG - Intronic
1152405319 17:80095053-80095075 ATCCACAGGCAGACAGTGCAAGG - Intronic
1152495033 17:80665136-80665158 AACCAGAGACAGCAGGTGGGAGG - Intronic
1152507030 17:80756241-80756263 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1153281122 18:3415276-3415298 AACCAGAGGCAGAAAGCTGAGGG + Intronic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153795430 18:8617694-8617716 AACAAAAGGCAGAGGCTGGAAGG - Intronic
1155053002 18:22164778-22164800 AACCCCAGGCTGAAGGTGGTGGG - Intergenic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1155602818 18:27568986-27569008 GACCACAGGCTCAAGGTGGCAGG + Intergenic
1155670529 18:28365595-28365617 AGCCACAGGCAGGAGCTGGCTGG - Intergenic
1155868585 18:30997340-30997362 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156821073 18:41373657-41373679 AACAATAGGAAGAGGGTGGATGG + Intergenic
1156974962 18:43209567-43209589 AACCACAGGGAGGAGGCTGAGGG - Intergenic
1157538832 18:48484158-48484180 GGCAACAGGCAGAAGCTGGAAGG + Intergenic
1159898911 18:74023603-74023625 CACCACTGGCAGAAGGTGAAGGG - Intergenic
1161115936 19:2496356-2496378 AAACAAAGGTAGAATGTGGAAGG - Intergenic
1162794306 19:13078697-13078719 AAGCACAGGCAGCGGGTGGTGGG - Exonic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1164883266 19:31754525-31754547 TACTCAAGGCAGAAGGTGGAGGG + Intergenic
1165613005 19:37173170-37173192 AACCACAGGCAGATGATAGGAGG + Intronic
1165683336 19:37796431-37796453 AACCACAGGCAGAATCCGGGAGG - Intronic
1166139899 19:40800036-40800058 AACCAAAGACAGAAGAAGGAGGG - Exonic
1166423180 19:42653968-42653990 AAACACAGACAGAAGGGGAAGGG + Intronic
1167353575 19:48990698-48990720 ACACACAGGCAGCAAGTGGAGGG + Intronic
1167656877 19:50770722-50770744 AACCACAGTCAGTGGGCGGAGGG - Exonic
1167970016 19:53183518-53183540 AAGTACAGCCAGAAGGTGGGGGG - Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
925063921 2:914695-914717 ACCCACAGGCACAAGATGGAAGG + Intergenic
925063941 2:914782-914804 ACCCACATGCAGAAGATGGAAGG + Intergenic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925063982 2:914954-914976 ACACACAGGCAGTAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064039 2:915212-915234 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
927241816 2:20925823-20925845 AAACCCAGGCAGAGGGTGGTGGG + Intergenic
927247855 2:20972213-20972235 AGCCAGAGGGGGAAGGTGGATGG + Intergenic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
929260413 2:39861062-39861084 AACAACATGCAGAACATGGAAGG + Intergenic
929699787 2:44152109-44152131 ATCCCCTGGCAGAAGGTGAAAGG - Intergenic
929847436 2:45544449-45544471 AATCAGAGGCAGTAGGTGGCAGG + Intronic
930198453 2:48530651-48530673 AACAGCAGTCAGAAGGAGGAGGG - Intronic
930511660 2:52352875-52352897 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
930923332 2:56784543-56784565 AAAGACAGGGAAAAGGTGGATGG - Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932344082 2:70984501-70984523 AACCACAGTCTGAAGGATGAGGG - Intronic
932345398 2:70991991-70992013 AACCAGAGGCAGACAGTGCAGGG + Intronic
932432154 2:71682534-71682556 AACCACAGGAAGGAGGTGTCGGG - Exonic
932518990 2:72388048-72388070 CACAACTGGCAGGAGGTGGAAGG + Intronic
932721636 2:74142984-74143006 AAGCTCAGGCAGGGGGTGGATGG - Intronic
932880865 2:75500755-75500777 AGCCTCAGGCAGAAAGGGGAAGG - Intronic
933732340 2:85466798-85466820 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
936993470 2:118389663-118389685 TTCCAAAGGCAGGAGGTGGAGGG + Intergenic
937638317 2:124182774-124182796 AGACACAGGCAGAAGATGAATGG - Intronic
939688877 2:145233022-145233044 AAACAAAGGCAGATGGTGAAGGG - Intergenic
940487069 2:154309510-154309532 AACTCATGGCAGAAGGTGGAAGG + Intronic
940972170 2:159906014-159906036 AAAAGCAGGCAGAAGTTGGAAGG + Intergenic
942676571 2:178433140-178433162 AGCCTCAAGCAGAAGCTGGAGGG - Intronic
943636258 2:190310030-190310052 AAAAGCAGGCAGAAGTTGGAAGG + Intronic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
946332493 2:219018285-219018307 AAACAAAGGCACATGGTGGAGGG + Intronic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
947834427 2:233164930-233164952 AAGCACAGGCGGGAGGTGGCTGG + Intronic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
948570067 2:238912422-238912444 AGCCCCAGGCAGAAGGGGCAAGG + Intergenic
948719254 2:239887894-239887916 TACAACAGTCAAAAGGTGGAAGG + Intergenic
949022342 2:241748695-241748717 CACCAGGGGCTGAAGGTGGAGGG - Intronic
1168957456 20:1844421-1844443 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1170575633 20:17659657-17659679 AACCAGGGGAAAAAGGTGGAGGG - Intronic
1170747683 20:19115320-19115342 AACAGGAGGCAGAAGGTAGAAGG - Intergenic
1171255002 20:23684030-23684052 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171271453 20:23821675-23821697 ACACACAGGGAGATGGTGGAGGG + Intergenic
1173838420 20:46140369-46140391 AGCCACAGGAAGGAGTTGGAGGG + Intergenic
1174766316 20:53257135-53257157 AACCAAAGGGAAGAGGTGGAAGG - Intronic
1174925116 20:54750739-54750761 TACAATAGGCAGAAGGTGAAGGG + Intergenic
1175182874 20:57160869-57160891 AACTGAAGGCGGAAGGTGGAAGG - Intergenic
1175573202 20:60039715-60039737 CACCACAGGCGGCAGGTGGGTGG + Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1177079238 21:16617738-16617760 ATCCCGTGGCAGAAGGTGGAAGG + Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178819499 21:35962382-35962404 ACCCACCCACAGAAGGTGGAGGG - Intronic
1178922169 21:36745869-36745891 AACCCCAGGCAGAAGGTGGAAGG + Intronic
1179718402 21:43301874-43301896 AATCACAGGGAGATGGTGGCTGG + Intergenic
1179724646 21:43335381-43335403 GCCCACAGCCAGGAGGTGGACGG - Intergenic
1181671198 22:24426331-24426353 AAGGACAGACAGAAGATGGATGG + Intronic
1181712511 22:24699482-24699504 TACCAGACGCGGAAGGTGGAAGG + Intergenic
1182041347 22:27241087-27241109 ATCCCACGGCAGAAGGTGGACGG + Intergenic
1182068922 22:27449591-27449613 AACAACAGGCATAAACTGGATGG - Intergenic
1182699092 22:32218541-32218563 CACCACAGCCAGGAGGAGGATGG + Exonic
1182748734 22:32625187-32625209 GCCCACAGGCTGAATGTGGACGG + Intronic
1182873748 22:33672330-33672352 AACCTCAGGAATGAGGTGGAAGG - Intronic
1183244207 22:36681200-36681222 ACCAACAGAAAGAAGGTGGAGGG - Intronic
1183653451 22:39171875-39171897 AAACACAGGCAGACGGGGGATGG - Intergenic
1183758139 22:39790010-39790032 ACCCACAGGCAGGAGGGGGCTGG + Intronic
1185090962 22:48772925-48772947 CACCACGTTCAGAAGGTGGAAGG - Intronic
949439847 3:4068667-4068689 ACACACAGCCAGCAGGTGGAAGG - Intronic
949758251 3:7438696-7438718 AGCCACAGGCAGAAGACTGAAGG - Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
950723632 3:14901769-14901791 ATCCACAGGCAGAAGAGGAAGGG + Intronic
951063275 3:18235137-18235159 AACCACATGCATCAGTTGGATGG + Intronic
952632491 3:35486412-35486434 AACCCCAGGCAGAAAGCAGAGGG - Intergenic
952723215 3:36555067-36555089 AATCACAGGCAGCTGGGGGATGG + Intergenic
953009774 3:39013891-39013913 AACCACAGGGAAAAGATGAAGGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955222914 3:57037907-57037929 AGCCACAGGCTGAAGGGTGATGG - Intronic
955864791 3:63371483-63371505 AAGCCCAGGCAGTAGGTGGCTGG - Intronic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
960655686 3:120001459-120001481 AATCATGGGCAGAAGGTGAAGGG - Intronic
960906441 3:122606459-122606481 AAACACAGGAAGAATGAGGAGGG + Intronic
962487941 3:135863067-135863089 TCCCACTGGCGGAAGGTGGAAGG - Intergenic
962711525 3:138090603-138090625 AGCCAAAGGTGGAAGGTGGAGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963577804 3:147083946-147083968 AACTACAAGCAAGAGGTGGAAGG - Intergenic
963811139 3:149777582-149777604 AGCCAAGGGCAGAAGGAGGAGGG - Intronic
963986118 3:151596939-151596961 AACTACTGGCAGAGTGTGGAAGG - Intergenic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
966338704 3:178901267-178901289 ATCCCATGGCAGAAGGTGGATGG - Intergenic
966393236 3:179475026-179475048 ATCCAATGGCAGGAGGTGGAAGG + Intergenic
966935930 3:184709436-184709458 ACCCTCACGCAGAAGGTGGTGGG + Intergenic
967148225 3:186624843-186624865 AACGACAAGGTGAAGGTGGAGGG + Intergenic
967364180 3:188667144-188667166 AGTCTCAGGCACAAGGTGGAAGG + Intronic
968121789 3:196130999-196131021 GACCAGAGGCAGACGTTGGAGGG - Intergenic
968632990 4:1661743-1661765 AACCACAGGCATGAGGCGGTGGG - Intronic
968832148 4:2938164-2938186 AACCGCAGGCAGCGGGTGGGGGG + Exonic
968880888 4:3299447-3299469 AAAAGCAGGCAGAAAGTGGAGGG - Intronic
969092444 4:4705091-4705113 AGACACAGGGAGAAGATGGATGG + Intergenic
969715089 4:8864480-8864502 CACCACTGGCAGAAGATGAATGG - Intronic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970485612 4:16521688-16521710 GAACAAAGGCAGAAGGTGTAGGG - Intronic
970664915 4:18325865-18325887 AACCCTAGGAAGAAGGTGTAGGG - Intergenic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971316700 4:25573642-25573664 AAAAACAGGCAGTAGTTGGAAGG - Intergenic
971907067 4:32739703-32739725 AACCAGAGGCAAAAGTTGAAAGG + Intergenic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
973804487 4:54512625-54512647 AAATACAGGCAGACTGTGGAAGG - Intergenic
974259284 4:59503848-59503870 AACCTCAAGGAGAAGGTGCATGG - Intergenic
974899873 4:67983890-67983912 AATCCCAGGCATAAGGTGGCAGG + Intergenic
975209961 4:71688545-71688567 AACCACTGCCAGACTGTGGAAGG - Intergenic
975998029 4:80339071-80339093 AACCACAGACAGTAGGAAGATGG - Intronic
976267255 4:83195755-83195777 AAAGAAAGGAAGAAGGTGGAAGG - Intergenic
976455078 4:85237057-85237079 AACTACTGGCAGAATGAGGATGG - Intergenic
977483324 4:97608022-97608044 AACCACAGCTAAAAGGTGGGGGG + Intronic
977706780 4:100080435-100080457 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
978139737 4:105304920-105304942 ACCCACAGCCAGAAGAAGGAAGG + Intergenic
978496244 4:109362237-109362259 AACCACAAGCAGCATGCGGATGG + Intergenic
982094488 4:151909586-151909608 AGCCACAGACAGAGGTTGGAAGG - Intergenic
982627766 4:157788964-157788986 ATCCCACGGCAGAAGGTGGAAGG + Intergenic
983636811 4:169906005-169906027 AACCCAAGGCAACAGGTGGAGGG - Intergenic
984030526 4:174598702-174598724 TACCACAGGCAGGAGGAGGGAGG - Intergenic
984237733 4:177181124-177181146 AACCAAGAGCAGAATGTGGATGG + Intergenic
985709416 5:1419927-1419949 AACCCAAGGCAGAAGTGGGAAGG - Intronic
985717794 5:1472314-1472336 AACCACAGGCTGTAGGTGCTAGG + Intronic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
986319501 5:6616803-6616825 AACAGCTGGCTGAAGGTGGAAGG - Exonic
986344205 5:6819336-6819358 AACATCAGGCAGAAGAGGGAGGG - Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
987771862 5:22315426-22315448 AACGAGAGGAAGAAGGTTGATGG + Intronic
988314728 5:29610117-29610139 ACCCAGAGCCAGAGGGTGGAAGG - Intergenic
989813407 5:45706183-45706205 AACCCCAGCAAGAAGTTGGAGGG - Intergenic
990464108 5:56056147-56056169 AGCCAAAGGGAGAAGGTGGTTGG + Intergenic
991048333 5:62246175-62246197 AACCTCAGGCAGAAAATGTAAGG + Intergenic
991472042 5:66979342-66979364 AACCACAGGAACAAGGAGCAAGG - Intronic
991484845 5:67124189-67124211 ACCCAAGGGTAGAAGGTGGAGGG - Intronic
992528394 5:77632683-77632705 AACCACAGGAAGAAAGTGGTAGG - Intronic
993744915 5:91585540-91585562 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
994007293 5:94853953-94853975 AGACACAGGCAGATGGTGGCAGG + Intronic
994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG + Intergenic
996199800 5:120657817-120657839 AACAAAAAGCAGAAGGTGGGAGG - Intronic
996513799 5:124347465-124347487 AATCTCAGGCAGAAGCTGCAAGG - Intergenic
997603593 5:135156953-135156975 CGCCCCAGGAAGAAGGTGGAGGG + Intronic
998148731 5:139745325-139745347 TGCCACAGGCAGATGGTGGAGGG + Intergenic
999085612 5:148886173-148886195 AAGCCCAGGCAGCATGTGGACGG + Intergenic
999218804 5:149958252-149958274 AATCAAAGGCAGCGGGTGGAGGG - Intergenic
999676087 5:154004390-154004412 AACCACTGGCATAGGATGGATGG - Intronic
999833778 5:155347189-155347211 AAGCCCATGCAGAAGATGGAGGG - Intergenic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1001398167 5:171431399-171431421 GACCGAAGGCAGAAGGTGGGTGG + Intronic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1002000931 5:176195946-176195968 AGCCACAGACAGATGGAGGAAGG + Intergenic
1002253403 5:177943026-177943048 AGCCACAGACAGATGGAGGAAGG - Intergenic
1002257464 5:177968740-177968762 AACTCCTGGCAGAACGTGGAAGG + Intergenic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1003937971 6:10995249-10995271 AACCACAGGCAGCAGGCAGAAGG - Intronic
1004003940 6:11622075-11622097 AACCACTGACAGAAGTTGGGAGG + Intergenic
1004737167 6:18419206-18419228 AGCCATAGGCAGGAGGAGGAGGG - Intronic
1004994962 6:21181474-21181496 ATCCAATGGCAGAAGGTAGAAGG - Intronic
1006834536 6:36989470-36989492 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1007112002 6:39318185-39318207 AACCACACCCAGAAGGGAGAAGG - Intronic
1007278484 6:40692908-40692930 AATCACAGGGAGAAGGTGATGGG + Intergenic
1009929078 6:70154875-70154897 TAAAGCAGGCAGAAGGTGGAAGG - Intronic
1010197957 6:73258651-73258673 GGCCAAAGGCGGAAGGTGGAGGG + Intronic
1010365375 6:75044570-75044592 AAACACAGGCTGAAAGTGAAAGG + Intergenic
1013280736 6:108634564-108634586 AAGCCAAGGCAGAAGGGGGAAGG - Intronic
1013489403 6:110630599-110630621 AACTACAGACAGCAAGTGGAAGG - Intronic
1014482955 6:121961299-121961321 ATCCTATGGCAGAAGGTGGAAGG - Intergenic
1014988791 6:128048141-128048163 AATCACTGGCAGAGGGTGAATGG + Intronic
1015584176 6:134758716-134758738 ACCCACAGGCAGAAACTGCATGG + Intergenic
1016393327 6:143596951-143596973 AGACACAGGCAGAAGGCAGATGG - Intronic
1016603224 6:145887984-145888006 TACCACAAGTAGAAGGGGGAAGG - Intronic
1017561157 6:155629369-155629391 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1018190763 6:161307464-161307486 TAAAGCAGGCAGAAGGTGGAAGG - Intergenic
1018593640 6:165454609-165454631 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1019269532 7:139307-139329 AACCAGAGGCTGCAGGTGCAGGG - Intergenic
1019424574 7:968276-968298 ACCCACAGGCAGAGGGACGAGGG + Exonic
1019726701 7:2606755-2606777 AGCCCCAGCCAGGAGGTGGAGGG + Intronic
1019823680 7:3265902-3265924 AACCACAGGCAAAAGGTATAAGG - Intergenic
1020118237 7:5488242-5488264 GGCCACAGGCAGCAGGTGAATGG + Intronic
1020151924 7:5689142-5689164 AAGCACAGGAGGGAGGTGGAAGG + Intronic
1021385809 7:20028345-20028367 AATCAATGGCAGAAGGTGAAGGG - Intergenic
1021608730 7:22435352-22435374 AACCACAGAGAAAAGCTGGAGGG + Intronic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023905872 7:44521304-44521326 ACCTACAGGCAGAAGGGGAAAGG + Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024135769 7:46406529-46406551 AAACACAATCAGAAGTTGGAGGG - Intergenic
1024944029 7:54791059-54791081 AACAACAGGCAGAGGGTGGGTGG - Intergenic
1025934321 7:66022597-66022619 CACCATAGCCAAAAGGTGGAAGG + Intergenic
1026277342 7:68891657-68891679 AACCCATGGCAGAAGGTGAAGGG + Intergenic
1027878259 7:83799689-83799711 GGGCACAGGCAGAAGATGGATGG + Intergenic
1028042346 7:86069868-86069890 TACCAGAGGCTGGAGGTGGAAGG - Intergenic
1028496122 7:91463265-91463287 CACCTCTGGCAGAGGGTGGAGGG - Intergenic
1029906499 7:104098630-104098652 GAGCACAGGAAGCAGGTGGAAGG + Intergenic
1029952584 7:104602832-104602854 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1030889691 7:114984006-114984028 AACCAAAGGCAACAGGTGCATGG + Intronic
1032761352 7:134946488-134946510 TACCAGAGGCAGAGGGTGGGCGG - Intronic
1033282576 7:140016642-140016664 AACCAAAGCCAGGTGGTGGAAGG - Intronic
1033616821 7:143024322-143024344 ATCCTATGGCAGAAGGTGGAAGG - Intergenic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1034353572 7:150433176-150433198 AACCTCAGGCAGCTGGAGGATGG + Intergenic
1034510347 7:151529056-151529078 AACCTCAGGTAGAAGGTAAAAGG - Intergenic
1034834110 7:154336279-154336301 AACTGCAGGCAGAAGATGCACGG + Intronic
1035300033 7:157891135-157891157 GACCCCAGGGAGAAGGTGCATGG + Intronic
1035742927 8:1942885-1942907 ATCCAGAGACAGAACGTGGATGG + Intronic
1037315314 8:17594888-17594910 CACAACAGCCAGAAGGTGGAAGG - Intronic
1038936664 8:32259440-32259462 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1039908715 8:41807474-41807496 ATTCACAGGAAGAAGGTGAAAGG - Intronic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1043697573 8:83240072-83240094 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
1044666734 8:94640461-94640483 AACCGCAGCCAGGAGGTGGCGGG - Intergenic
1044895268 8:96885176-96885198 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1046747518 8:117892151-117892173 AACCACTGTCAGAAGAAGGATGG - Intronic
1047425558 8:124742392-124742414 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1049312213 8:141939174-141939196 AACCAGAGTCAGAGGGTGGGTGG + Intergenic
1051533593 9:18132315-18132337 AAACACACGCAAAAGGTAGACGG - Intergenic
1053181431 9:35974447-35974469 AAACACAGACAGAAAGTGAAGGG - Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055587028 9:77765803-77765825 CACGACAGCCAAAAGGTGGAAGG + Intronic
1055840111 9:80493526-80493548 ATCCCAGGGCAGAAGGTGGAAGG + Intergenic
1056471450 9:86908415-86908437 ACCCACAGGCACAAGGAGGCGGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058726527 9:107810032-107810054 AGCCACAGGAAGAAGGAGGCAGG - Intergenic
1059077548 9:111210122-111210144 AATAACAGGCAGAAGGTTGTGGG + Intergenic
1059462936 9:114446567-114446589 AAACACATGCAGAAAGTAGAAGG - Intronic
1060032899 9:120231001-120231023 ACCCACAGGCACAGTGTGGATGG - Intergenic
1060746433 9:126136341-126136363 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1060849951 9:126866373-126866395 GGCCACAGTCAGAAGGTGGAGGG - Intronic
1061379738 9:130247281-130247303 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1185647316 X:1624687-1624709 GACCACAGGCAGATGCTGGGAGG + Intronic
1185647334 X:1624749-1624771 GACCACAGGCAGATGCTGGGAGG + Intronic
1186289182 X:8078166-8078188 AACCACACACAAAAGCTGGAAGG - Intergenic
1187169410 X:16836601-16836623 AGCCACAGCCAGCAGGGGGACGG - Intronic
1187550000 X:20293045-20293067 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1187745758 X:22407623-22407645 AAACTCAGGCACAAGGTGGTTGG - Intergenic
1189988883 X:46576209-46576231 AGCTACAGGGAGAAGGGGGAAGG - Intronic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1190326859 X:49211857-49211879 ACCCACGGGCATAAGGTGGCAGG + Intronic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1192163418 X:68806666-68806688 ATCCACAGACAGAAAGTAGAGGG + Intergenic
1194370692 X:93067484-93067506 AACCACAGGCCCAAAGTAGAGGG + Intergenic
1195168018 X:102239359-102239381 ATCCAATGGCAGAAGGTGGGAGG + Intergenic
1195190839 X:102447728-102447750 ATCCAATGGCAGAAGGTGGGAGG - Intronic
1196538742 X:116880547-116880569 AACAAAAGGCAAAAAGTGGAGGG - Intergenic
1198507250 X:137312930-137312952 AAGCACTGGCAGAAGATTGAAGG - Intergenic
1200678484 Y:6179377-6179399 AACCACAGGCCCAAAGTAGAGGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic