ID: 1091689121

View in Genome Browser
Species Human (GRCh38)
Location 12:2583812-2583834
Sequence AGCCGCAGCAACCCAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 428}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091689121_1091689134 24 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689134 12:2583859-2583881 TGTCTGGGTGCCTGGGGCCGGGG 0: 1
1: 0
2: 2
3: 44
4: 426
1091689121_1091689131 18 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689131 12:2583853-2583875 TATGAATGTCTGGGTGCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1091689121_1091689128 9 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689128 12:2583844-2583866 GTGAAATGATATGAATGTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 222
1091689121_1091689135 25 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689135 12:2583860-2583882 GTCTGGGTGCCTGGGGCCGGGGG 0: 1
1: 0
2: 6
3: 67
4: 721
1091689121_1091689133 23 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689133 12:2583858-2583880 ATGTCTGGGTGCCTGGGGCCGGG 0: 1
1: 0
2: 4
3: 46
4: 535
1091689121_1091689127 8 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689127 12:2583843-2583865 TGTGAAATGATATGAATGTCTGG 0: 1
1: 0
2: 3
3: 20
4: 257
1091689121_1091689132 22 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689132 12:2583857-2583879 AATGTCTGGGTGCCTGGGGCCGG 0: 1
1: 0
2: 2
3: 38
4: 403
1091689121_1091689129 16 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689129 12:2583851-2583873 GATATGAATGTCTGGGTGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 146
1091689121_1091689130 17 Left 1091689121 12:2583812-2583834 CCCCAGCCTGGGTTGCTGCGGCT 0: 1
1: 0
2: 5
3: 48
4: 428
Right 1091689130 12:2583852-2583874 ATATGAATGTCTGGGTGCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091689121 Original CRISPR AGCCGCAGCAACCCAGGCTG GGG (reversed) Intronic
900105544 1:979395-979417 AGCCACAGCCTCCCAGGCTCCGG + Exonic
900188783 1:1344738-1344760 GGCTGGAGCAACCCAGGGTGAGG + Intronic
900527428 1:3136044-3136066 AGCCACAGGACACCAGGCTGGGG + Intronic
901934179 1:12616686-12616708 AGCTGCAGCCGCCCAGGTTGGGG + Intronic
902047258 1:13534900-13534922 AGTCTCAGCTACCCATGCTGAGG - Intergenic
902591749 1:17480012-17480034 AGTCCCAGCTACTCAGGCTGAGG + Intergenic
903506590 1:23840016-23840038 TGGCGCAGCCACTCAGGCTGAGG + Intergenic
903548476 1:24141716-24141738 TGCCGAAGCAACACAGGCTGAGG - Intronic
903610049 1:24604492-24604514 AGCCTCAACATCCCAGGCTCAGG - Intronic
903829697 1:26167306-26167328 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
903830464 1:26171239-26171261 AGCAGGAGCCACCCAGGCCGAGG + Exonic
903971449 1:27121637-27121659 AGCCTCAGCAACCCTGGCACTGG + Intronic
904064822 1:27741278-27741300 AGCCGCAGCCTCCCAGGCTCAGG + Intronic
904372810 1:30060953-30060975 AGCTGCAGCTACCCAGGGTGTGG + Intergenic
904460909 1:30679381-30679403 AGCCACAGCAGCCCAAGTTGTGG + Intergenic
904661724 1:32090564-32090586 AGTCCCAGCTACTCAGGCTGAGG - Intronic
904705818 1:32389889-32389911 AGCCTCAACCACCCAGGCTCAGG - Intronic
905398343 1:37682928-37682950 AGCTGCAGCATGCCAGGCCGTGG - Exonic
905435456 1:37952398-37952420 AACAGCAGCATCCCAGCCTGAGG + Intergenic
906206548 1:43990500-43990522 AGCAGCTGCCAGCCAGGCTGTGG - Exonic
907171197 1:52466784-52466806 AGTCCCAGCTACTCAGGCTGAGG - Intronic
907305396 1:53510079-53510101 AGCCGCAGCAGCCCTGCCTCTGG - Intronic
907369763 1:53993108-53993130 AGCCGCAGCCACCCAAGTTGTGG - Intergenic
908198586 1:61770826-61770848 AGCCTCAGCCTCCCAGGCTCAGG - Intronic
910458914 1:87427136-87427158 AGCTGCAGCAAGCAGGGCTGAGG - Intergenic
910655449 1:89614005-89614027 AGCCTCAGCTTCCCAGGCTCAGG + Intergenic
910712779 1:90199057-90199079 AGCAGCTGCCACCAAGGCTGAGG + Intergenic
910863321 1:91764560-91764582 AGCCACAGCTCCCCCGGCTGCGG + Intronic
913163310 1:116164793-116164815 AGCCTCAGCCACCCAGCCTGGGG + Intergenic
914249426 1:145909216-145909238 AGCCTCAACCTCCCAGGCTGAGG - Intronic
914316196 1:146514035-146514057 AGCTGCAGCAAGCAGGGCTGAGG - Intergenic
914498159 1:148219326-148219348 AGCTGCAGCAAGCAGGGCTGAGG + Intergenic
914950862 1:152112314-152112336 AGCAGCAGCAGCAAAGGCTGAGG - Exonic
915207599 1:154282104-154282126 AGTCCCAGCCACTCAGGCTGAGG - Intergenic
915307932 1:154991734-154991756 AGTCCCAGCTACTCAGGCTGAGG + Intronic
915337139 1:155151314-155151336 AGTCCCAGCTACTCAGGCTGAGG + Intergenic
915517261 1:156420813-156420835 GACCGCAGCGACCCAGGCAGAGG + Intronic
915637329 1:157195822-157195844 AGCTGCAGCAGCCCAGGTTGTGG + Intergenic
915933687 1:160077371-160077393 AGCCTCAGGAACCCAGCCTGAGG + Intergenic
916586566 1:166154617-166154639 ACCCTCAGCAAACCTGGCTGGGG + Intronic
917821764 1:178770096-178770118 AGCCTCAGCCTCCCAGGCTCAGG + Intronic
918320055 1:183355690-183355712 AGCCACAGGAGCCCAGGCTGGGG - Intronic
920195302 1:204222635-204222657 TGCCGCAGGGAGCCAGGCTGGGG - Exonic
920224313 1:204427019-204427041 AGTCCCAGCTACTCAGGCTGAGG + Intronic
921097693 1:211901458-211901480 AGCTACAGCCACCCAAGCTGGGG + Intergenic
921692213 1:218164747-218164769 AGCCGCCGCACCCCGGGCAGCGG - Intergenic
922536259 1:226383058-226383080 AGCAGCAGGAGCCGAGGCTGTGG + Exonic
922972008 1:229750181-229750203 AGCTCCAGCAGCCCAGGCTGTGG + Intergenic
923041825 1:230325152-230325174 AGGCCCAGAAGCCCAGGCTGAGG + Intronic
924746961 1:246844640-246844662 AGCCTCAGCTTCCCAGGCTCAGG - Intronic
1064537851 10:16377011-16377033 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
1066373688 10:34838427-34838449 GGCCACAGCCACCCAGTCTGTGG - Intergenic
1066510242 10:36087500-36087522 AGCCACAGCCACGCAGGCTGGGG + Intergenic
1066780827 10:38943015-38943037 AGCCGCAGTGGCCCAGGCAGGGG - Intergenic
1067122193 10:43483122-43483144 AGCAGAAACAACCCAGGTTGGGG + Exonic
1067178805 10:43969851-43969873 AGCAGCAGCCCCACAGGCTGAGG + Intergenic
1067286482 10:44911231-44911253 AGCGGCTCCAGCCCAGGCTGGGG + Exonic
1067806737 10:49397910-49397932 AGCGGCAGCAGCCCAGCCCGGGG + Intergenic
1068865840 10:61895004-61895026 AACCGCTGCAACCCAGGAGGCGG + Intergenic
1069920309 10:71812102-71812124 GGCTGCCGAAACCCAGGCTGTGG + Intronic
1069991791 10:72320792-72320814 CAGGGCAGCAACCCAGGCTGAGG - Intergenic
1070344698 10:75530557-75530579 TGGCACAGCAACCCAGGGTGAGG - Intronic
1070589324 10:77790235-77790257 AGCTGCAGGAAGCCAGGTTGAGG - Intergenic
1070798994 10:79233973-79233995 GGCGAGAGCAACCCAGGCTGAGG + Intronic
1073311387 10:102545235-102545257 AGTCCCAGCTACCCAGGGTGGGG - Intronic
1075027769 10:118999160-118999182 AGCTGGAACAACTCAGGCTGGGG + Intergenic
1075121827 10:119670013-119670035 AATCGCTGCATCCCAGGCTGGGG - Exonic
1075324584 10:121520722-121520744 AGCCTCAGCCTCCCAGGCTCAGG + Intronic
1075657848 10:124173797-124173819 AGCCGTAGCACCCCAGGCCCTGG - Intergenic
1075715439 10:124552601-124552623 AGCCACTGCCCCCCAGGCTGGGG + Intronic
1076152900 10:128177889-128177911 TGCAGCAGAAACGCAGGCTGTGG - Intergenic
1076356716 10:129858574-129858596 AGCCCCAGGCACCCAGGCTGGGG - Intronic
1076507505 10:130987655-130987677 AGGGGCAGCCACGCAGGCTGGGG - Intergenic
1076522820 10:131091450-131091472 GTCCGCAGCACCCCAGGGTGGGG + Intergenic
1076554218 10:131311570-131311592 AGCAGCAGCAGCCCCGGCGGCGG - Exonic
1076611763 10:131730376-131730398 AGCTCCTGCAACCCAGGCTGTGG - Intergenic
1076648625 10:131971788-131971810 AGCCCCAGGAGCCCTGGCTGTGG - Intronic
1077372042 11:2186937-2186959 AGCCACTGCAACCCCCGCTGAGG + Intergenic
1077434853 11:2534049-2534071 CGCAGCAGAAACCCAGGCAGTGG - Intronic
1078195695 11:9134974-9134996 AGTCTCAGCTACTCAGGCTGAGG + Intronic
1078315289 11:10289268-10289290 AGCTGCAGCTGCCCAAGCTGGGG - Intronic
1078413947 11:11150016-11150038 AACAGCAGCATCCCAGGCAGAGG - Intergenic
1078852823 11:15179684-15179706 TGCCCCAGCACCCCAGCCTGTGG - Intronic
1079000754 11:16753405-16753427 AGCCACTGCACCCCAGCCTGGGG - Intronic
1079411051 11:20187904-20187926 ATCTGCAGCATCCCAGGCTGAGG - Intergenic
1079648500 11:22896503-22896525 AGTCCCAGCTGCCCAGGCTGAGG + Intergenic
1080695657 11:34601015-34601037 GGCTGCAGTATCCCAGGCTGAGG + Intergenic
1081638181 11:44734784-44734806 AGAGGCAGCAACACAGGGTGGGG - Intronic
1081760818 11:45575431-45575453 AGGGGCAGGAACCCAGGCTTTGG - Intergenic
1083041520 11:59691961-59691983 AGCCCCAGCTACTCAGGATGGGG - Intergenic
1083127651 11:60587631-60587653 AATCCAAGCAACCCAGGCTGAGG - Intergenic
1083333316 11:61909172-61909194 AGCCGCAGCAACCAGGGCTGGGG + Intronic
1083419885 11:62546702-62546724 AGCCGCAGCACCGCAGCCTTGGG - Exonic
1084800694 11:71541924-71541946 ACACACAGCAACACAGGCTGTGG + Intronic
1085051785 11:73383761-73383783 AAAGGCAGCAACCCAGGATGAGG + Intronic
1086215238 11:84371332-84371354 AGCCTCAACCACCCAGGCTCAGG + Intronic
1086499426 11:87436954-87436976 AGCCACAGCAACCCAGAGTGTGG + Intergenic
1086727995 11:90212748-90212770 AGTTGCAGCTACTCAGGCTGAGG - Intronic
1088866995 11:113857945-113857967 AGCCTCGGCATCCCAGGCTCAGG + Intronic
1089453519 11:118612571-118612593 AGAGGCCGGAACCCAGGCTGGGG - Intronic
1090293922 11:125569657-125569679 AGCCCCACCAACCCACGCTCGGG - Intronic
1090716858 11:129438769-129438791 AGACGCAGCAAGCCAGGCGCTGG + Intronic
1091036367 11:132237589-132237611 AGTCTCAGCATCTCAGGCTGAGG + Intronic
1091689121 12:2583812-2583834 AGCCGCAGCAACCCAGGCTGGGG - Intronic
1091745893 12:2992624-2992646 AGCAGCCCAAACCCAGGCTGGGG - Intronic
1091798028 12:3308428-3308450 GGCAGCAGCAACCAAGGCTCAGG + Intergenic
1091971428 12:4790126-4790148 AGCCTCAGCCTCCCAGGCTCAGG - Intronic
1092318743 12:7448039-7448061 AGCTGAAGCCACCCAGTCTGTGG + Intronic
1092761221 12:11812963-11812985 GGCCCCAGGAACCCTGGCTGCGG + Intronic
1093952769 12:25182491-25182513 AGTCCCAGCTACTCAGGCTGAGG + Intronic
1095603093 12:44037145-44037167 AGCTGCAGCCACCCAAGCCGTGG + Intronic
1095810354 12:46368017-46368039 AGTCTCAGCTACTCAGGCTGAGG + Intronic
1095897005 12:47289653-47289675 AGCCACTGCACCCCAGCCTGGGG - Intergenic
1097275046 12:57807438-57807460 AGCCTCAGCATACCAGGCAGTGG - Exonic
1097356786 12:58611186-58611208 ACCCGCAGCAACACAGTATGGGG - Intronic
1097868109 12:64576767-64576789 AGCCTCAACCTCCCAGGCTGAGG - Intergenic
1100297966 12:93280233-93280255 AGCTGCAGTCACACAGGCTGGGG + Intergenic
1103049724 12:117768609-117768631 AGCAGCAGGAGCCCAGCCTGAGG + Intronic
1103662558 12:122532957-122532979 AGTCCCAGCTACTCAGGCTGAGG + Intronic
1104779931 12:131413562-131413584 AGCTGCAGGAGCCCAGGGTGAGG - Intergenic
1104858715 12:131913847-131913869 AGCCCCATCCACCCAGCCTGGGG - Intronic
1104898495 12:132175735-132175757 AGCCCCAGAAACCCAGGCCAGGG - Intergenic
1104948202 12:132426826-132426848 TCCCGCAGCAACGCAGGCTCAGG + Intergenic
1105635588 13:22212489-22212511 AGTCCCAGCTACTCAGGCTGAGG + Intergenic
1105995253 13:25665070-25665092 AGCAGAAGCAACAAAGGCTGTGG + Intronic
1107188117 13:37547528-37547550 AGCAGCAGCAGCTCTGGCTGTGG - Intergenic
1108255430 13:48605082-48605104 AGTCTCAGCTACTCAGGCTGAGG + Intergenic
1108327541 13:49348484-49348506 AGCCTCAGCCTCCCAGGCTCAGG - Intronic
1108710395 13:53027607-53027629 AGCCGCAACCTCCCAGGCTCAGG + Intergenic
1109134817 13:58634291-58634313 AGCCTCAGCCACCCGGGCTCAGG + Intergenic
1112238792 13:97660676-97660698 AGCCGGTGCAAGGCAGGCTGGGG + Intergenic
1112609848 13:100945627-100945649 GGCTGCAGCAGCCCAGGTTGAGG - Intergenic
1113329417 13:109314218-109314240 AGCCTCAGCAACCCGTGCTCAGG - Intergenic
1113379061 13:109786491-109786513 AGCAGCAGCAGCCCCGGCGGCGG - Exonic
1113390534 13:109892339-109892361 TGATGCAGCAACCCAGGCAGAGG - Intergenic
1113818410 13:113192470-113192492 AGACACAGCTACCCAGGCTTGGG + Intronic
1115906675 14:38209434-38209456 CGCCGCAGCTGCCCGGGCTGGGG - Exonic
1116081287 14:40175801-40175823 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
1117497299 14:56318390-56318412 AGCAGCAGCATCTCTGGCTGTGG - Intergenic
1119258564 14:73221666-73221688 AGTCTCAGCTACTCAGGCTGAGG - Exonic
1119357424 14:74018974-74018996 AGCCGCGGCCACGCTGGCTGCGG + Intronic
1119739803 14:77007032-77007054 AGCTGCAGCAACTGAGGCAGGGG - Intergenic
1123018168 14:105385315-105385337 AGCCCGAGAAACCCAGGCTGTGG - Intronic
1123689309 15:22823664-22823686 AGCAGCCGCAACCCAGGAGGTGG - Intronic
1124109477 15:26773015-26773037 AGCAGGAGCAGCCCCGGCTGCGG - Exonic
1124237674 15:28004016-28004038 AGCCGCTGCCACCCAGGCCCTGG + Intronic
1124933395 15:34146062-34146084 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1125484341 15:40102031-40102053 AGCCAGAGCCACCCAAGCTGGGG - Intronic
1126923397 15:53553365-53553387 AGCTGCCTCAACCCAGGTTGTGG + Intronic
1127148647 15:56050978-56051000 AGTCCCAGCTACGCAGGCTGAGG - Intergenic
1127809968 15:62557190-62557212 AGTGGCAGTGACCCAGGCTGGGG + Intronic
1127940704 15:63693060-63693082 AACCCCAGCCACTCAGGCTGAGG + Intronic
1128339838 15:66813725-66813747 CGAGGCAGCAACCCTGGCTGGGG - Intergenic
1129349466 15:74946544-74946566 TGCGACACCAACCCAGGCTGTGG + Intergenic
1129414632 15:75368386-75368408 AGCTGCAGCCACCCGGGCCGCGG - Intronic
1130183058 15:81651312-81651334 AGCTGCAGCCACCCAAACTGTGG + Intergenic
1130653495 15:85775780-85775802 AGCCTCTGCAACCCAGGCAGGGG - Intronic
1131518613 15:93096579-93096601 AGTCCCAGCTACCTAGGCTGAGG - Intergenic
1132117755 15:99149955-99149977 AGCCACTGCACCCCAGGCAGGGG - Intronic
1132468783 16:90227-90249 AGCTGCAGCAGCACAGGGTGGGG - Intronic
1132491689 16:235107-235129 TGCCACTGAAACCCAGGCTGCGG - Intronic
1132516572 16:368763-368785 CGCCTCAGCACCCCAGCCTGGGG + Intronic
1132523061 16:400322-400344 AGCAGCATCCACCCAGCCTGAGG + Exonic
1132730153 16:1357076-1357098 AGCCCAAGCACCCCAGGCTGTGG + Intronic
1133193905 16:4154739-4154761 AGCAGCAGGAACCAAGGCTGAGG + Intergenic
1133221772 16:4321996-4322018 AGCTCCAGAAACCGAGGCTGGGG + Intronic
1133293486 16:4737906-4737928 AGCTGCAGCGACCCAGGCCCTGG - Exonic
1134062821 16:11209352-11209374 AGTCCCAGCTACTCAGGCTGAGG + Intergenic
1134257311 16:12622866-12622888 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
1134680806 16:16123899-16123921 AGTCGCAGCTACTCAGGCTGAGG + Intronic
1135300228 16:21320328-21320350 TGCCCCATCACCCCAGGCTGAGG + Intergenic
1135335264 16:21596469-21596491 AGCCTCAGCCTCCCAGGCTCAGG + Intergenic
1135413709 16:22253395-22253417 AGCCACAGCCCCCCAGGGTGGGG - Intronic
1137268123 16:46885009-46885031 AACCGCAGCAGCCCCAGCTGGGG + Intronic
1137274708 16:46925740-46925762 AGCCGCAACCTCCCAGGCTCAGG - Intronic
1137308094 16:47224915-47224937 AGCCTCAACCTCCCAGGCTGAGG - Intronic
1137554206 16:49460531-49460553 AGCCGCACCAACCCAGCTGGAGG + Intergenic
1137671522 16:50282144-50282166 GGCCGGAGGAAGCCAGGCTGTGG + Intronic
1139489836 16:67280200-67280222 AGCCGGGGCCACCCAGGATGAGG + Exonic
1139677344 16:68533289-68533311 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1139747578 16:69087065-69087087 AGCCTCAGCAAGCCAGGTGGAGG - Intergenic
1139829206 16:69783050-69783072 CGCCGCTGCACCCCAGCCTGGGG - Intronic
1139962831 16:70727827-70727849 AGGCCCAGCCACCCAGTCTGGGG - Intronic
1140414908 16:74767590-74767612 AGACGCAGCAACAGAGGCAGAGG + Intronic
1141875275 16:86819826-86819848 AGCGCCAGCATCCCCGGCTGGGG - Intergenic
1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG + Intronic
1142643956 17:1300293-1300315 AGCCTCAGCAACCCAGGGAGAGG + Exonic
1142810848 17:2394937-2394959 AGCCGCCCCCACCCACGCTGGGG - Exonic
1143563319 17:7707751-7707773 AGCAGCAGGAAGCCAGGCTCAGG - Intronic
1143815771 17:9513245-9513267 AGTCCCAGCTACTCAGGCTGAGG + Intronic
1144299310 17:13908769-13908791 AGTCCCAGCTACTCAGGCTGAGG + Intergenic
1144955796 17:19018221-19018243 ACCCGCTGGAACCCTGGCTGTGG - Intronic
1145710067 17:26963312-26963334 AGCCGCAGCGGCCCAGGCAGGGG - Intergenic
1145942744 17:28751565-28751587 AGCCTCAGTGAGCCAGGCTGGGG + Intergenic
1146410459 17:32579184-32579206 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1148155440 17:45422333-45422355 AGCCTCAGCCTCCCTGGCTGAGG - Intronic
1148241607 17:46002745-46002767 GGAAGCAGCCACCCAGGCTGCGG - Intronic
1148861663 17:50607740-50607762 GTTCGCAGGAACCCAGGCTGTGG + Intronic
1151743661 17:76000624-76000646 GGGAGCTGCAACCCAGGCTGTGG + Intronic
1151888465 17:76938105-76938127 AGCTGCTGAAACTCAGGCTGCGG - Exonic
1152392752 17:80012397-80012419 AGCCGCAGCCAACCAGCCGGTGG + Intronic
1152558796 17:81067691-81067713 AGCAGCAGCAACGCCGGCAGAGG - Intronic
1152731941 17:81976922-81976944 TCCCGCACCAACCCATGCTGAGG - Intronic
1152755118 17:82083987-82084009 AGACGCGGCAGCCCAGACTGAGG + Exonic
1152941745 17:83176442-83176464 AGCAGCAGCAGCGGAGGCTGGGG + Intergenic
1153223911 18:2883537-2883559 AGCCACAGCCACACAGGATGGGG - Intronic
1153952947 18:10072289-10072311 AACCCCAGCAGCCCAGCCTGGGG + Intergenic
1154078201 18:11225839-11225861 AGCCGCTGCAGCCGAGGCTTGGG - Intergenic
1155077686 18:22374968-22374990 AGCCTCAGCCTCCCAGGCTCAGG - Intergenic
1155229116 18:23756770-23756792 AGCCACGGCATCCCAGGCTCGGG + Intronic
1155403988 18:25467739-25467761 GGCTCCAGCAGCCCAGGCTGTGG - Intergenic
1155949381 18:31892933-31892955 AGCCGCAGCCTCCCAGGCTCAGG - Intronic
1156244529 18:35284732-35284754 AGCTGTAGCCACCCAGGTTGTGG - Intronic
1156565462 18:38184107-38184129 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
1156859463 18:41818950-41818972 AGCCCCAGCATCCCCGCCTGGGG - Intergenic
1157419012 18:47529896-47529918 AGCTTGAGAAACCCAGGCTGAGG + Intergenic
1157568205 18:48694376-48694398 AGCCACAGGAACCCTGGCAGTGG + Intronic
1158743443 18:60169270-60169292 AACCCCAGCTACTCAGGCTGAGG - Intergenic
1159948460 18:74460991-74461013 AGCAGCAGCAGCCCTGGCTCTGG - Intergenic
1160731021 19:641854-641876 AGCGGCAGACACCCAGGCCGGGG + Intronic
1161039993 19:2105199-2105221 AGGGGCAGCAGCCCAGGCTGGGG + Intronic
1161083813 19:2324637-2324659 AGCAGCAGCAAAACAGGCGGCGG + Intronic
1161332679 19:3695803-3695825 AGCCTCAGCCTCCCAGGCTCAGG + Intronic
1161368015 19:3892282-3892304 AGCCTCCACATCCCAGGCTGAGG + Intronic
1161550905 19:4911562-4911584 AGCCGCAGCACAGCAGGCTCAGG - Intronic
1161719467 19:5895062-5895084 CCCAGCAGGAACCCAGGCTGTGG + Intronic
1162048826 19:8019668-8019690 AGTCCCAGCTACTCAGGCTGAGG + Intronic
1162933166 19:13967105-13967127 AGCCTAAGCACCCCAGGTTGGGG + Intronic
1163255329 19:16152736-16152758 AGCAGCAGTAACTGAGGCTGTGG + Intronic
1163427457 19:17247009-17247031 AGCCCCAGCCACCCAGACTGTGG + Intronic
1163441737 19:17325333-17325355 AGCAGCAGCAGCGCAGGCGGCGG - Exonic
1164457466 19:28420707-28420729 ACCCGAATCAGCCCAGGCTGGGG + Intergenic
1165375068 19:35436066-35436088 AGCCAGAGGACCCCAGGCTGTGG + Intergenic
1166334192 19:42095622-42095644 GGCCGTCGAAACCCAGGCTGGGG + Exonic
1166675863 19:44740724-44740746 AGCCTCAGCCCCCCAGGCTCAGG + Intergenic
1166969491 19:46555273-46555295 TGCCACAGCACCCCAGCCTGGGG + Intronic
1168080455 19:54006324-54006346 TACCACAGCCACCCAGGCTGTGG - Intronic
1168139650 19:54376684-54376706 AGCCACTGCACCCCAGCCTGGGG + Intergenic
1168687463 19:58357450-58357472 AGCGGCAGCAAGCCACACTGGGG - Exonic
925040791 2:731873-731895 AGCCCTGGCCACCCAGGCTGGGG + Intergenic
925191945 2:1892203-1892225 AGCAGCAGCAACCTGAGCTGCGG - Exonic
926120215 2:10237642-10237664 TGCCGCAGCCCCCCGGGCTGAGG + Intergenic
929187890 2:39114175-39114197 AGCCTCAACATCCCAGGCTCAGG + Intronic
929769947 2:44883441-44883463 AGAGGCACCAAGCCAGGCTGAGG - Intergenic
932054847 2:68433325-68433347 AGCGGCAGCTGCCCAAGCTGTGG - Intergenic
932501705 2:72188024-72188046 AGCTGCAGCCACCCAAACTGTGG - Intronic
933058075 2:77698917-77698939 AGCCACTGCACCCCAGCCTGGGG + Intergenic
933863772 2:86497661-86497683 AGCCTCAACCTCCCAGGCTGAGG + Intergenic
935292922 2:101625148-101625170 AGCCTCAGCAGTCAAGGCTGCGG - Intergenic
937466729 2:122139530-122139552 AGCCACATCAACCTGGGCTGAGG - Intergenic
937543615 2:122988978-122989000 AGCTGCAGCTACCCATGTTGGGG + Intergenic
938935944 2:136127667-136127689 AGCCCCAGCATGCCAGGCTTAGG + Intergenic
940328235 2:152447690-152447712 AGCAGCAGTAATCCAGGCAGAGG - Intronic
942302361 2:174574006-174574028 AGTCGCAGCTACCCAGGAGGCGG - Intronic
942531059 2:176911015-176911037 AGCTGCAGCACCCCACACTGGGG - Intergenic
946243236 2:218369597-218369619 AGTCCCAGCCACTCAGGCTGGGG - Intergenic
946247090 2:218394089-218394111 AGCAGCAGGAGCCTAGGCTGAGG - Intronic
946334866 2:219029864-219029886 GGCAGCAGACACCCAGGCTGAGG + Intronic
946945356 2:224815915-224815937 AGTCCCAGCTACTCAGGCTGAGG + Intronic
947810319 2:233000081-233000103 AGCCTCTGCAAGCCAGGATGGGG - Intronic
948125630 2:235563005-235563027 AGCCGCTGCACACCAGCCTGGGG + Intronic
948444069 2:238018605-238018627 CGCCACAGCACTCCAGGCTGGGG - Intronic
948796377 2:240404407-240404429 GGCCGCAACTACCCCGGCTGAGG + Intergenic
948887671 2:240892243-240892265 GGCAGCAGCAGTCCAGGCTGGGG + Intronic
949060502 2:241953811-241953833 AGCCGGAGGTGCCCAGGCTGTGG + Intergenic
1168786256 20:543136-543158 CGCCCCAGCAACCCCGCCTGGGG + Intronic
1169294192 20:4378768-4378790 AGCCTCAGCTACCCAGGCTCAGG + Intergenic
1171250139 20:23640348-23640370 GTCCGCAGCATCCCAAGCTGGGG - Intergenic
1171528766 20:25837368-25837390 AGCCGCAACCTCCCAGGCTCAGG + Intronic
1171548060 20:26018518-26018540 AGCCGCAACCTCCCAGGCTCAGG - Intergenic
1172705944 20:36881946-36881968 AGCGGCAGAAACCCATTCTGGGG + Intronic
1173458430 20:43222465-43222487 AGCCACAGCACTCCAGCCTGGGG + Intergenic
1173939099 20:46894846-46894868 AGCCGCGGCAGCCCAGGAGGCGG + Exonic
1174109340 20:48187391-48187413 TGGGGCAGCAACCCAGGCAGAGG + Intergenic
1174202132 20:48814081-48814103 AGGCCAAGGAACCCAGGCTGCGG + Intronic
1174287404 20:49482904-49482926 GGCCGCAGAAGCCCAGGGTGGGG - Intergenic
1175237261 20:57523841-57523863 AGCCACAGCAACCCAGGGCCAGG + Exonic
1176207943 20:63900493-63900515 AGCCTCAGCCTCCCAGGCTCAGG - Intronic
1177262420 21:18748504-18748526 AGCTGCAGCCACCGAAGCTGTGG - Intergenic
1179094205 21:38297294-38297316 AGGGGCAGCAAGCCAGGCTTGGG - Intronic
1179771146 21:43618142-43618164 AGTCCCAGCTACCCAGGCTGAGG + Intronic
1179958674 21:44755923-44755945 AGCCTCAACCTCCCAGGCTGAGG - Intergenic
1180083125 21:45495494-45495516 AGCTGCAGGACCCCAGGCTGTGG - Intronic
1180138216 21:45875125-45875147 AGCGGCAGCCAGACAGGCTGGGG + Intronic
1180931791 22:19597067-19597089 AGAGGCAGCAACACAGCCTGGGG - Intergenic
1180977143 22:19854685-19854707 AGGCACTGCGACCCAGGCTGGGG + Exonic
1181314486 22:21962632-21962654 GGCCCCGGCCACCCAGGCTGGGG - Intronic
1181476483 22:23170886-23170908 AGCCACAGCACGCCAGCCTGGGG - Intergenic
1181840526 22:25655383-25655405 AGCAGCAGCATTCTAGGCTGGGG - Intronic
1182553862 22:31118168-31118190 ACCCTCAGCAGCCCAAGCTGTGG - Intronic
1183316754 22:37141301-37141323 AGCTGCAGCTACCCAAGTTGTGG + Intronic
1183343155 22:37293204-37293226 AGCCACTGCAGCCCAGGCAGAGG - Intronic
1183707395 22:39482824-39482846 CTCAGCAGCAACCCAGACTGAGG + Intronic
1183887965 22:40900849-40900871 AGCCTCTGCCACCCAGGCTCTGG - Intronic
1183916427 22:41124127-41124149 AGTCCCAGCTACTCAGGCTGAGG + Intronic
1184244218 22:43227732-43227754 AGCAGCTGCACCCCAGGCTAGGG + Intronic
1184608385 22:45587195-45587217 AGTCACAGCAACGCCGGCTGTGG - Intronic
1184731421 22:46373085-46373107 GGCCCCTGCATCCCAGGCTGAGG + Intronic
1184768429 22:46584662-46584684 AGCCCCAGCCAGCCATGCTGCGG - Intronic
1184772827 22:46607883-46607905 AGTCGCGGCACCGCAGGCTGAGG - Intronic
1184796906 22:46738104-46738126 AGCCGCTGCAATCCGTGCTGTGG - Exonic
1184815219 22:46863778-46863800 AGCAGGTGCAACCCGGGCTGAGG - Intronic
1185205594 22:49536025-49536047 AGCCTCAGGAAGCCAGGCCGGGG + Intronic
949188067 3:1218052-1218074 AGCCACAGCAGTCCAGCCTGAGG + Intronic
949905131 3:8852718-8852740 AGCAGCAGCAACCAAGGCTGAGG + Intronic
950704755 3:14772907-14772929 AGCCCCAGCACCCCGGGCCGGGG - Exonic
952746581 3:36787556-36787578 AGCCTCAGGAACCCAAGCTGAGG - Intergenic
953980503 3:47410802-47410824 TGCCCCAGGACCCCAGGCTGAGG - Exonic
954684575 3:52363449-52363471 AGCTTCAGAACCCCAGGCTGGGG + Intronic
954830528 3:53417684-53417706 AGCCGCAGCAACAAAGGCTGTGG - Intergenic
955991302 3:64630459-64630481 AGTCCCAGCTACTCAGGCTGAGG + Intronic
956158728 3:66325646-66325668 AGGCCCAGCAGCCCAGGCAGAGG + Intronic
956990114 3:74752382-74752404 AGCTGCAGCCACCCAAGTTGTGG - Intergenic
958423641 3:93956413-93956435 AGCCTCAGCCTCCCAGGCTTAGG - Intronic
960973627 3:123156191-123156213 AGCCAAAGGAAGCCAGGCTGGGG + Intronic
961423117 3:126822985-126823007 AGCCTCAGCCTCCCAGGCTTAGG + Intronic
961493520 3:127274175-127274197 AGCTGCAGCCACCCAAACTGTGG + Intergenic
962105379 3:132383550-132383572 AGCTGCAGCCACCCAAGCTGTGG - Intergenic
962786073 3:138769050-138769072 AGCTGCAGCTACCCAAACTGTGG - Intronic
964996680 3:162891327-162891349 AGCTGCAGCCACCCAAGTTGTGG + Intergenic
966154604 3:176902388-176902410 AGACCCAGCATCCCAGGATGAGG + Intergenic
966578888 3:181536918-181536940 AGCCTCAGCCTCCCAGGCTCAGG + Intergenic
966608103 3:181842175-181842197 AGTCCCAGCTACTCAGGCTGAGG + Intergenic
968001552 3:195210052-195210074 AGCAGCTGCAGTCCAGGCTGAGG + Intronic
968051240 3:195656428-195656450 AGCCGCAGCAGCCCACAGTGAGG - Intergenic
968104583 3:195991910-195991932 AGCCGCAGCAGCCCACAGTGAGG + Intergenic
968132929 3:196202573-196202595 AGGAGCAGGAACCCAGGCAGAGG + Intronic
968302874 3:197629493-197629515 AGCCGCAGCAGCCCACAGTGAGG + Intergenic
968431023 4:558860-558882 CGCCACTGCACCCCAGGCTGGGG + Intergenic
968588210 4:1443852-1443874 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
970806145 4:20035642-20035664 AGCCTCAACCACCCAGGCTCAGG - Intergenic
972478730 4:39477854-39477876 AGTCCCAGCTACTCAGGCTGAGG + Intergenic
972741396 4:41890110-41890132 AGCCCCAGCAAGCCAGGCTCTGG - Intergenic
975254439 4:72216662-72216684 AGCTGCAGCCACCCAAGTTGTGG - Intergenic
976388190 4:84483373-84483395 ATGCCCAGCACCCCAGGCTGAGG + Intergenic
976519408 4:86008710-86008732 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
976753153 4:88471085-88471107 AGCCCCAGCTACTCAGGCTGAGG - Intronic
977938370 4:102830782-102830804 AGCCTCAACCTCCCAGGCTGAGG - Intronic
978433020 4:108653141-108653163 AGCCTCAGCTTCCCAGGCTCAGG - Intronic
980731038 4:136824316-136824338 AGCTGCAGCCGCCCAAGCTGGGG - Intergenic
981491829 4:145347896-145347918 AGCAGCAGCACTCCAGGTTGAGG + Intergenic
981692238 4:147522500-147522522 AGCAGCTGCACTCCAGGCTGGGG + Intronic
982390266 4:154856238-154856260 AGCCACAACCACCCAGGCTCAGG - Intergenic
984687031 4:182680589-182680611 AGCCGCTGAAACACAGGCAGCGG - Exonic
985507929 5:295068-295090 AGCCGCAGCAGCCCACAGTGAGG - Intronic
985573046 5:660770-660792 GGCCGCAGCAGCCCAGGATGGGG + Exonic
985689693 5:1300245-1300267 AGCCTCAGCCTCCCAGGCCGGGG + Intergenic
985740107 5:1610603-1610625 AGCCGCAGCAGCCCACAGTGAGG + Intergenic
985768925 5:1796829-1796851 AGCATCAGCAAGCCATGCTGGGG + Intergenic
985997785 5:3606381-3606403 CGCCGCAGGATCCCAGGCTGTGG + Intergenic
986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG + Intergenic
988566023 5:32320595-32320617 GGCTGCAGCCACCCAGGTTGCGG - Intergenic
989147733 5:38265284-38265306 AGACTCAGCATCCGAGGCTGAGG + Intronic
991359438 5:65803743-65803765 AGCTGCAGCTGCCCAAGCTGTGG - Intronic
992080025 5:73227749-73227771 TGCTGAAGCAACCCAGTCTGTGG + Intergenic
992302199 5:75394399-75394421 AGTCCCAGCTACTCAGGCTGAGG + Intronic
992839025 5:80668733-80668755 AGCCACAGCCACCCAAGCTGTGG - Intronic
995052253 5:107719754-107719776 AGCCACTGCAGCCCTGGCTGGGG - Intergenic
995211763 5:109549016-109549038 AGCCTCAGCCTCCCAGGCTCAGG + Intergenic
997292317 5:132747142-132747164 AGCCGCCCCACCCCTGGCTGGGG + Intergenic
997483159 5:134205049-134205071 AGTCCCAGCTACTCAGGCTGAGG - Intronic
998761788 5:145440213-145440235 AGCCACAGTGACCCAGGATGGGG + Intergenic
999793931 5:154970140-154970162 AGCCTCAGCCTCCCAGGCTCAGG + Intergenic
1000043258 5:157500921-157500943 AGCCACAGCATCCCTGTCTGTGG - Intronic
1001151695 5:169234520-169234542 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1001892228 5:175349266-175349288 AGTGGCAGCAGGCCAGGCTGTGG - Intergenic
1002948622 6:1786508-1786530 GACCTCAGCATCCCAGGCTGGGG + Intronic
1003602905 6:7534381-7534403 AGCCGCTGCCTCCCAGGCTCAGG + Intergenic
1004404934 6:15324061-15324083 AGTCCCAGCTACTCAGGCTGAGG + Intronic
1005381364 6:25237426-25237448 AGTGGCAGCAGCCCAGTCTGAGG - Intergenic
1006015304 6:31076115-31076137 AGCCTCAGCCTCCCAGGCTCAGG + Intergenic
1006347828 6:33497775-33497797 AGCCACCGAAACCCTGGCTGTGG + Intergenic
1006483580 6:34319261-34319283 AGCCCCAGAAACCAAGGTTGAGG + Intronic
1006487721 6:34357530-34357552 AGCCTCAGCCTCCCAGGCTCAGG - Intronic
1007121445 6:39385422-39385444 AGGCGCAAGAACACAGGCTGGGG + Intronic
1007377114 6:41464499-41464521 AGGGGCAGCCAGCCAGGCTGGGG - Intergenic
1007480879 6:42149029-42149051 AGCTGCAGAGACCCAGGGTGGGG - Intergenic
1007664950 6:43508585-43508607 AGACTCAGGAATCCAGGCTGGGG - Intronic
1007949850 6:45861498-45861520 AGCTGCAGAAACCCAGGCTTGGG + Intergenic
1010366299 6:75055606-75055628 GGCTGCAGCAGGCCAGGCTGAGG + Intergenic
1011753031 6:90472458-90472480 AGCCCCAGCCTCCCAGGCTCAGG - Intergenic
1012169650 6:96002386-96002408 AGCTGCAGCCATCCAGGTTGTGG - Intergenic
1013512211 6:110855516-110855538 AACTGCTGCAAGCCAGGCTGAGG + Intronic
1015180455 6:130356324-130356346 AGCCGGGGCAGACCAGGCTGAGG - Intronic
1015692058 6:135936537-135936559 GGCGGCAGCAACACAGACTGAGG + Intronic
1015941486 6:138456997-138457019 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1018005009 6:159613530-159613552 AGCCGCTGTCACCCAGGCAGTGG - Intergenic
1018559949 6:165091695-165091717 AGCTGGAGCCACACAGGCTGTGG + Intergenic
1018707700 6:166475153-166475175 AGCAGAAGCACCACAGGCTGGGG - Intronic
1019348568 7:542547-542569 GGCCGCAGCATCCCAGGCCGGGG + Intergenic
1019498628 7:1353061-1353083 CGCCGCCGCCACCCAGGCCGAGG - Intergenic
1019661540 7:2226869-2226891 AACCCCAGCTACTCAGGCTGAGG + Intronic
1019921688 7:4167269-4167291 AGTCCCAGCTACTCAGGCTGAGG + Intronic
1020133927 7:5575403-5575425 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
1021216977 7:17928242-17928264 AGCCCCAGCTACTCAGACTGAGG + Intronic
1022120476 7:27303262-27303284 TGCCGCATGAAACCAGGCTGAGG + Intergenic
1025096425 7:56099076-56099098 AGTCTCAGCTACTCAGGCTGAGG - Intergenic
1026623476 7:71971814-71971836 AGCCTCAGCCTCCCAGGCTCTGG - Intronic
1026676583 7:72433511-72433533 AGCCGCAAGCACCCAGGATGGGG - Intronic
1026963311 7:74423568-74423590 AGCCTCAACCTCCCAGGCTGAGG - Intergenic
1028527511 7:91801798-91801820 AGCTGCAGCTACCCAAGTTGCGG - Intronic
1028908876 7:96185478-96185500 AGTCTCAGCTACTCAGGCTGAGG + Intronic
1029176316 7:98667191-98667213 AAGCCCAGCTACCCAGGCTGAGG + Intergenic
1029487510 7:100852603-100852625 AGCTGGAGCAGCGCAGGCTGGGG + Intronic
1032586679 7:133153407-133153429 AGCCTCAACATCCCAGGCTCAGG + Intergenic
1032677428 7:134144252-134144274 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1033333725 7:140435312-140435334 AGCCGCAGCCACCCAGCCTGAGG - Intergenic
1033662532 7:143412232-143412254 AGTCCCTGCAGCCCAGGCTGTGG + Intergenic
1034481092 7:151320906-151320928 AGCTGCAGCCACCCAAGTTGGGG + Intergenic
1034520082 7:151612922-151612944 AGCGGCAGCCTCCCAGGATGAGG + Intronic
1035795981 8:2356994-2357016 AGCCGCAGCAGCCATGTCTGAGG + Intergenic
1036179807 8:6574464-6574486 AGCCACAGCAACTCAGCATGTGG - Intronic
1036415551 8:8544461-8544483 AGCCTCAGCAGCCCAGAGTGGGG - Intergenic
1038486331 8:27937633-27937655 AGCGGAAGCCACCCAGTCTGTGG - Intronic
1038849521 8:31262075-31262097 AGCCTCAACCACCCAGGCTCAGG + Intergenic
1039577042 8:38632091-38632113 CTCCACAGCAAGCCAGGCTGTGG - Intergenic
1039646161 8:39285291-39285313 TCCCTCAGAAACCCAGGCTGGGG - Intergenic
1040844309 8:51821219-51821241 AGCCTCAACCACCCAGGCTCAGG + Intronic
1041862177 8:62526944-62526966 AGCCTCAGGAATCCAGCCTGAGG + Intronic
1042483746 8:69330058-69330080 AGCTGCAGCAACCCACAGTGAGG - Intergenic
1043087281 8:75849978-75850000 AGCTGCAGCCACCCATGTTGTGG - Intergenic
1043195424 8:77287033-77287055 AGCTGCAGCCACCCAAACTGAGG + Intergenic
1043443418 8:80297145-80297167 AGCCGCAGGAGGCCAGGGTGCGG - Intergenic
1043564026 8:81527875-81527897 AGCCTCAACCACCCAGGCTCAGG - Intronic
1044525080 8:93242147-93242169 AGCCGCAGCCACCCAAACCGTGG - Intergenic
1047968727 8:130066819-130066841 AGCCTCAGCAGCCAAGACTGAGG + Intronic
1048213906 8:132479368-132479390 AGCAGCAGCGACTGAGGCTGAGG + Intronic
1048381620 8:133870476-133870498 AGTCACTGCCACCCAGGCTGGGG + Intergenic
1048421808 8:134284550-134284572 AGCTGCAGCCATCCAGACTGTGG - Intergenic
1049159819 8:141089902-141089924 AGCAGCAGAAACCCAGGCTCTGG - Intergenic
1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG + Intronic
1049647759 8:143743351-143743373 AGTCCCAGCTACTCAGGCTGAGG - Intergenic
1049977191 9:871150-871172 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1050547477 9:6721153-6721175 AGCCTCAACATCCCAGGCTCAGG + Intronic
1051655087 9:19372745-19372767 AGTCCCAGCTACTCAGGCTGAGG + Exonic
1052671744 9:31566652-31566674 AGTCTCAGCAACCCAGCTTGCGG + Intergenic
1052906818 9:33842317-33842339 AGCCGCAACCTCCCAGGCTCAGG - Intronic
1053215680 9:36268584-36268606 AGCCTCAGCCTCCCAGGCTCAGG - Intronic
1053619263 9:39799095-39799117 AACTGCAGCCACCCAAGCTGTGG - Intergenic
1053877418 9:42558444-42558466 AGCTGCAGCCACCCAAGCTGTGG - Intergenic
1053895243 9:42736244-42736266 AACTGCAGCCACCCAAGCTGTGG + Intergenic
1054234277 9:62543278-62543300 AGCTGCAGCCACCCAAGCTGTGG + Intergenic
1054264894 9:62908334-62908356 AACTGCAGCCACCCAAGCTGTGG + Intergenic
1055022361 9:71683953-71683975 TACGGCAGCATCCCAGGCTGTGG + Exonic
1056783917 9:89574514-89574536 AGCCGCTGCAACCCAGGAAGTGG - Intergenic
1057146728 9:92764057-92764079 AGCCGCAGCCACCCAGACCCAGG + Intronic
1057211534 9:93203356-93203378 AGGAGCAGCCACCCAGGCTGGGG + Intronic
1057411087 9:94817080-94817102 AGCCTCATCCTCCCAGGCTGAGG + Intronic
1057559199 9:96114071-96114093 TGCGGCAGCCACCCAGGCTGTGG - Intronic
1057984612 9:99699567-99699589 TGCCACAGCCACCCAGGCTTCGG + Intergenic
1058510426 9:105712031-105712053 AGTCCCAGCTACTCAGGCTGAGG - Intronic
1058651888 9:107182314-107182336 TGCCTCAGCAGCCTAGGCTGTGG - Intergenic
1059311013 9:113389205-113389227 AGCCGCAGTAACCCAGGACACGG - Intronic
1059413538 9:114149274-114149296 ACCCCCAGCAGCCCAGGGTGGGG - Intergenic
1060676529 9:125520288-125520310 AGAAGCAGCAACCCAGGCATAGG - Intronic
1060731496 9:126039703-126039725 AGCCTCAGCTCCCCGGGCTGGGG + Intergenic
1061620019 9:131805875-131805897 AGCCCCAGGAACCCAGGCTGGGG - Intergenic
1061688453 9:132304061-132304083 AGCCACTGCACTCCAGGCTGGGG + Intronic
1062394134 9:136345921-136345943 AGCTGCACCACCCGAGGCTGGGG + Intronic
1062540674 9:137040420-137040442 AGCCGCTGGTCCCCAGGCTGTGG + Exonic
1062602818 9:137326442-137326464 AGCCTCAGCCTCCCAGGCTCAGG - Intronic
1186483587 X:9915032-9915054 AGCCACACCAACGCAGGCTGAGG - Intronic
1188010092 X:25045784-25045806 AGCCTCAGCCTCCCAGGCTCAGG - Intergenic
1188207674 X:27380428-27380450 AGCTGCAGCCACCCAAGCTGTGG + Intergenic
1189726220 X:43970184-43970206 GGCCACAGCAACCCAGGCCCTGG + Intronic
1190111081 X:47589253-47589275 TGCCACTGCACCCCAGGCTGGGG + Intronic
1192579983 X:72272938-72272960 AGCCCCAGAAACCCAAGCAGTGG - Intronic
1195229474 X:102831708-102831730 AGCCCCAGGAACCCACACTGGGG - Intergenic
1195349075 X:103979980-103980002 GGCTGCAGCAGCCCAGGCTGGGG - Intergenic
1195351058 X:103997339-103997361 GGCTGCAGCAGCCCAGGCTTGGG + Intergenic
1195352651 X:104009489-104009511 GGCTGCAGCAGCCCAGGCTGGGG + Intergenic
1195356443 X:104044073-104044095 GGCTGCAGCAGCCCAGGCTGGGG - Intergenic
1195358368 X:104058859-104058881 GGCTGCAGCAGCCCAGGCTGGGG + Intergenic
1195862444 X:109396378-109396400 ATCCCCAGCAACCCACACTGGGG + Intronic
1197609673 X:128623774-128623796 AGCTGCAGCCACCCAAGTTGTGG - Intergenic
1197802281 X:130363813-130363835 AGCCTCAGCCTCCCAGGCTCGGG + Intronic
1199593450 X:149488712-149488734 GGCTGCAGCAGCACAGGCTGAGG - Intronic
1199598567 X:149526719-149526741 GGCTGCAGCAGCACAGGCTGAGG + Intronic
1199765540 X:150938743-150938765 CGCCGCTGCATCCCAGCCTGTGG + Intergenic
1199861206 X:151801627-151801649 AGCTGCAGCTACCCAAGTTGTGG - Intergenic
1199928971 X:152498731-152498753 AGCCTCAGGGACACAGGCTGAGG - Intergenic