ID: 1091690247

View in Genome Browser
Species Human (GRCh38)
Location 12:2591337-2591359
Sequence CTGTATAAGATGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091690247_1091690250 -2 Left 1091690247 12:2591337-2591359 CCCTTCACCTTCATCTTATACAG 0: 1
1: 1
2: 1
3: 25
4: 248
Right 1091690250 12:2591358-2591380 AGAGTCCCCTTCCTTCTGACCGG 0: 1
1: 0
2: 0
3: 16
4: 197
1091690247_1091690252 3 Left 1091690247 12:2591337-2591359 CCCTTCACCTTCATCTTATACAG 0: 1
1: 1
2: 1
3: 25
4: 248
Right 1091690252 12:2591363-2591385 CCCCTTCCTTCTGACCGGTGTGG 0: 1
1: 0
2: 3
3: 11
4: 148
1091690247_1091690257 30 Left 1091690247 12:2591337-2591359 CCCTTCACCTTCATCTTATACAG 0: 1
1: 1
2: 1
3: 25
4: 248
Right 1091690257 12:2591390-2591412 TCAATCATCATCAAGAAATAAGG 0: 1
1: 0
2: 1
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091690247 Original CRISPR CTGTATAAGATGAAGGTGAA GGG (reversed) Intronic
900279526 1:1857374-1857396 CTGTACAAGATGACAGTGATTGG - Intronic
903422451 1:23227726-23227748 CTTTATAAGATTGAGGTTAAAGG + Intergenic
904102703 1:28046305-28046327 CAGGAAAAGATGAAGGTGATGGG + Intronic
909564231 1:77037109-77037131 CTGTACAGGATGATGCTGAAAGG + Intronic
910599324 1:89013728-89013750 CTGTAAAATATGAAGGACAATGG - Intronic
911557759 1:99366083-99366105 GCGTATTAGGTGAAGGTGAATGG - Intergenic
911808691 1:102245217-102245239 GAGTATAAGAGGAAAGTGAATGG + Intergenic
915615527 1:157034874-157034896 CTGAATAATATAAAGGTGTAGGG + Intronic
917222319 1:172745086-172745108 GTGTAGAAGTTGAAAGTGAATGG + Intergenic
918132380 1:181641104-181641126 CTGCACAAGATGAATGAGAAAGG - Intronic
918459929 1:184765921-184765943 CTTAATAAGAAGAAGGTGATGGG - Intergenic
918734699 1:188044366-188044388 GTGTCTAAGATGAATGTGAAAGG - Intergenic
919204253 1:194400197-194400219 CTCTACAAATTGAAGGTGAAAGG - Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
921709293 1:218357253-218357275 CTGGATGAGATGAAGGGGAGGGG + Intronic
922872594 1:228915493-228915515 CTGTTTATCATGCAGGTGAAAGG - Intergenic
922950193 1:229552772-229552794 GAGGATAAGATGAGGGTGAAAGG - Intronic
1064824806 10:19386123-19386145 GAGTAGAAGATGAAGATGAATGG - Intronic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1065317445 10:24477196-24477218 ATGTATAGGAAGGAGGTGAATGG + Intronic
1065335030 10:24648363-24648385 TTGTATAAGATGAAGTAGATTGG - Intronic
1065810986 10:29443605-29443627 CTCTATCAGATAAAAGTGAAAGG + Intergenic
1067793000 10:49301821-49301843 CTGTCTTAGATGAAGGGGAAAGG + Intronic
1067929401 10:50545154-50545176 CTTTATAATATGAATGGGAATGG + Intronic
1067958173 10:50816685-50816707 CACAATAAGATGAAGGTGAAAGG + Intronic
1068150593 10:53125767-53125789 AAGGACAAGATGAAGGTGAATGG + Intergenic
1069177320 10:65308955-65308977 CCTTATTAGATGATGGTGAAGGG - Intergenic
1070002017 10:72385775-72385797 CTGTATATGAGAAAGGTGATGGG + Intronic
1071296203 10:84221974-84221996 CTGTCTGTGATGACGGTGAAGGG - Exonic
1074545223 10:114397038-114397060 TGGTATAAGATGAAGGTTCAAGG - Intronic
1075131178 10:119741250-119741272 CTGTAGAGGATGAACATGAAGGG - Intronic
1078306956 11:10198773-10198795 CTCTATAACATGAAAGTGCAAGG - Intronic
1079013530 11:16849436-16849458 CTGTAAAGGATGAATCTGAAAGG + Intronic
1079050866 11:17158010-17158032 AAGTTTAAGAGGAAGGTGAAGGG - Intronic
1079975514 11:27086086-27086108 CTTTATAACATGAAAGTGCAAGG + Intronic
1080555528 11:33413158-33413180 CTTTAGAAAATGAGGGTGAATGG - Intergenic
1080759269 11:35232139-35232161 ATCTATAACATAAAGGTGAATGG - Intronic
1081462592 11:43285795-43285817 CTGCATAAGAGGCAGTTGAAGGG - Intergenic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1085370394 11:75998462-75998484 CTGCCTAAGATGTAGGTGAAAGG + Intronic
1087511268 11:99097843-99097865 CTGTATAAATTGAAGGTAAAAGG + Intronic
1091576927 12:1746108-1746130 ATGTATAGGTTGAAAGTGAAAGG + Intronic
1091639408 12:2223683-2223705 CTCTATAAGAGGAAGGATAATGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1093815192 12:23537290-23537312 TTTTATAAGATTGAGGTGAAAGG - Intronic
1096739885 12:53685350-53685372 GTGTATGAGATAAAGGAGAAGGG + Intergenic
1098701567 12:73634907-73634929 CTGTATAATATGTAGGTGGCAGG + Intergenic
1100041112 12:90318299-90318321 CTGCATAAGATGAAGGCTCATGG + Intergenic
1100659355 12:96679870-96679892 CTGGACAAGAGGAAAGTGAAAGG - Intronic
1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG + Intronic
1105375181 13:19837530-19837552 ATGTATAACATGAAGCTGAAAGG - Exonic
1106105291 13:26727820-26727842 CTGTGTTAGTTCAAGGTGAAGGG + Intergenic
1107712040 13:43159866-43159888 CTTTATAAGATGTAGGTTCAGGG - Intergenic
1108024813 13:46166787-46166809 CTTTATAAAATGAAGGGGACAGG - Intronic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108909224 13:55522003-55522025 CTGTATAATATAAAAGTGCAAGG - Intergenic
1109133893 13:58624029-58624051 CTGAAGAAGATGGAGGTAAATGG - Intergenic
1109614946 13:64820627-64820649 ATGTATCAGCTGAAAGTGAATGG + Intergenic
1110168893 13:72476064-72476086 CTGTGAAAGACGATGGTGAAGGG + Intergenic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1112321140 13:98408675-98408697 CTTTATAAGATAAAAGTGACAGG - Intronic
1112678468 13:101732951-101732973 CTGTAAAAGATGAAAGAGATTGG - Intronic
1112798274 13:103081514-103081536 CTGTATAAGGTAAAGGGCAAAGG + Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1116552001 14:46252336-46252358 CTGTATGAAATTAAGGTAAATGG + Intergenic
1116720425 14:48488842-48488864 CTGAATAAGTGAAAGGTGAAGGG + Intergenic
1116751215 14:48887088-48887110 TTGTTTAAGAAGAAAGTGAATGG + Intergenic
1117327827 14:54685037-54685059 CTGAAAAAGATTTAGGTGAATGG + Intronic
1117399833 14:55348786-55348808 ATTTAAAAGTTGAAGGTGAAAGG + Intronic
1117606381 14:57432676-57432698 CTGTCTTATATGAAGGTGTAAGG + Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1119247590 14:73126062-73126084 TGGTAAAAGATGAAGCTGAAGGG - Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1124623058 15:31289812-31289834 ATGGATAAGATAAAGGTAAAAGG - Intergenic
1125243114 15:37599781-37599803 CTATAGAAGATGATGGTGAAAGG - Intergenic
1125956853 15:43796425-43796447 CTGTATGAGATGAAGGGGGTGGG - Exonic
1126235684 15:46381529-46381551 CTGTATAAGACAGAGGGGAAAGG + Intergenic
1126706546 15:51411219-51411241 CTTTATAAGCTGGAGGTGTAAGG - Intergenic
1127447079 15:59074464-59074486 CTCTATAAGATAAAAGTGCAAGG - Intronic
1128483007 15:68055217-68055239 CTGTAGCTGATGGAGGTGAATGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1133757831 16:8776004-8776026 CTGTATAAAATGAGGGTTATAGG + Intronic
1136016977 16:27406595-27406617 CAGTAGAAGACGAAGGTGAGAGG - Intronic
1137418655 16:48311087-48311109 CTGTCTAAGGTCAATGTGAAGGG - Intronic
1138565991 16:57833275-57833297 TTGTATAAGATGTAGTTGCAGGG + Intronic
1138863000 16:60781892-60781914 ATGTATAAGTTTCAGGTGAAAGG + Intergenic
1140856144 16:78979496-78979518 CTGAATTAGAGGCAGGTGAAAGG + Intronic
1144112717 17:12052060-12052082 CAGTTTAAGATGAACTTGAAAGG - Intronic
1144288500 17:13803106-13803128 TTTAATAAAATGAAGGTGAAAGG - Intergenic
1146502638 17:33377515-33377537 CAGTATAAGATGAATGCGATTGG - Intronic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1153339099 18:3956292-3956314 CTGTTAAAAATGAAGATGAAAGG + Intronic
1155842562 18:30664045-30664067 TTGTATAAGTTGTAAGTGAAGGG - Intergenic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1159236698 18:65683824-65683846 CTATATAATATGAAGATCAATGG + Intergenic
1159405687 18:67999847-67999869 CTGTGAAAGATTAAAGTGAATGG + Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
925168545 2:1735984-1736006 CTGCATAAGATAAAAGTGCAAGG - Intronic
925647591 2:6052699-6052721 CTGTATAACTTGAAGGTGTCTGG + Intergenic
926469756 2:13239030-13239052 CTGTATAACATAAAAGTGCAAGG - Intergenic
927371483 2:22360521-22360543 CTATAGAAGATGAAAGTCAATGG - Intergenic
929340293 2:40807511-40807533 CTGCCTAAGAGGAAGTTGAAAGG - Intergenic
929580572 2:43079530-43079552 CTGTATCACATGAAGGTGCATGG + Intergenic
932946783 2:76243195-76243217 CTGTATAAAATGGGGGTGCAGGG + Intergenic
932991380 2:76792278-76792300 CTGTTTAAGATGAAAGTCATAGG + Intronic
933267135 2:80193124-80193146 GTTTATAAGATAAAGGTCAAGGG - Intronic
933502588 2:83133974-83133996 TTGTATAAGATGAACAAGAATGG - Intergenic
934039184 2:88113917-88113939 AGTTAGAAGATGAAGGTGAAGGG + Intergenic
934149730 2:89134859-89134881 CTGTATAAGATGAAGATGTTGGG - Intergenic
934217566 2:90047172-90047194 CTGTATAAGATGAAGATGTTGGG + Intergenic
934542943 2:95191530-95191552 TTGTATAAAATCAAGGTGTAAGG + Intergenic
935158718 2:100509520-100509542 CTGGATAAGATGGAGGTCACGGG + Intergenic
935236344 2:101141536-101141558 ATCTCTAAGATGATGGTGAAGGG - Intronic
936889161 2:117349134-117349156 ATGAATAAGATGAAGTTTAATGG - Intergenic
937068184 2:119036142-119036164 ATATATAGGCTGAAGGTGAAGGG + Intergenic
938589711 2:132724585-132724607 CTGTGATAGATGAAGGGGAAGGG - Intronic
939189736 2:138902219-138902241 CTGTACAAGATGATGGTCAATGG - Intergenic
940082028 2:149813754-149813776 CTGTATAAGGAATAGGTGAAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942864416 2:180655834-180655856 CTGAATAAAATGAATGTCAAGGG - Intergenic
944335615 2:198530354-198530376 CTGTATAAGATGAAAGGAAGGGG - Intronic
944750113 2:202700572-202700594 CTGCATAACATAAAAGTGAAAGG + Intronic
945476000 2:210283611-210283633 CTATATGAGTTGAAAGTGAAGGG - Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
946693772 2:222332139-222332161 CTTTATAAAAGGAAGGTGAAGGG - Intergenic
947224824 2:227829981-227830003 CAGTAAAAGATCAAGGTGAAGGG + Intergenic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1174991351 20:55513714-55513736 CTGTATAATATAAAAGTGCAAGG - Intergenic
1177044078 21:16147509-16147531 CTTTATAAGATAAAAGTGCAAGG + Intergenic
1177340873 21:19798349-19798371 CTATTTAAGATGAGAGTGAAGGG - Intergenic
1177358660 21:20040655-20040677 CTCTCTAAGGTGTAGGTGAAAGG - Intergenic
1177600663 21:23308076-23308098 GTGTAAAAGAAGGAGGTGAAAGG + Intergenic
1177692558 21:24530590-24530612 CAGTTGAAGATGAAGGGGAAAGG + Intergenic
1181481757 22:23204344-23204366 CCGTAAATGATGAAGCTGAATGG + Intronic
1181996051 22:26883477-26883499 CTGAATAAGGTCAAGTTGAATGG - Intergenic
1182719892 22:32388906-32388928 CAGTAAAACAAGAAGGTGAAGGG - Intronic
1183922476 22:41180347-41180369 CCCTGTAAGATGAAGGTGATTGG - Intergenic
949435118 3:4020754-4020776 ATACATAAGGTGAAGGTGAATGG - Intronic
949585978 3:5437629-5437651 CTGCATAAGATGAAGAAGCATGG - Intergenic
949595709 3:5544734-5544756 ATGTATAGGCTGAAAGTGAAGGG - Intergenic
950809428 3:15636815-15636837 GTGTATAACATGATGTTGAAAGG + Intronic
952468810 3:33621853-33621875 AAGTATAAGATGAAAATGAATGG - Intronic
954944644 3:54409882-54409904 CTGTATAACATAAAAGTGCAAGG + Intronic
955288400 3:57667555-57667577 CTATATAAGCTGAGGGTCAAGGG - Intronic
956232683 3:67034882-67034904 CTGTATAAGATGCGGGTGTTTGG - Intergenic
957859828 3:85932512-85932534 ATGTTTAAGATCAGGGTGAATGG - Intronic
958049264 3:88323655-88323677 CTGTGAAGGTTGAAGGTGAATGG + Intergenic
958119887 3:89271906-89271928 CTGAAAAAGAGGAAGGGGAAGGG - Intronic
958623526 3:96594830-96594852 GTGTATAAAATGAAAGTGCAGGG - Intergenic
958727568 3:97924397-97924419 ATGAATAAGAAAAAGGTGAAAGG + Intronic
958968006 3:100580292-100580314 CTGTATAATAGGAAAGTGAAGGG + Intergenic
963908044 3:150790290-150790312 CTGTATAAAAGGAAGGTCACAGG - Intergenic
964146582 3:153471221-153471243 CTGTATAAAATAAAAGTGCAAGG - Intergenic
965156868 3:165071385-165071407 CTGTGTCAGATGAAGGCAAAAGG - Intronic
965305150 3:167055215-167055237 CTGTATAAGATGTAATTTAAGGG - Intergenic
965450810 3:168835464-168835486 ATGTAGAAGATAAAGGTGACTGG + Intergenic
966022745 3:175235990-175236012 CTGTACAATATGAAAGTGCACGG - Intronic
967245105 3:187478708-187478730 ATATATAAAATGAAGGTGATGGG - Intergenic
967352135 3:188525524-188525546 CTATGTAAGGTTAAGGTGAAGGG + Intronic
968244493 3:197129285-197129307 CTCTATAACATGAAAGTGCAAGG - Intronic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972103926 4:35459122-35459144 CTGTGTAAAATGAAGATAAAAGG - Intergenic
973790616 4:54374708-54374730 CTGGCAAACATGAAGGTGAATGG + Intergenic
973804603 4:54513708-54513730 CTGGATAAGATGGAGGTGCATGG + Intergenic
975446454 4:74471317-74471339 CTATATAAGAGAGAGGTGAAGGG + Intergenic
975798728 4:78036275-78036297 CTCTAAAGGATGAAGTTGAAGGG - Intergenic
975868696 4:78753655-78753677 CTGTATAGAATGAAAATGAAGGG - Intergenic
976408389 4:84684975-84684997 CTGTAAAGGATGAAAGTGAGGGG + Intronic
977449857 4:97181100-97181122 CTGATTAAGAAGAAGCTGAATGG - Intergenic
977595217 4:98871992-98872014 CTGCCTAAGTGGAAGGTGAAAGG + Intronic
978196682 4:105980264-105980286 CTATATAATATGAGGGAGAATGG - Intronic
979004667 4:115277401-115277423 ATGTATACGTTGAAAGTGAAGGG + Intergenic
980254409 4:130359259-130359281 CAGTAAAAGATAAAGGAGAAAGG + Intergenic
981701357 4:147610478-147610500 GAGTATAAGATGAAGAAGAAGGG + Intergenic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
982934259 4:161451043-161451065 CTGTTAAAAATGAAGATGAATGG - Intronic
983806187 4:171996000-171996022 CTGTATAAAATGAATCTTAATGG - Intronic
983900260 4:173126269-173126291 CTGTATAAAAAAAAGGTAAAAGG + Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
985987220 5:3525977-3525999 CTTAATGAGATCAAGGTGAAGGG - Intergenic
987556253 5:19454824-19454846 ATATATAAGATGAAAATGAAAGG + Intergenic
987581537 5:19800252-19800274 CTCTAAAAGATAAAGGTTAATGG + Intronic
987798623 5:22664336-22664358 CTATCTAGGAAGAAGGTGAAGGG + Intronic
989229648 5:39072518-39072540 GTGTTTTAGATGAAGGTGAAGGG - Intronic
989296156 5:39828858-39828880 CTGTATAAAATCAAGGTTGAAGG - Intergenic
991265884 5:64716823-64716845 CTGTATAAGACTTGGGTGAATGG + Intronic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
992666727 5:79017614-79017636 CTGAATAAAATGAAAGTGTATGG - Intronic
993909697 5:93666242-93666264 CTGAATAAGATGTAGGTGAAAGG - Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994207894 5:97056434-97056456 GTGAAGAAGATGAAGATGAAGGG - Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
994408698 5:99379135-99379157 CTGTGGAAGATGAATTTGAAAGG - Intergenic
995507989 5:112880350-112880372 GTGTGTAAGATGGAGGGGAAAGG + Intronic
997077166 5:130692756-130692778 CTGGAAAAGATGTAGGTAAAAGG + Intergenic
997421863 5:133775855-133775877 CTCTAAAAGACGATGGTGAAGGG + Intergenic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
999722611 5:154409993-154410015 CTGCATAATATAAAGATGAAAGG - Intronic
1000462279 5:161537536-161537558 GTTTATAAGATGAAAGTGACAGG - Intronic
1000586670 5:163108340-163108362 CTGTATAACATAAAAGTGCAAGG - Intergenic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1004735510 6:18402263-18402285 CTGTGTAAAATGAAGGTGCTAGG + Intronic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006311878 6:33266847-33266869 CTGTCTAAGAGCAAGCTGAATGG + Intronic
1010186913 6:73155537-73155559 CATTATAAGATGAGGCTGAATGG + Intronic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015156357 6:130100913-130100935 CTGTATATGAAGAAAGTGACAGG - Intronic
1015217685 6:130768723-130768745 ATGTGAAAGATGAAGGGGAATGG - Intergenic
1016379564 6:143461014-143461036 CTGTAAAGGATAAAGGGGAAGGG + Intronic
1016632985 6:146253515-146253537 ATATATAAAATGAATGTGAACGG - Intronic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017950838 6:159133317-159133339 CTGGAGAAAATGAAGGTGTAAGG - Intergenic
1021143838 7:17060762-17060784 ATTAAAAAGATGAAGGTGAATGG - Intergenic
1021792448 7:24218961-24218983 CTATTTATGAGGAAGGTGAAAGG + Intergenic
1022142980 7:27509279-27509301 CCGTATGAGCTGAAGCTGAAAGG + Intergenic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1024110275 7:46138050-46138072 CTGCATAAAATGTAGGAGAAAGG - Intergenic
1026828297 7:73597087-73597109 GAGCAGAAGATGAAGGTGAAGGG - Intronic
1026840035 7:73665390-73665412 CTGTCTAAAAAGAAAGTGAAGGG + Intergenic
1027446723 7:78281936-78281958 CTGTAAGAAATGAAAGTGAATGG - Intronic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1030796793 7:113798714-113798736 CTGTGAAAGATAAAGGGGAAAGG + Intergenic
1031140878 7:117941869-117941891 CTGTATTAGCTGAGGGGGAAAGG - Intergenic
1031896112 7:127349734-127349756 CTGAATAAAATGAAGGTTATAGG + Intronic
1036288380 8:7464304-7464326 CTTAAAAAGATGAAGGAGAAGGG - Intergenic
1036333095 8:7847224-7847246 CTTAAAAAGATGAAGGAGAAGGG + Intergenic
1036394179 8:8352843-8352865 ATACATAAGCTGAAGGTGAAGGG + Intronic
1038192926 8:25340289-25340311 CTATATAAGGTATAGGTGAATGG + Intronic
1042730905 8:71933942-71933964 TGGTATAAGAAGAAGGGGAAGGG - Intronic
1042973932 8:74443378-74443400 CTTTAAAAGATGATGGTGATAGG + Intronic
1044570724 8:93715246-93715268 CAGTATATGATGAATGTCAAGGG + Intronic
1047062033 8:121238032-121238054 TTGTATAAGATAAGGGTGAAAGG - Intergenic
1050521943 9:6510035-6510057 CAGTGTAAGCTCAAGGTGAACGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052466980 9:28840845-28840867 ATGTATGAGATGAAGGTAAAGGG - Intergenic
1052724264 9:32210993-32211015 CTCTATAACATGAAAGTGCAAGG + Intergenic
1054155519 9:61637220-61637242 ATGTATGATATGAAGGGGAAAGG + Intergenic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1055622431 9:78140344-78140366 ATGTATAAAATCTAGGTGAAGGG - Intergenic
1056191689 9:84190541-84190563 CAGTATGAGATGAGGGTGGAAGG - Intergenic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056411844 9:86336213-86336235 CTCTCTTAGATCAAGGTGAAAGG + Intronic
1058805193 9:108583645-108583667 CTATTTAAAATAAAGGTGAAAGG - Intergenic
1058986385 9:110212049-110212071 GTGTAAAAGGTGAAGGAGAAAGG - Intergenic
1059631848 9:116133427-116133449 CTGTCCAAGATGAAGATGAAAGG + Intergenic
1186024175 X:5290701-5290723 CTTTATAAGAGGGAGGTAAAAGG - Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1188093077 X:25987688-25987710 TTCTATAAGATAAAAGTGAAAGG + Intergenic
1188213876 X:27454500-27454522 CTCTATAAGGTAAAGGGGAAAGG - Intergenic
1189638370 X:43037945-43037967 CTGTATAGGAGGAAGGACAATGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1191816603 X:65252691-65252713 CTGTATTAGATCAATGTAAATGG - Intergenic
1193012668 X:76695112-76695134 CTCCATAACATGAAAGTGAAAGG + Intergenic
1193165237 X:78272964-78272986 GTGTAAAAAATGAAGGTGAATGG + Exonic
1193587728 X:83346569-83346591 CTGTATAAAATGAAGGTAGTAGG - Intergenic
1194113221 X:89864096-89864118 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1194989119 X:100526258-100526280 TTGTATAAGGTGAAAGTTAAGGG + Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196059434 X:111391494-111391516 CAGCAGAAGATGAAGCTGAAAGG - Intronic
1197295617 X:124715778-124715800 CTGTGGAAAATGAAGTTGAACGG - Intronic
1197530772 X:127623059-127623081 CTGTATAAGGAGAACGTGACAGG + Intergenic
1199489208 X:148380158-148380180 CTGAAAAGGAAGAAGGTGAAGGG + Intergenic
1199680027 X:150217863-150217885 ATGTAGAAGATAAAGTTGAAGGG + Intergenic
1200465906 Y:3519155-3519177 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1200898565 Y:8403573-8403595 AAGTATAAAATGAAGATGAATGG - Intergenic