ID: 1091691323

View in Genome Browser
Species Human (GRCh38)
Location 12:2599340-2599362
Sequence ATGTCCCCCTTGGACAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091691323_1091691328 1 Left 1091691323 12:2599340-2599362 CCGTGGCTGTCCAAGGGGGACAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1091691328 12:2599364-2599386 TAGCACAAGGAACAGTGGAAGGG 0: 1
1: 0
2: 3
3: 18
4: 275
1091691323_1091691329 6 Left 1091691323 12:2599340-2599362 CCGTGGCTGTCCAAGGGGGACAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1091691329 12:2599369-2599391 CAAGGAACAGTGGAAGGGCCTGG 0: 1
1: 0
2: 3
3: 36
4: 361
1091691323_1091691332 27 Left 1091691323 12:2599340-2599362 CCGTGGCTGTCCAAGGGGGACAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1091691332 12:2599390-2599412 GGAAATGTTTGGCCTTAAAAAGG 0: 1
1: 0
2: 1
3: 30
4: 228
1091691323_1091691330 16 Left 1091691323 12:2599340-2599362 CCGTGGCTGTCCAAGGGGGACAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1091691330 12:2599379-2599401 TGGAAGGGCCTGGAAATGTTTGG 0: 1
1: 0
2: 2
3: 14
4: 245
1091691323_1091691326 -4 Left 1091691323 12:2599340-2599362 CCGTGGCTGTCCAAGGGGGACAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1091691326 12:2599359-2599381 ACATTTAGCACAAGGAACAGTGG 0: 1
1: 0
2: 5
3: 27
4: 254
1091691323_1091691327 0 Left 1091691323 12:2599340-2599362 CCGTGGCTGTCCAAGGGGGACAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1091691327 12:2599363-2599385 TTAGCACAAGGAACAGTGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091691323 Original CRISPR ATGTCCCCCTTGGACAGCCA CGG (reversed) Intronic
900518441 1:3094298-3094320 AAGCACCCCTTGGGCAGCCACGG + Intronic
900774716 1:4573906-4573928 AGGTCCCTCCTGGACAGCCAGGG + Intergenic
902925358 1:19692400-19692422 CTGTCCCCATTGTACAGACAAGG - Intronic
904310447 1:29626036-29626058 ATGTCCCCATTTCACAGACAAGG - Intergenic
905322328 1:37126942-37126964 ATGTCCTCCTTCCCCAGCCATGG + Intergenic
908753760 1:67448730-67448752 ATTACCCCCTTTGACTGCCATGG - Intergenic
908769622 1:67584144-67584166 TTGTCTCCATTTGACAGCCAAGG - Intergenic
915113523 1:153580376-153580398 ATGGCCTTCTTGGACAGGCACGG - Intergenic
917848727 1:179042404-179042426 ATGTTCCCCTTGTCCAGACATGG - Intronic
922543444 1:226436056-226436078 CTCTCCTCCTTGGACATCCAGGG - Intergenic
1062971046 10:1649675-1649697 ATATGCCCCTGGGCCAGCCAGGG + Intronic
1063426129 10:5951441-5951463 AACTGCCCCTTGTACAGCCAGGG - Intronic
1063877565 10:10496087-10496109 ATGTCCCCATTTGACAGCTAAGG + Intergenic
1065974182 10:30828162-30828184 ATGTCGCCCTTGGGCAGCAGAGG + Intronic
1068918385 10:62457973-62457995 ATGTCTCCCTGGGAGAGCTAAGG - Intronic
1071389394 10:85155828-85155850 ATGTCTCCCTTAGACTTCCAGGG - Intergenic
1075235164 10:120721345-120721367 ATGACCCCCTTGTTCACCCATGG + Intergenic
1078140213 11:8686986-8687008 ATGTGTCCCATAGACAGCCATGG - Exonic
1082074385 11:47964985-47965007 ATGTCCCCCATGGATAAGCAGGG - Intergenic
1084331330 11:68432327-68432349 GTGTCCCCCATGGCCAGGCACGG + Intronic
1090566158 11:127994091-127994113 GTGCCCCCTTTGGACAGCCTTGG + Intergenic
1091039492 11:132263205-132263227 ATGGCCCCCTTGAACAGCCTTGG - Intronic
1091691323 12:2599340-2599362 ATGTCCCCCTTGGACAGCCACGG - Intronic
1093926991 12:24918528-24918550 ATGTCTCTCTTGGACTTCCAGGG + Intronic
1094058028 12:26286174-26286196 AGGCCCACCCTGGACAGCCAGGG + Intronic
1096429504 12:51531487-51531509 ACGTCCCCCTGGGGCAGCCGTGG + Intergenic
1096541491 12:52309801-52309823 ATCTCCCCATTCCACAGCCAAGG - Intergenic
1096815703 12:54200502-54200524 ATGTCCCACTTGGAAAGTCAAGG + Intergenic
1096997940 12:55850989-55851011 ATGTCCCCTTTGGACTGTTATGG - Intergenic
1101648958 12:106657360-106657382 CTGTCCCCCAGGGACAACCAGGG + Intronic
1101790311 12:107919936-107919958 ATGTGCCCAATGAACAGCCAAGG - Intergenic
1103917206 12:124382042-124382064 ATGTCACCCTTGGCCAGAGAAGG - Intronic
1103935291 12:124473028-124473050 AGCTCCTCCTTGGACAGCCGTGG + Exonic
1104795377 12:131513458-131513480 ATTAGCCCCGTGGACAGCCAGGG - Intergenic
1109140054 13:58703832-58703854 TTATCCCCCCTGGACAGCCAGGG - Intergenic
1118741981 14:68746339-68746361 AGGTGCACCTTGGAGAGCCAGGG + Intergenic
1122863481 14:104593178-104593200 AGGTCCTACTGGGACAGCCAAGG + Exonic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1130168221 15:81484923-81484945 TTGTACACCTTGGACAGTCAAGG - Intergenic
1130292322 15:82613876-82613898 ATGCCCCCCTGGGACAGCCCGGG + Intronic
1130889460 15:88120898-88120920 ATGTGCCCATTGTACAGCTAAGG - Intronic
1132530410 16:445547-445569 ATCTCCCCCTTGCCCACCCAAGG + Intronic
1133239317 16:4405055-4405077 ATGTCCCTCTTGCAGAGCCCAGG + Intronic
1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG + Intronic
1133448227 16:5880715-5880737 ATGACCCCCTTGGACATCTGGGG + Intergenic
1133738180 16:8631468-8631490 TTGTACCCCTTGTACAGACAAGG - Intronic
1134046013 16:11101571-11101593 ATGCCTACCTTGGACATCCAAGG - Intronic
1136674198 16:31885388-31885410 ATGTCCCTCTTTGACAGCAAGGG - Intronic
1136991237 16:35152478-35152500 CTGTCCCCCTTGGAGAGCCTAGG + Intergenic
1137627737 16:49920268-49920290 ATGTCCCTCTTGGATACCCTTGG + Intergenic
1139714947 16:68805548-68805570 CTGGCCACCTTGCACAGCCATGG - Intronic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1143520855 17:7443449-7443471 AGTTCCCACATGGACAGCCAGGG + Exonic
1144206683 17:12984561-12984583 AGGTCCCCTTTGGCCAGCCGGGG + Exonic
1144618370 17:16797682-16797704 GTCTCCCCCTTGGCCAGGCATGG - Intronic
1144737815 17:17564700-17564722 CTGTCCCCCTTGGGCAGCTGTGG - Intronic
1146492238 17:33291664-33291686 AGGTCCCCCTTGGAGAGGCGCGG + Exonic
1147647276 17:42041182-42041204 ATGGCCACCTGGGACAGCCAGGG + Intronic
1147800050 17:43078460-43078482 ATTTCCGCCTTGGCCAGGCATGG - Intronic
1151043837 17:70895975-70895997 ATGTGCCCATGGGTCAGCCAGGG - Intergenic
1151310477 17:73289666-73289688 ATGACCCTCTTGGCCAGCCATGG + Intronic
1151475258 17:74341567-74341589 GTGTCCCCTTTGGGCATCCAAGG + Intronic
1152574652 17:81134708-81134730 ATGTCCCCCTGGCGAAGCCAGGG - Intronic
1152711388 17:81871856-81871878 GTGTCCCCCGTGGAAAGACAGGG + Intergenic
1160455616 18:78996961-78996983 ATCACCCCCTAGGAGAGCCATGG - Exonic
1160924575 19:1537399-1537421 ATGCCCCCCTTAAACAGGCAGGG - Intergenic
1161089275 19:2352069-2352091 CTGTCCCCCTTGGCAAGGCAGGG + Intronic
1161505510 19:4641264-4641286 GTGGCCCCATTGGACAGACAGGG - Intronic
1163475701 19:17524958-17524980 GAGTCTCCATTGGACAGCCATGG + Intronic
1166100694 19:40569884-40569906 ATGTCCCCCTTAGAAAGACGGGG + Intronic
925178191 2:1799475-1799497 CTATCCCTCATGGACAGCCACGG + Intronic
927287386 2:21370587-21370609 AAGACCTCCTTGGAAAGCCAAGG + Intergenic
932409243 2:71535432-71535454 ATGTCCCCTTGGGGTAGCCAGGG + Intronic
938651868 2:133391348-133391370 CTGTCCCCCATTGACTGCCAGGG - Intronic
942428503 2:175884352-175884374 ATGTCCCACCTGGCCAGCCCAGG + Intergenic
948077123 2:235173724-235173746 ATATCCTCTTTGGACAGCCACGG + Intergenic
948560481 2:238848240-238848262 GTGTCCCCCGTGGACAGCCTGGG + Exonic
948801200 2:240434447-240434469 ATGACCCCCATGTACAGCAAGGG - Intergenic
948864680 2:240769268-240769290 CTGCCCCCATTGGTCAGCCAGGG - Intronic
948908908 2:240993230-240993252 ATGTTCCCCATGAGCAGCCAGGG - Intronic
1168957094 20:1841796-1841818 ATGATCCCCTTGGAGAGACAGGG - Intergenic
1172657698 20:36547020-36547042 GTGTCCCCCTGGGATGGCCATGG - Intronic
1173021601 20:39272222-39272244 ATGTCTCCTTTGCACACCCAAGG - Intergenic
1176222230 20:63975176-63975198 ATGTCCCCCCTAGACTCCCAGGG - Exonic
1177404418 21:20646491-20646513 ATGTTCTCCTTGTCCAGCCATGG + Intergenic
1178428585 21:32499377-32499399 GTGTGCCCCAAGGACAGCCAAGG + Intronic
1178595852 21:33951605-33951627 ATGAGCCCTTAGGACAGCCAGGG + Intergenic
950298755 3:11855587-11855609 ATGTCTCTCTTGGACTTCCAGGG + Intergenic
950584377 3:13881874-13881896 GTGTTCCCTTAGGACAGCCACGG - Intergenic
951684199 3:25326096-25326118 ATCTCCCCCTTGGAAAGAAAGGG + Intronic
952865707 3:37853943-37853965 ATATCTCCCTTGCCCAGCCAAGG + Intergenic
955025850 3:55166561-55166583 ATATCCCCATTGTACAGACAAGG - Intergenic
957527125 3:81391900-81391922 ATGTCTCCCTTGGGCATTCATGG - Intergenic
958892129 3:99794749-99794771 AGGGCCCCCTGGGAAAGCCAGGG + Exonic
961479526 3:127171073-127171095 ATGTCCCTCCTGGACAGCAGGGG + Intergenic
964727644 3:159831380-159831402 GTCTCCCCCTTGGCCTGCCAGGG + Intronic
966543132 3:181114492-181114514 ATGTCACTCTTGGCCGGCCACGG + Intergenic
969704517 4:8784554-8784576 ATGTCCCCCCTGGATAGCCCTGG - Intergenic
970445991 4:16123731-16123753 ATTTCCCCCTTTCACAGACAAGG + Intergenic
970852035 4:20614294-20614316 ATGTCCTCCTTGTCCTGCCACGG + Intronic
977540296 4:98310922-98310944 ATATTTCCCTTGGACAGCCATGG + Intronic
978498579 4:109385274-109385296 ATGTCCCCCCGTGCCAGCCATGG + Intergenic
980236428 4:130113231-130113253 ATGTCTACCTTTGACAGACAGGG - Intergenic
980943261 4:139295254-139295276 ATCTCCCACTTAAACAGCCAAGG + Intronic
981499665 4:145436479-145436501 ATGTGCCCCTTCCACAGCCCTGG + Intergenic
984141404 4:176008332-176008354 ATGTCTCTCTTGGACTTCCAGGG + Intergenic
987084006 5:14452165-14452187 CGGGCCTCCTTGGACAGCCAGGG - Intronic
989626022 5:43430189-43430211 AGGTCCCCCTAGGGCAGACAGGG - Intergenic
997983863 5:138488397-138488419 ATGTCTCCATTGAACAGCCTCGG - Intergenic
998636106 5:143956405-143956427 ATTTCCCATTTGGAAAGCCATGG + Intergenic
999665187 5:153905407-153905429 ATGTCTCCCTTGGACAGGGTTGG - Intergenic
999916890 5:156272545-156272567 ATCTCATCCTTGGACTGCCATGG - Intronic
1001192878 5:169647055-169647077 ATGTCCCCATTGGACAGGTTGGG + Intronic
1002063289 5:176639360-176639382 ATGTCCCCCATAGACAGACTTGG + Intronic
1003397883 6:5769234-5769256 ATTTCCCCCTTGGATAGTCTTGG + Intronic
1004349275 6:14877020-14877042 ATGTCCCCCTTGGTCAACCTAGG - Intergenic
1006727256 6:36208612-36208634 ATGTCCTCCATGGCCATCCATGG - Intronic
1007661314 6:43488402-43488424 ATGTCCCTCAGAGACAGCCAGGG - Intronic
1009610066 6:65930415-65930437 ATGTTCCCCTGTGCCAGCCATGG - Intergenic
1016495162 6:144653293-144653315 ATCTCCCTCTTGGCCAGGCACGG + Intronic
1017444841 6:154498291-154498313 ATTTCCTCTGTGGACAGCCATGG - Intronic
1019700247 7:2471390-2471412 ATGTCCGGCTTGGCCTGCCAGGG - Intergenic
1022442624 7:30446530-30446552 AGGTCCCACTTTGACTGCCAAGG + Intronic
1023074218 7:36467115-36467137 ATGTATCCCTTGGCCAGGCAAGG - Intergenic
1028826850 7:95283430-95283452 ATCTCCCACTTGGAGGGCCAGGG - Intronic
1029110582 7:98211453-98211475 TTGTCCCCCGTGGGCAGCCTCGG + Exonic
1029253000 7:99250387-99250409 TTGTGCCCCTGGGGCAGCCAGGG - Intergenic
1030152499 7:106421114-106421136 TTGTCTCCCTTGGGAAGCCACGG + Intergenic
1031617048 7:123894180-123894202 ATGTCTCTCTTGGACTTCCAGGG - Intergenic
1031918268 7:127583077-127583099 AGGTCCCCTTTAGACAGCCATGG - Exonic
1033248961 7:139742439-139742461 ATATCCCTCTTGGAGATCCACGG - Intronic
1034547119 7:151796412-151796434 ATGTCCTCCTTTGACTGTCAGGG + Intronic
1035927841 8:3747973-3747995 ACGTCCACCTTGGAGAACCATGG - Intronic
1036611280 8:10351902-10351924 ATGTGGCCGTCGGACAGCCAGGG - Intronic
1040050721 8:43011281-43011303 CTGACCCCCTTGGCCAGGCACGG - Intronic
1041260008 8:56013117-56013139 ATGCACCCTTGGGACAGCCAGGG - Intergenic
1042077567 8:65013284-65013306 ATGTCTCCCAAGGACACCCATGG - Intergenic
1044385221 8:91579992-91580014 AAGTTACCCATGGACAGCCAAGG - Intergenic
1046519409 8:115305030-115305052 ATGTGCCCCTGGGCCAGGCAGGG - Intergenic
1048970569 8:139643069-139643091 CTGACCCCCTTGGCCAGGCAAGG + Intronic
1048988930 8:139750110-139750132 ATGCCACACTGGGACAGCCAGGG - Intronic
1049383722 8:142330476-142330498 ATGTACCATTTGCACAGCCATGG - Intronic
1049787366 8:144457440-144457462 ATCACCACCTTGGGCAGCCATGG + Intronic
1050063533 9:1735017-1735039 ATGTCCCAGTTGGAGAGTCATGG - Intergenic
1051214100 9:14778365-14778387 CTGCCCGCCTTGGCCAGCCAAGG - Intronic
1056577811 9:87869319-87869341 ATGCCCCCCAGGGAGAGCCATGG + Intergenic
1057585698 9:96326968-96326990 ATGGTCCCCTCTGACAGCCAGGG - Intronic
1057632427 9:96731154-96731176 ATTTTCCCATTGGACTGCCATGG + Intergenic
1061309716 9:129754207-129754229 CTGTCCCCCTTGGCCTCCCAAGG - Intergenic
1062252329 9:135604618-135604640 GTGTCCCCCATGCACGGCCAGGG - Intergenic
1186725097 X:12349086-12349108 CTGTCCCCCCTGGAGACCCATGG + Intronic
1189214994 X:39315287-39315309 GTGTCTCTCTTGGGCAGCCAGGG + Intergenic
1197182991 X:123556640-123556662 TTGTCCCCATTTGAGAGCCATGG + Intergenic
1198453500 X:136792204-136792226 ATGTCCCACTTGGACAATCCAGG + Intergenic
1199442270 X:147882068-147882090 ATGTCTCTCTTGGACTTCCAGGG - Intergenic
1199651439 X:149948720-149948742 ATGTCCTCCTGGCTCAGCCATGG + Intergenic