ID: 1091691925

View in Genome Browser
Species Human (GRCh38)
Location 12:2603134-2603156
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091691925_1091691931 16 Left 1091691925 12:2603134-2603156 CCTACAAGTCCAGATTTGAATCC 0: 1
1: 0
2: 2
3: 18
4: 135
Right 1091691931 12:2603173-2603195 TCACTATTTAACCTTGAATGAGG 0: 1
1: 0
2: 2
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091691925 Original CRISPR GGATTCAAATCTGGACTTGT AGG (reversed) Intronic