ID: 1091691931

View in Genome Browser
Species Human (GRCh38)
Location 12:2603173-2603195
Sequence TCACTATTTAACCTTGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091691927_1091691931 7 Left 1091691927 12:2603143-2603165 CCAGATTTGAATCCCAGCATGGC 0: 1
1: 0
2: 4
3: 40
4: 313
Right 1091691931 12:2603173-2603195 TCACTATTTAACCTTGAATGAGG 0: 1
1: 0
2: 2
3: 10
4: 146
1091691929_1091691931 -6 Left 1091691929 12:2603156-2603178 CCAGCATGGCCACTCAGTCACTA 0: 1
1: 0
2: 1
3: 7
4: 146
Right 1091691931 12:2603173-2603195 TCACTATTTAACCTTGAATGAGG 0: 1
1: 0
2: 2
3: 10
4: 146
1091691925_1091691931 16 Left 1091691925 12:2603134-2603156 CCTACAAGTCCAGATTTGAATCC 0: 1
1: 0
2: 2
3: 18
4: 135
Right 1091691931 12:2603173-2603195 TCACTATTTAACCTTGAATGAGG 0: 1
1: 0
2: 2
3: 10
4: 146
1091691924_1091691931 24 Left 1091691924 12:2603126-2603148 CCTGGGAGCCTACAAGTCCAGAT 0: 1
1: 0
2: 2
3: 14
4: 106
Right 1091691931 12:2603173-2603195 TCACTATTTAACCTTGAATGAGG 0: 1
1: 0
2: 2
3: 10
4: 146
1091691928_1091691931 -5 Left 1091691928 12:2603155-2603177 CCCAGCATGGCCACTCAGTCACT 0: 1
1: 1
2: 2
3: 15
4: 178
Right 1091691931 12:2603173-2603195 TCACTATTTAACCTTGAATGAGG 0: 1
1: 0
2: 2
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091691931 Original CRISPR TCACTATTTAACCTTGAATG AGG Intronic