ID: 1091692270

View in Genome Browser
Species Human (GRCh38)
Location 12:2605351-2605373
Sequence CTTAGGGCAGACACTTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091692270_1091692276 -6 Left 1091692270 12:2605351-2605373 CCATCCCAAGTGTCTGCCCTAAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1091692276 12:2605368-2605390 CCTAAGCAGAATGTGCCAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 140
1091692270_1091692280 24 Left 1091692270 12:2605351-2605373 CCATCCCAAGTGTCTGCCCTAAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1091692280 12:2605398-2605420 ACACAAACCCTGTGCCCCTGTGG 0: 1
1: 0
2: 0
3: 33
4: 223
1091692270_1091692274 -7 Left 1091692270 12:2605351-2605373 CCATCCCAAGTGTCTGCCCTAAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1091692274 12:2605367-2605389 CCCTAAGCAGAATGTGCCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091692270 Original CRISPR CTTAGGGCAGACACTTGGGA TGG (reversed) Intronic
900507030 1:3034884-3034906 CCTGGGGCAGACACCTGGGTGGG - Intergenic
900902771 1:5528053-5528075 CTTAGGGCAGCCACTCTGCAGGG + Intergenic
901823693 1:11847002-11847024 GTTGGGGCAGAAACTTGAGAGGG + Intronic
906970307 1:50506482-50506504 CTTAGAGCGGACACTTAGGTTGG - Intronic
910555872 1:88532275-88532297 ACTAGGGCAGACCTTTGGGATGG - Intergenic
910556148 1:88535421-88535443 TGTAGGGCAGACACTTGAAATGG - Intergenic
912512576 1:110198993-110199015 CTCAGGGCTCAGACTTGGGAGGG + Exonic
915165718 1:153946704-153946726 CTTTGGGCAGACGCTTGCCAGGG - Intergenic
915565040 1:156708321-156708343 CTTAGGGAAGATGCTAGGGAAGG + Intergenic
921834670 1:219765443-219765465 TTTAGGGCAGGTACTTGAGAAGG - Intronic
923016502 1:230130596-230130618 CTTAGGGGAGACACAGGGGTCGG - Intronic
924454159 1:244204790-244204812 CTTTGGTCAGTCACTGGGGAAGG + Intergenic
924875745 1:248102208-248102230 CTTAGGTCAGAGAGCTGGGAAGG + Intergenic
1065054207 10:21827234-21827256 CCCAAGGCAGACACTGGGGAGGG - Intronic
1065969625 10:30796112-30796134 CTCAGTCCAGAGACTTGGGAAGG - Intergenic
1070764149 10:79047028-79047050 CTTAGGGCAGGAACACGGGAGGG - Intergenic
1074136098 10:110627451-110627473 CTTAGGGCACACACATGCCAAGG - Intergenic
1076069276 10:127473424-127473446 CACAGGGCAGGCAGTTGGGAAGG - Intergenic
1076865523 10:133164553-133164575 GCTGTGGCAGACACTTGGGAAGG - Intronic
1077041534 11:526482-526504 GTTAGGGGAGACACTGGGGGCGG - Intergenic
1077612066 11:3649432-3649454 CATTGGGCAGAGACTAGGGAGGG - Intronic
1078437351 11:11336528-11336550 CTCAAGGCAGCCACCTGGGAAGG + Intronic
1080738599 11:35042230-35042252 CTTGGGTCTGACACTTGGAATGG + Intergenic
1081199219 11:40196203-40196225 CTTAGGGCAGACACTACGAAGGG + Intronic
1089352970 11:117831830-117831852 CTCAGGGCAGTCATTTGGGGTGG + Intronic
1091692270 12:2605351-2605373 CTTAGGGCAGACACTTGGGATGG - Intronic
1091999579 12:5021238-5021260 CTTTGGGCAGACAGAGGGGAGGG - Intergenic
1093415873 12:18920005-18920027 CTTAGGGCAGACTGTCAGGATGG - Intergenic
1095294919 12:40516702-40516724 TTCAGGCCAGACTCTTGGGAAGG - Intronic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1099918491 12:88926591-88926613 CTGAGAGCAGAGACTTGGGGAGG + Intergenic
1099922687 12:88978756-88978778 CTTAGGACACACAGTTGGGAAGG - Intergenic
1100425051 12:94476621-94476643 GTTAGGGCATACACTTGGGTAGG - Intergenic
1100842794 12:98630766-98630788 CTAAGGTCACACAGTTGGGATGG + Intronic
1101043939 12:100785272-100785294 CTTAGGGCTCACTCTTGGTATGG + Intronic
1106218627 13:27725533-27725555 CTTAGGGAAGAGCCTTGGGAAGG - Intergenic
1106738090 13:32608541-32608563 GTTAGGGCTGGCAGTTGGGAAGG + Intronic
1111212338 13:85095662-85095684 CTTAGGTCAGAAATTTGGAATGG - Intergenic
1111657776 13:91174834-91174856 CTTTGGAAAGACACTGGGGATGG - Intergenic
1112155551 13:96812959-96812981 CTGAGGACAGAGACTTGGGATGG + Intronic
1112746099 13:102528858-102528880 CTTTGGGCAGAGATGTGGGAAGG - Intergenic
1113513640 13:110874554-110874576 CTCAGTGCAGACTCTTGGGGTGG + Intergenic
1115501534 14:34054008-34054030 CTTGGGGCACACACTTGAGCAGG + Intronic
1116414186 14:44660921-44660943 CTTAGAGCTGACACTTGCAAAGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118818625 14:69329996-69330018 AGTAGGGCAGCCACTTTGGAAGG + Intronic
1119480696 14:74955860-74955882 CTCAGGGCGGTCACCTGGGATGG + Intergenic
1119562447 14:75602081-75602103 CATAGGGCAGGAAATTGGGATGG + Intronic
1119597884 14:75953380-75953402 CTTTGGGTATACACTTAGGAGGG - Intronic
1120846007 14:89125773-89125795 CAGAAGGCAGACAGTTGGGAGGG - Intronic
1122888119 14:104719543-104719565 CTCAGGGCACACACCTGGCAGGG - Exonic
1123126860 14:105952989-105953011 AGCAGGGCAGACAGTTGGGAAGG + Intergenic
1123925952 15:25110859-25110881 CTTAGGGCAGGTAATTGGGCTGG - Intergenic
1126195312 15:45924215-45924237 CTTTGGACAGCCTCTTGGGAAGG + Intergenic
1128237135 15:66075950-66075972 CTTAGGGCAGGGACAAGGGAAGG + Intronic
1128339164 15:66808460-66808482 CTCAGGGCAGCGACGTGGGATGG - Intergenic
1128737619 15:70062106-70062128 CTTCGGGCAGAAACTTGGCCGGG - Intronic
1128902083 15:71433565-71433587 CTCAGGGGACACACTGGGGAGGG - Intronic
1131145422 15:90008235-90008257 CTTGGGGTAGGCACTAGGGATGG - Intronic
1131847651 15:96504821-96504843 TTAAGGGCAGACACTTCAGATGG + Intergenic
1134431173 16:14207914-14207936 GTGAGGGCAGTCTCTTGGGATGG + Intronic
1137494134 16:48956594-48956616 CTCCAGGCAGACACTTTGGAAGG + Intergenic
1138075054 16:54033942-54033964 CATAAGTCAGACACTTGGAAAGG - Intronic
1142501949 17:338016-338038 CTGAGGGCTGGCACTTGAGATGG - Intronic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1143756118 17:9068833-9068855 CTTAAGTTAGACCCTTGGGAGGG + Intronic
1143998223 17:11027619-11027641 TTCAGGGCAGGCAGTTGGGAAGG + Intergenic
1144487328 17:15677748-15677770 CTTAGGGGAGACTGATGGGATGG + Intronic
1144913705 17:18704570-18704592 CTTAGGGGAGACTGATGGGATGG - Intronic
1145921697 17:28614570-28614592 CTTAGCACAGAGACTGGGGAGGG + Exonic
1147125987 17:38369051-38369073 CTTGGGCCAGAAACTTGTGATGG + Intronic
1147545457 17:41397864-41397886 ATGAGGGCAGATACTTGGGCTGG - Intergenic
1149811449 17:59677529-59677551 CTTAGGCCATACACTCGGAAGGG - Intronic
1151537526 17:74747423-74747445 CTGAGGACAGACACTGAGGAAGG - Intergenic
1153653748 18:7263907-7263929 CCTGGGACAGCCACTTGGGAAGG + Intergenic
1154313801 18:13287598-13287620 CTGAGGGCAGACAGTGGAGAAGG - Intronic
1156769840 18:40706875-40706897 CTGAAGGCATAGACTTGGGATGG - Intergenic
1157297944 18:46459506-46459528 CCTGGGGCAGAGAATTGGGAGGG - Exonic
1157605515 18:48923623-48923645 TTTGGGGCAGGCATTTGGGAAGG - Intronic
1158397787 18:57093210-57093232 CTTAGGACAGACACCGGGGCTGG + Intergenic
1158429086 18:57367583-57367605 CTTAGGGAAGAAAATTGGCAGGG + Exonic
1161509403 19:4662305-4662327 TTTTGTGCAGACACTTTGGAGGG - Intronic
1161707642 19:5829541-5829563 CTAAGGGCAGACGTGTGGGAAGG - Intergenic
1161973221 19:7595552-7595574 CTAAGGGTAGACACTGGGGCTGG + Intergenic
1162931271 19:13959141-13959163 CTCAGGGCAGAAGCTGGGGAGGG - Exonic
1163917332 19:20252616-20252638 CATAGGGCAGACACTAGGGCAGG + Intergenic
1163931111 19:20392995-20393017 CATAGGGCAGACACTAGGGCAGG + Intergenic
1164102960 19:22075236-22075258 TGTAGGGCAGACACTAGGGCAGG + Intronic
1164269616 19:23660045-23660067 TGTAGGGCAGACACTAGGGCAGG - Intronic
1164869895 19:31633898-31633920 CTTGGGGGAGACACTTTGAAAGG - Intergenic
1165797227 19:38526302-38526324 CTTGGGGCAGAATCCTGGGAGGG - Intronic
1166885951 19:45960980-45961002 CCTAGGGCAGAGACCTGGGCCGG + Intronic
1168147250 19:54426664-54426686 CGTAGGCCAGCCACCTGGGAGGG - Exonic
932452999 2:71827674-71827696 CTTCCGGCAAACCCTTGGGAAGG + Intergenic
937055828 2:118935889-118935911 CTTAGTGCAGATACTGGTGATGG + Intergenic
937229369 2:120388709-120388731 GTTAGTGCAGACACTTGGGAAGG - Intergenic
941600882 2:167543059-167543081 TTTAGTGCAGACATTTTGGAAGG + Intergenic
943544265 2:189255010-189255032 CATAAGGCATACCCTTGGGAAGG - Intergenic
943613457 2:190063743-190063765 CAGAGGGCAGACACCTGGCAGGG + Intronic
947572327 2:231245923-231245945 CTTAGGGCAGAGGCTTGGTGTGG - Intronic
947834718 2:233167017-233167039 CTTAGGGCACACTCTTAGAAAGG - Intronic
1172166100 20:32900299-32900321 CTTAGAGCAGACACTTGAGCTGG + Intronic
1173137982 20:40457362-40457384 CTAAGGGGAGGCACTGGGGAAGG - Intergenic
1175185381 20:57176421-57176443 CACAGGGCAGCCAGTTGGGATGG - Intronic
1175403126 20:58711712-58711734 CCAAAGGCAAACACTTGGGATGG - Intronic
1177116200 21:17089979-17090001 CTTAGTGCAGAGACATGGCAAGG + Intergenic
1178257299 21:31065868-31065890 CTTAGGGACAACACTTGGCAGGG + Intergenic
1179399947 21:41074936-41074958 CTTGGTTCAGACACTGGGGAGGG - Intergenic
1180229756 21:46420019-46420041 CTGGGTGCAGACACTTGGGTTGG + Intronic
1184020112 22:41815135-41815157 CTTGGGGCAGACTGTTGGGGTGG - Intronic
1184088977 22:42282677-42282699 CTGGGGGCAGAGACCTGGGAGGG + Intronic
1184159648 22:42690485-42690507 CTTAGGGCAGAGAGGTGGGTAGG - Intergenic
1185418149 22:50721044-50721066 TTCAGGGCAGACACCGGGGAGGG - Intergenic
950336213 3:12195505-12195527 CTGAGGGTGGACACTTGGGGAGG + Intergenic
950875056 3:16264406-16264428 CTTAGGGGAAACACCTAGGAAGG + Intronic
950972290 3:17201435-17201457 CTTGGGGCAGAAAGCTGGGAGGG + Intronic
951729671 3:25796672-25796694 CACAGGGCAGGCAGTTGGGAAGG - Intergenic
953667156 3:44933625-44933647 CTTAGGTCCAACACTTGGAATGG + Intronic
953975956 3:47381606-47381628 CCTGGGACAGACACTGGGGATGG + Intronic
954443087 3:50532363-50532385 TTCAAGGCAGACACATGGGAAGG + Intergenic
955933701 3:64082395-64082417 CTTAGGGCAATCATTTGAGAAGG + Intergenic
956947980 3:74245477-74245499 TTGAGGGCAGACATTTGTGATGG + Intergenic
958610711 3:96421668-96421690 ATTAGAGCAGAAAATTGGGAAGG + Intergenic
967487160 3:190046154-190046176 CTTAGGGCAGGCACCAGGAAGGG - Intronic
970899119 4:21138223-21138245 CTTAGGGCACAGAGTTGAGAAGG - Intronic
984047119 4:174814910-174814932 CTTTGGGGGGACTCTTGGGAAGG - Intronic
986810337 5:11351247-11351269 CTCAGGGCAAACACTGGAGAGGG + Intronic
989106296 5:37866334-37866356 CTTAGGTAAGCCATTTGGGAAGG - Intergenic
991438003 5:66615885-66615907 CTGAGGGCAGGCAAATGGGAGGG - Intronic
995902701 5:117089049-117089071 ATTAGGGCAGTCATTTGGGAGGG + Intergenic
996685602 5:126277058-126277080 ATTAGGGCAGCCACTGTGGATGG - Intergenic
996764702 5:127024103-127024125 CTTAGAGAAGACACATAGGAAGG + Intronic
997036739 5:130202194-130202216 CTTTGGGGAGACTGTTGGGAAGG - Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1003875643 6:10433981-10434003 CTGAGAGCAGAAACTTTGGAGGG + Intergenic
1004915000 6:20323210-20323232 CTTAGGGAAAACACTGAGGAAGG + Intergenic
1008524868 6:52397840-52397862 CTCAGTGCAGCCACCTGGGAAGG + Intronic
1011151609 6:84280142-84280164 CATAGGGCAGATTCTTGGGAAGG + Intergenic
1014538469 6:122645842-122645864 CTTAGTGCAGACTCATGTGATGG + Intronic
1017148124 6:151252979-151253001 CAAAGGGCAGACACTGGGGATGG - Intronic
1018691457 6:166347411-166347433 CTCAGTGTAGACACTTAGGAGGG - Intergenic
1019940399 7:4284694-4284716 CTTCTGGCAGACCCTGGGGAAGG - Intergenic
1020713101 7:11633584-11633606 CTTAGGGAGGACACTTAGAAGGG - Intronic
1021067133 7:16190200-16190222 ATTAAGGCAGACACTTGTGCAGG - Intronic
1023190601 7:37576861-37576883 TATAGTCCAGACACTTGGGATGG - Intergenic
1023738085 7:43252254-43252276 CTGGGGGCAGAAACCTGGGAAGG - Intronic
1032012943 7:128358878-128358900 CTTAGGACAAACTCTGGGGAAGG - Intronic
1032518629 7:132525767-132525789 TTCAGGGCAGAGCCTTGGGAGGG - Intronic
1033777640 7:144630081-144630103 CTTTGGGGGGACTCTTGGGAAGG + Intronic
1034925456 7:155118053-155118075 CTTAGAGCAAACATTGGGGAGGG + Intergenic
1035708796 8:1697000-1697022 CCTGAGGCAGATACTTGGGAAGG - Intronic
1035742004 8:1935579-1935601 CTTAGGGCAGCCCCTCCGGAGGG + Intronic
1036953746 8:13165553-13165575 CTGAAGGCAGACACTTGGCCAGG + Intronic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1039505124 8:38046470-38046492 CTCAGGAGAGACACTTGGAAGGG - Intronic
1041755669 8:61310663-61310685 ATTAGGGCAGACATTGGGTAAGG - Intronic
1042844430 8:73156145-73156167 CTTAGGGAAGATTCCTGGGAGGG - Intergenic
1045946086 8:107797875-107797897 CCTAGAGCATACACTGGGGATGG + Intergenic
1046028239 8:108750787-108750809 CTAAGGGGAGAATCTTGGGAAGG + Intronic
1047420792 8:124706704-124706726 CCCAGGGCACACACTTGGGATGG - Intronic
1047681269 8:127256993-127257015 CTTAGAACAGGCCCTTGGGATGG + Intergenic
1049861833 8:144903914-144903936 AACAGGGCAGACAGTTGGGAAGG - Intergenic
1051484105 9:17589700-17589722 CTTAGTGCAGGCACATCGGATGG + Intronic
1053046101 9:34918516-34918538 CTTATGGGAGACATTTTGGAAGG - Intergenic
1055498016 9:76875155-76875177 CTCTGGGCAGACAATGGGGAAGG - Intronic
1055828001 9:80349726-80349748 CTCAGGGATGAGACTTGGGATGG - Intergenic
1056938174 9:90933597-90933619 CTGAGGGCAGGCCCTGGGGAGGG + Intergenic
1056992706 9:91425256-91425278 CTCATGGCAGACACTAGGGATGG - Intergenic
1059035853 9:110752796-110752818 ATTTGGGCAGACACATGGAAGGG - Intronic
1062217528 9:135397353-135397375 CTCAGGGCACAGGCTTGGGATGG - Intergenic
1186726940 X:12367459-12367481 ATTAGGGCAGCCACTAAGGATGG - Intronic
1190182304 X:48203378-48203400 TATAGAGCAGACACTTGGCAGGG + Intronic
1190187648 X:48249967-48249989 TATAGAGCAGACACTTGGCAGGG + Intronic
1190662755 X:52669721-52669743 TATAGAGCAGACACTTGGCAGGG - Intronic
1190676675 X:52788762-52788784 TATAGAGCAGACACTTGGCAGGG + Intronic
1191839575 X:65502085-65502107 CTTAGGGCAGTCACAAGCGAGGG - Exonic
1194877297 X:99205279-99205301 GTCAGGGAAGACACTTGAGATGG + Intergenic
1196752418 X:119129883-119129905 CTAAAAGGAGACACTTGGGAAGG - Intronic
1199535065 X:148893620-148893642 CTTAAGTCAGACACTGGTGAGGG + Intronic
1201969541 Y:19776364-19776386 CTTTGCACATACACTTGGGAAGG + Intergenic