ID: 1091692924

View in Genome Browser
Species Human (GRCh38)
Location 12:2609361-2609383
Sequence CTGTGAATAAGGAGTGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091692919_1091692924 13 Left 1091692919 12:2609325-2609347 CCACTGGGAGGAGTCCGTGGGGA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG 0: 1
1: 0
2: 3
3: 9
4: 154
1091692917_1091692924 14 Left 1091692917 12:2609324-2609346 CCCACTGGGAGGAGTCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG 0: 1
1: 0
2: 3
3: 9
4: 154
1091692920_1091692924 -1 Left 1091692920 12:2609339-2609361 CCGTGGGGAAACACATCCCTGTC 0: 1
1: 0
2: 3
3: 12
4: 240
Right 1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG 0: 1
1: 0
2: 3
3: 9
4: 154
1091692912_1091692924 27 Left 1091692912 12:2609311-2609333 CCCTAGCTCGGCTCCCACTGGGA 0: 1
1: 0
2: 0
3: 3
4: 127
Right 1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG 0: 1
1: 0
2: 3
3: 9
4: 154
1091692913_1091692924 26 Left 1091692913 12:2609312-2609334 CCTAGCTCGGCTCCCACTGGGAG 0: 1
1: 0
2: 1
3: 14
4: 164
Right 1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG 0: 1
1: 0
2: 3
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091692924 Original CRISPR CTGTGAATAAGGAGTGCCCA CGG Intronic
900429025 1:2593313-2593335 CTGGGGACAAGGACTGCCCACGG + Intronic
901220387 1:7580351-7580373 CTGTGAATGAGGGGAACCCAGGG + Intronic
903493557 1:23748179-23748201 CTATGACTAAGGACTGCACATGG + Intronic
904371180 1:30048430-30048452 CCGTGATTCAGGAGGGCCCAGGG + Intergenic
905347596 1:37321773-37321795 ATGTGCAAAAGGAGTGGCCAGGG + Intergenic
906657509 1:47559348-47559370 CTGTGAACATGGACTGGCCATGG - Intergenic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
910201891 1:84708512-84708534 CTTTGAATTAGCAGTGCCAATGG + Intergenic
910842896 1:91577975-91577997 CTCTGGACAATGAGTGCCCATGG - Intergenic
911294206 1:96094106-96094128 CACTGAATAAGGAGTTCACATGG - Intergenic
916399977 1:164436974-164436996 CTAAGAAAAAGGAGTGCCAATGG + Intergenic
916800660 1:168213247-168213269 CTGAGAATCAGGAGAGCCAATGG + Intergenic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
918117733 1:181511195-181511217 CTGTGACTCAGGAGTGCACAGGG - Intronic
920009215 1:202855626-202855648 CTGTGGAGAAGTGGTGCCCAAGG - Intergenic
923961442 1:239088566-239088588 CTGTGAACAATGAGTACACATGG + Intergenic
1065988774 10:30985679-30985701 CTGTGAATAAGGAGAACCAACGG - Intronic
1070367823 10:75753252-75753274 CTGAGAATAAGTAGTACCTAAGG + Intronic
1071449061 10:85777268-85777290 CTGGGAGAAAGGAGGGCCCAGGG - Intronic
1074367549 10:112871418-112871440 CTGAGAATTAGGAGAGCCAATGG - Intergenic
1074607642 10:114989514-114989536 CTGAGAACCAGGAGTGCCAAGGG - Intergenic
1075372368 10:121948278-121948300 CTGAGAATAAGTATAGCCCAAGG + Intergenic
1076016694 10:127033404-127033426 CTCTGAATAAGAAGTACCCCTGG - Intronic
1078708933 11:13771433-13771455 CTCTGGCTCAGGAGTGCCCAGGG + Intergenic
1079203075 11:18391962-18391984 CTGAGAATCAGGAGAGCCAAGGG + Intergenic
1080321014 11:31009570-31009592 CTGAGAATCAGGAGTGCTGATGG + Intronic
1080626684 11:34036851-34036873 CTTTGAATAAGGATTACCCTGGG - Intergenic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1081370105 11:42290085-42290107 CTTTGAATCAGGAGTGTCAATGG - Intergenic
1082920518 11:58487523-58487545 CTGAGAGCCAGGAGTGCCCAGGG - Intergenic
1083397382 11:62401101-62401123 GTCAGAACAAGGAGTGCCCAAGG + Intergenic
1085325851 11:75606131-75606153 CAGTGCATAAGGTGTTCCCAAGG + Intronic
1086438178 11:86801543-86801565 CTGTTCCTAAGGAGTGCACAGGG - Intronic
1088510339 11:110566974-110566996 CAGTGAACAAGCAGTGCACAAGG - Intergenic
1088582794 11:111331630-111331652 CTGTGTCAAAGGATTGCCCACGG - Intergenic
1088810892 11:113391340-113391362 CTGTGAATGAGGAGAGCCATTGG + Intronic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1092072713 12:5645936-5645958 CTGTGCTTAAGAAGTGGCCAGGG - Intronic
1092976663 12:13751679-13751701 CTGTGAGTTCGAAGTGCCCATGG + Intronic
1093656263 12:21697702-21697724 CTGTGAAGGAGGAGTGCCATGGG + Intronic
1095249909 12:39966738-39966760 CTGTGTATAAGGACTGGGCAAGG + Intronic
1095453959 12:42362840-42362862 CCCTGAATAATGAGTGACCAGGG - Intronic
1095509708 12:42937245-42937267 CTGTGAATTAGGAGTGCCCGTGG + Intergenic
1096758875 12:53823183-53823205 CTGTGACAGAGGAGTGCCTAGGG + Intergenic
1104032924 12:125078299-125078321 ATGTGCATCAGAAGTGCCCATGG - Intronic
1107591602 13:41913281-41913303 CTGGGGGTAAGGAGTGGCCATGG + Intronic
1111260975 13:85739263-85739285 CTGTGTATAAGGCATGTCCATGG + Intergenic
1111928907 13:94493420-94493442 CTGTGAGAAAGGAATTCCCAAGG + Intergenic
1112588250 13:100738807-100738829 CTTTAAAAAAGGAGTTCCCAAGG + Intergenic
1112700590 13:102003290-102003312 CTGTGAATAAAGAGAGCCATGGG + Intronic
1113069838 13:106409819-106409841 CTGTAATTAAGAAGAGCCCATGG + Intergenic
1117458606 14:55922372-55922394 CTGAGAATCAAGAGTGCCAATGG + Intergenic
1118210684 14:63763317-63763339 CTGTAAAGAAGTAATGCCCATGG + Intergenic
1118457558 14:65958539-65958561 CCATGGGTAAGGAGTGCCCAGGG + Intronic
1119107887 14:71941230-71941252 CGGTGAATTAGGAGTGTCAAAGG + Intronic
1120394176 14:83946462-83946484 CTGTGAACAAGGAGTGCCAAGGG - Intergenic
1120602311 14:86526631-86526653 CTGTGAAAAAGGAAAGCTCAAGG - Intergenic
1121886817 14:97550649-97550671 CTGGGATTAATGAGTACCCAGGG + Intergenic
1122760147 14:104018263-104018285 TTGTTAAAACGGAGTGCCCATGG + Intronic
1123979977 15:25592698-25592720 CTGGGGATCAGGAGTGCTCATGG + Intergenic
1125066467 15:35492112-35492134 CTGAGAATTAGGAGTGCTGAGGG + Intronic
1128469685 15:67941744-67941766 CTGTGGATATGGAGTGGTCAGGG + Intergenic
1130803704 15:87295224-87295246 CTGAGAACCAGGAGAGCCCATGG - Intergenic
1131119288 15:89813113-89813135 ATGTGAATAAGGACACCCCAGGG + Intronic
1132847240 16:2006265-2006287 CTGTGAGCAAGGTGGGCCCAAGG + Intronic
1133154508 16:3863625-3863647 CTTTGAATAAGGACTGTCTAGGG - Intronic
1139902357 16:70338159-70338181 CTGTGCATTGGGATTGCCCATGG + Intronic
1140956294 16:79869524-79869546 CTAAGAGTAAGGAGTGCTCAGGG + Intergenic
1146592628 17:34141245-34141267 CTGGGAATAAGGAGTGGTCCTGG + Intronic
1148819626 17:50353115-50353137 CAGCGAAGGAGGAGTGCCCATGG - Intronic
1157477525 18:48032981-48033003 CTCTGAATAATGAATTCCCAGGG - Intronic
1158124479 18:54086285-54086307 ATCTGAATAAGGAGTTTCCAAGG - Intergenic
1166894955 19:46017224-46017246 CTGAGAAAAAGGAGTAACCAAGG - Intronic
1168131973 19:54327059-54327081 CTGTGAAAAGGAAGGGCCCAGGG - Intergenic
1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG + Intronic
925923571 2:8654434-8654456 TTGTGAGTAAGGAGTGCATAAGG + Intergenic
929810881 2:45188439-45188461 CTGTCATGAAGGAGTACCCAGGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931213748 2:60222498-60222520 CTGTTGACTAGGAGTGCCCATGG - Intergenic
931428201 2:62189996-62190018 CTGGGAAGCAGGAGTGCCAAGGG + Intergenic
931824072 2:65981161-65981183 CTGTACATAAGGACTGGCCAAGG - Intergenic
937553905 2:123130920-123130942 CTGAGAATTAGAAGTGCCAACGG - Intergenic
939436932 2:142189222-142189244 CTGTGTATGAGGATTACCCATGG + Intergenic
944869821 2:203898839-203898861 CTGAGAATCAGGAGAGCCAATGG - Intergenic
945919846 2:215744604-215744626 CATTGAACAAGGAGTGCCCCAGG + Intergenic
947093761 2:226543191-226543213 CTGAGAACCAGGAGTGCACATGG + Intergenic
948251278 2:236531850-236531872 CTGCCAATAAGGAGGGACCATGG - Intergenic
1172239809 20:33405351-33405373 CTGAGAATCAGGAGTGCCAATGG - Intergenic
1172707293 20:36891549-36891571 CTGGGAATGAGGTGTGCCCTGGG + Exonic
1172998033 20:39084923-39084945 CTGTTTATAAGGAGTGCCCAGGG - Intergenic
1173800951 20:45894141-45894163 CGGAGAACAAGGAGTCCCCAAGG - Intronic
1175655893 20:60770459-60770481 CTATGAATAAGAATTGCCTAGGG - Intergenic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1181869031 22:25883318-25883340 CTCTGAATCAGGATTGCCTAGGG - Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
949229699 3:1736266-1736288 CTGAGAATCAGGAGAGCCAATGG + Intergenic
951319434 3:21226610-21226632 TTTTGAATAAGCAGTTCCCAAGG - Intergenic
956982815 3:74658632-74658654 CTTAGAATCAGGAGTGCCAAAGG - Intergenic
957315393 3:78569876-78569898 CTGTGCATATGGACAGCCCAAGG - Intergenic
957320293 3:78621550-78621572 CTGTAAATAAGGCAAGCCCAGGG + Intronic
961751200 3:129095828-129095850 CTGTGGAGAAGAGGTGCCCATGG + Intronic
962044620 3:131742341-131742363 CTTAGAAAAAGGAGAGCCCACGG - Intronic
967840942 3:194003935-194003957 CTCTGAATAAGCTGTACCCAGGG - Intergenic
968282750 3:197489481-197489503 CTGGGGCTGAGGAGTGCCCAGGG + Intergenic
968955569 4:3717147-3717169 CTCTGAATGAGGGGTGCCCAAGG + Intergenic
969571039 4:8008519-8008541 CTGTGCATAGGGAGAGCCCGAGG - Intronic
971012033 4:22448912-22448934 TTGTGAGAAAGGTGTGCCCATGG + Intronic
974811457 4:66951694-66951716 CTGAGAATGAGGAGAGCCAATGG - Intergenic
976000493 4:80368919-80368941 GTGAGAATTAGGAGTGCACAAGG + Intronic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
981455467 4:144948205-144948227 CTGAGAAGAAGGAGTGGCCTGGG - Intergenic
981901404 4:149869456-149869478 CTGTGACTGAGGAGTTCTCAAGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983739550 4:171111807-171111829 GTGTGAAAAAGGAGTCCCCTTGG - Intergenic
988540798 5:32107259-32107281 CTGTAAGTAAGTAGTCCCCATGG + Intronic
992088951 5:73301203-73301225 CGGGGAACAAGGCGTGCCCAGGG - Intergenic
992467883 5:77025070-77025092 CTGAGAACCAGGAGTGCCAAGGG - Intergenic
993358865 5:86948247-86948269 CTGAGAATCAGGAGAGCCAATGG + Intergenic
996589618 5:125132102-125132124 CTGGGAACAAGGAGTGCTGATGG + Intergenic
996589638 5:125132200-125132222 CTGGGAATCAGGAGTGCTGATGG + Intergenic
997086891 5:130811231-130811253 CTTTGAAGAAGGAGTTTCCATGG + Intergenic
997660162 5:135583220-135583242 CTGGGAATATGGACTCCCCATGG - Intergenic
999065222 5:148678496-148678518 CTGAGAATGAGGAGGGCCCAAGG - Intergenic
999841362 5:155431055-155431077 CTGAGAACCAGGAGTGCCAACGG - Intergenic
1000872996 5:166600422-166600444 CTGTCAATAAGGAGTCTTCAAGG - Intergenic
1001043951 5:168356823-168356845 CTGGGAATAAGGGAAGCCCATGG + Intronic
1001414433 5:171534693-171534715 CTGTCAATCAGCAGTGACCAGGG + Intergenic
1002403499 5:179009220-179009242 CTGAGAATCTGGAGAGCCCATGG + Intergenic
1007285711 6:40746028-40746050 CTGTGAATGATGACTGCCGATGG + Intergenic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1009674303 6:66797018-66797040 GTGTGAAAAAGGGGTGCCCATGG + Intergenic
1013872917 6:114789276-114789298 CTGTGCATAATGAGTGCATAAGG - Intergenic
1014816961 6:125946597-125946619 CTGGAAATAAGGGGTGCCCTGGG - Intergenic
1017667994 6:156740012-156740034 CTGAGAACAAGGAGTGTCAAGGG + Intergenic
1017782777 6:157729340-157729362 CTGTGAATGCAGAGTGCTCAAGG - Intronic
1018995996 6:168710790-168710812 CTGTGAATACAGGGTGCTCACGG + Intergenic
1022121683 7:27314571-27314593 CTTTGAATAAGAATTCCCCAGGG + Intergenic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026358501 7:69581118-69581140 CTGAGAAGCAGGAGTGCCAATGG - Intergenic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1028661636 7:93283914-93283936 CAGGGAATAATGAGTGCCTATGG + Intronic
1029600193 7:101558803-101558825 CTGTGAAGACAGAGTGCCCCAGG - Exonic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1034007807 7:147493422-147493444 CTGTTATTAAGGAGTGACTATGG + Intronic
1036526212 8:9537235-9537257 CTGAGAACCAGGAGTGCCAATGG - Intergenic
1036573333 8:10001338-10001360 CTGAGAACTAGGAGTGCCAAAGG - Intergenic
1036648879 8:10629472-10629494 CTGGGAATTAGGATTGGCCAGGG + Intronic
1037843334 8:22261254-22261276 CTCTAAATATGGAATGCCCAGGG + Intergenic
1038115048 8:24544146-24544168 CTGAGAATCAGGGGAGCCCATGG - Intergenic
1042753291 8:72181869-72181891 TTGAGAATCAGGAGAGCCCATGG - Intergenic
1042936003 8:74058933-74058955 CTGAGAACCAGGAGTGCCAAGGG + Intergenic
1048678724 8:136814492-136814514 CTCAGAATTAGGAGAGCCCATGG - Intergenic
1049200025 8:141335492-141335514 ATGTGTATCAGGAGTGACCAGGG + Intergenic
1049200101 8:141335886-141335908 ATGTGTATCAGGAGTGACCAGGG + Intergenic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1057990742 9:99767044-99767066 TTGAGAAGCAGGAGTGCCCATGG - Intergenic
1186400549 X:9254942-9254964 CTGGGAATAAGCAGTTTCCAAGG - Intergenic
1188142048 X:26562828-26562850 ATCTGAATAAGGAGTTCTCAGGG + Intergenic
1188460361 X:30418994-30419016 CTGTGAGTATTGAGTGACCAAGG - Intergenic
1189973691 X:46442096-46442118 CTGTCAATATGGAATACCCATGG + Intergenic
1192220429 X:69194123-69194145 CTGTGGACATGGAGTGCCCCTGG - Intergenic
1192260140 X:69501204-69501226 CTGAGAAGAAGGACTGGCCAGGG + Intergenic
1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG + Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198227217 X:134656464-134656486 CTGTGAATAAGAAGTCCTCCTGG - Intronic
1199461511 X:148090595-148090617 CTGAGAACAAGGAGAGCCAATGG - Intergenic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic