ID: 1091694827

View in Genome Browser
Species Human (GRCh38)
Location 12:2621446-2621468
Sequence CCTGAAGGGCCTGTGCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091694827_1091694833 -9 Left 1091694827 12:2621446-2621468 CCAGAGCGCACAGGCCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1091694833 12:2621460-2621482 CCCTTCAGGATCACGGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1091694827_1091694838 28 Left 1091694827 12:2621446-2621468 CCAGAGCGCACAGGCCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1091694838 12:2621497-2621519 GACTGTCCTTGGAAACCGCAGGG 0: 1
1: 1
2: 1
3: 7
4: 90
1091694827_1091694837 27 Left 1091694827 12:2621446-2621468 CCAGAGCGCACAGGCCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1091694837 12:2621496-2621518 TGACTGTCCTTGGAAACCGCAGG 0: 1
1: 1
2: 0
3: 5
4: 92
1091694827_1091694835 17 Left 1091694827 12:2621446-2621468 CCAGAGCGCACAGGCCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1091694835 12:2621486-2621508 GCACTTCCTCTGACTGTCCTTGG 0: 1
1: 1
2: 0
3: 24
4: 212
1091694827_1091694831 -10 Left 1091694827 12:2621446-2621468 CCAGAGCGCACAGGCCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091694827 Original CRISPR CCTGAAGGGCCTGTGCGCTC TGG (reversed) Intronic
901409352 1:9071829-9071851 CCTGGCGGGCCTGCGGGCTCCGG + Intronic
901857492 1:12053666-12053688 CCTGGGGGGCCTGTGTGTTCTGG - Intergenic
902630754 1:17702998-17703020 CCTGTAGGAGCTGTGTGCTCAGG + Intergenic
904756581 1:32771577-32771599 CCTGAAGGGCCTGCAGGCTCAGG - Exonic
905546600 1:38804708-38804730 CGCGGAGGGCCTGTGCGCTCGGG - Intergenic
905731739 1:40303185-40303207 CCTGAAAGGCCTCTGCTTTCAGG - Exonic
908413820 1:63892912-63892934 ACTGAAGGGCCTGTGCTTTTGGG - Intronic
912056021 1:105598576-105598598 CCTGAAGGACCAGTGTGATCAGG - Intergenic
913181946 1:116330724-116330746 CCTAACTGGCCTGTGAGCTCTGG + Intergenic
918038447 1:180897471-180897493 CCTGGGGGGCCAGTGGGCTCAGG - Intergenic
919767191 1:201135106-201135128 CCTGAAGACCCAGTGGGCTCAGG + Exonic
920035566 1:203063188-203063210 CCTGCAGGGCCTGTGCCATGTGG - Intronic
922303442 1:224323717-224323739 CCTGCCGGACCTGTGCCCTCTGG - Intronic
922577360 1:226671093-226671115 CCTGTAGGTTCTGTGAGCTCAGG + Intronic
1063178517 10:3573633-3573655 CCTCACAGGACTGTGCGCTCTGG - Intergenic
1065643736 10:27813097-27813119 CTTGAAGGGTTTGTGCACTCTGG + Intronic
1067760141 10:49038956-49038978 CCTGAGAGGCCTGGGCCCTCTGG - Intronic
1069826993 10:71260530-71260552 CCTGCAGGGCCTCTGGGCTCAGG + Intronic
1070611075 10:77933025-77933047 CTTGAGGGGACTGTGCCCTCAGG - Intergenic
1070819301 10:79345735-79345757 GCTGAAGGTCCTGTGAGCTCAGG + Intergenic
1072250598 10:93579275-93579297 CCTTAAGGCCCTGTGTGGTCTGG + Intronic
1076547218 10:131253413-131253435 GCTGAAAGGCCTGTGGACTCTGG - Intronic
1076707642 10:132310329-132310351 CTGGAGGGGCCTGTGGGCTCAGG + Intronic
1077309535 11:1882251-1882273 CCTGCAGGGCCTGGGCCATCTGG + Intronic
1077920853 11:6640890-6640912 CCAGCAGGGCCTGGGCCCTCCGG + Exonic
1078264926 11:9747972-9747994 CCTGCAGGGCCTGTTCCTTCAGG - Exonic
1079111479 11:17607663-17607685 CCTGAAGGGCCTGAGAGTGCAGG - Intronic
1081504198 11:43697841-43697863 ACTCAAGGGCCTGTGGGATCTGG - Intronic
1081857175 11:46311242-46311264 CCTGACTGGCCAGTGTGCTCAGG - Intronic
1083616559 11:64029218-64029240 CCTCAAGAGCCTTTGCGCTGTGG + Intronic
1084470756 11:69357641-69357663 CCTGAAGGGTCTGGGTGGTCAGG + Intronic
1086060585 11:82695867-82695889 CCAGAGGTGCCTGTGGGCTCCGG + Intergenic
1087275243 11:96154708-96154730 CCTCAAAGGACTGTGCACTCTGG - Intronic
1087960802 11:104346551-104346573 CCTGAAGAGCCTCTGAGATCTGG + Intergenic
1088684783 11:112275421-112275443 ACTGAAGGGCCTGAGCTCCCTGG - Intergenic
1089539076 11:119179104-119179126 CTTTAAGGGCCTGTGTGATCTGG - Intronic
1091066082 11:132514529-132514551 TCTGGAGGGCCTGGGCTCTCGGG + Intronic
1091694827 12:2621446-2621468 CCTGAAGGGCCTGTGCGCTCTGG - Intronic
1091694961 12:2622269-2622291 CCTGAAGGGCCTGCACACACTGG - Intronic
1092261623 12:6956048-6956070 CCAGAATGGCCTGTTAGCTCAGG + Intronic
1092289958 12:7154126-7154148 CGTGAATGGCCTGTCAGCTCAGG - Intronic
1094092078 12:26661595-26661617 CCTGATGGGCCTGAGGGCCCTGG + Intronic
1095981739 12:47978168-47978190 CCTGAAGGGTCAGTGGGCCCTGG - Intronic
1097147774 12:56953550-56953572 CCTTGAGGGCCTGTGGGCCCTGG - Intronic
1097902081 12:64883245-64883267 CTTTCAGGGCCTGTGAGCTCTGG + Intergenic
1102583113 12:113904492-113904514 CCTGAAGTGCTTTTGTGCTCAGG - Intronic
1103516147 12:121509653-121509675 ACTGAAGGGCCTGAAAGCTCTGG - Exonic
1103556615 12:121770521-121770543 CCTGGAGGGCCTGCGTGCTGGGG + Intronic
1104633622 12:130424658-130424680 CCTGCCGGGCCTGGGCTCTCTGG + Intronic
1104994061 12:132643136-132643158 CCTGGAGGGCCTGGGCACCCTGG + Intronic
1105463094 13:20609896-20609918 CATGAAAGGACTGTGCCCTCAGG + Intronic
1113627001 13:111854862-111854884 GCTGAAGGGCCTGTGATCTGGGG + Intergenic
1113734842 13:112671209-112671231 CCTGAAGAGGCTGTGAGATCCGG + Intronic
1114266324 14:21074603-21074625 CCAGAAGGGCCTGGGGCCTCGGG + Exonic
1115167229 14:30462875-30462897 CCTGAAAGGCCTGTGGGGTTGGG - Intergenic
1116471016 14:45285774-45285796 CCTGATGGGCCTCTGAGTTCTGG + Intergenic
1121220973 14:92285168-92285190 CCTGAACGGCCCGTGTGCTCTGG + Intergenic
1123574762 15:21655921-21655943 CCTGACTGGCCTGAGTGCTCAGG - Intergenic
1123611377 15:22098417-22098439 CCTGACTGGCCTGAGTGCTCAGG - Intergenic
1124221070 15:27850231-27850253 CCTCAGGGCCCTGTGCACTCAGG + Intronic
1124645974 15:31437758-31437780 CCTGCAGGGCCTGTTTCCTCTGG - Intergenic
1126704866 15:51397502-51397524 CCTGGAGGGCCTGGGGGCCCAGG - Exonic
1127178147 15:56383225-56383247 CCTGAAGAGTCTGTGCACTTAGG - Intronic
1128138760 15:65283951-65283973 CCTGAAACGCCTGTGCACTGTGG + Intronic
1129321110 15:74775495-74775517 CCTGCAGGGTCTGAGTGCTCAGG + Intergenic
1131510787 15:93048495-93048517 CCTCAAGGAACTGTGCGCTTGGG - Intronic
1202983629 15_KI270727v1_random:390173-390195 CCTGACTGGCCTGAGTGCTCAGG - Intergenic
1132519226 16:379762-379784 CCTGGAGGGGCTGTGAGCCCTGG - Intronic
1132677044 16:1125133-1125155 CCTGCAGGGCCTCTGGGCTGTGG + Intergenic
1134136177 16:11677788-11677810 CATGAAGGGCCAGTGCTCTGTGG - Exonic
1140037259 16:71380792-71380814 CCTGAAAGGCTTGTGCTCTCAGG + Intronic
1142161995 16:88562479-88562501 CCTGAAGGGGATTTGCACTCAGG - Intergenic
1143020766 17:3916257-3916279 CCTGCACGGCCTCTGCTCTCAGG + Exonic
1143110497 17:4550164-4550186 CCTGCAGGGCCGGAGGGCTCAGG + Exonic
1149045494 17:52239997-52240019 CCTGAAGGTCCTCTGTGGTCTGG - Intergenic
1151291906 17:73156490-73156512 GCTGAAGGGCCTCTGCTCCCCGG - Intergenic
1151529632 17:74696045-74696067 CCTGCAGGGCCTGGGGGCTGAGG - Intronic
1152457632 17:80425360-80425382 GCTGAAGGGGCAGTGCTCTCAGG - Intronic
1152692013 17:81722582-81722604 CCTGCAGGGCCTGTGGGTTAAGG - Intergenic
1158629767 18:59101609-59101631 CCTGAAGGTCCCCTGTGCTCAGG + Intergenic
1159260816 18:66009897-66009919 CCTGAAGATCCTTTGGGCTCTGG - Intergenic
1160066118 18:75575780-75575802 CCTGAAGGGGCTGGACCCTCTGG + Intergenic
1163261326 19:16191873-16191895 CTTGTAGGGCCTGTGCGTCCTGG + Exonic
1168373777 19:55858578-55858600 GCTGAAGGCCCTGTGCTCCCTGG + Exonic
925204403 2:1994214-1994236 CCTGACGGGCCTGTTCCTTCCGG + Intronic
925536865 2:4927253-4927275 CTTGAAGGGCCTGTGCAGCCAGG - Intergenic
925833947 2:7924577-7924599 CCAGAAGGCCCTGTGGGGTCAGG + Intergenic
927077836 2:19597795-19597817 TCTGAAGGGCCTGAGAGTTCAGG + Intergenic
927282443 2:21321119-21321141 GCTGAAGGCCCTGTGCACCCAGG + Intergenic
927673641 2:25089367-25089389 TCTGAAGGGCCTGTGAGCTGAGG - Intronic
932422921 2:71612024-71612046 CCTGGAGGGCCTGAGGGCTGTGG - Intronic
932773728 2:74515101-74515123 CCTGCAGTGCCTGGGCCCTCGGG + Exonic
935093264 2:99917212-99917234 CCTGAAGGGCCAGAGCCCTGAGG + Intronic
936153343 2:110033408-110033430 CCTCAAGAGCCTCTGCGCTTGGG - Intergenic
936191338 2:110338007-110338029 CCTCAAGAGCCTCTGCGCTTGGG + Intergenic
937082752 2:119151979-119152001 CCTAAAGGGCCTGGGCTCTGGGG + Intergenic
937952363 2:127398315-127398337 TCTGAAGGGCCTGCTGGCTCTGG - Intergenic
939991789 2:148882654-148882676 CCTGCATGGCCTGTGAGCTTTGG + Intronic
940719562 2:157267293-157267315 CCTGAAGGTCCTGAGTGATCTGG - Intronic
941404782 2:165074740-165074762 CCTGAACAGCCTGTGTGCTGTGG + Intergenic
942346085 2:175004807-175004829 CCTGGGGGGCCTGGGCGCCCGGG - Intronic
945455474 2:210047026-210047048 CCCGAAGGGACTTTGCACTCTGG + Intronic
946616644 2:221517358-221517380 AGTTAAGGGCCTGTGGGCTCAGG - Intronic
947524795 2:230871483-230871505 CCTGAGGGCCCTGTGCACTGTGG + Intronic
948055392 2:235006551-235006573 TCCCAAGGGCCTGTGCTCTCAGG + Intronic
948055398 2:235006567-235006589 TCTCAGGGGCCTGTGCTCTCAGG + Intronic
948900462 2:240954258-240954280 CCTGTGGGGTCTGTGCTCTCTGG - Intronic
948947317 2:241227501-241227523 CCTGAAGCGTCTGTGCTGTCAGG - Exonic
1168757786 20:327906-327928 CAGGAAGGGCCGGTGCGCTCAGG - Exonic
1169205648 20:3739023-3739045 CCAGAAGGGTCTGTGCACACAGG + Intronic
1171299301 20:24045691-24045713 CCTGAAGGGGCGGGGAGCTCTGG - Intergenic
1171795946 20:29567038-29567060 CTTGGAGGGCCTGAGCGCTAGGG + Intergenic
1173250691 20:41362859-41362881 CCTGAGGGGCTTGTGGGCCCAGG - Exonic
1173294832 20:41747542-41747564 CCTGATGGGGCTGGGGGCTCAGG + Intergenic
1176230956 20:64032699-64032721 GGTGCAGGGCCTGTGCCCTCTGG + Intronic
1179304779 21:40144358-40144380 CCTGCAGGGCCTGGGGTCTCGGG - Intronic
1179722875 21:43325317-43325339 CCAGAAGGTCCTGTGGGCACAGG - Intergenic
1180063777 21:45402792-45402814 CCTGGAGGCTCTGTGCCCTCTGG - Intergenic
1180083291 21:45496524-45496546 CCTGGAGGGCCTGGGGGCCCTGG - Exonic
1180988532 22:19919755-19919777 CCTGATCTGCCTCTGCGCTCTGG + Intronic
1181880228 22:25973301-25973323 CCTGAAGGGCAGATGTGCTCAGG - Intronic
1182431561 22:30301970-30301992 CCTGAAGGGCCTGTGGCTTTGGG - Intronic
1183393504 22:37559515-37559537 CCTGCAGGGCCTGGGGGCTCAGG - Intergenic
1185384931 22:50527239-50527261 CGTGGAGGGGCTGTCCGCTCTGG - Exonic
950485991 3:13274260-13274282 CCTGGATGGCCTCAGCGCTCAGG - Intergenic
952747598 3:36795663-36795685 TCTGAAGGGGCTGAGGGCTCAGG - Intergenic
952919583 3:38275584-38275606 CCTGAGGGGCCTGTCTTCTCTGG - Exonic
954145530 3:48632571-48632593 GCTTAAGGGCCTGTGAGCTCAGG - Intronic
954640374 3:52094191-52094213 CCTGAAGAGCCTTTGTGTTCTGG - Intronic
962927721 3:140010947-140010969 CCTGAATGGCCTGTGTGTTCTGG + Intronic
966748939 3:183303819-183303841 CCTGAAGACCCTGGGCGCCCAGG - Intronic
968472946 4:790222-790244 CCTGAGGGGCCAGTGGGCTGCGG + Intronic
968631507 4:1654488-1654510 CCAGCAGCGCCTGTGCGCTTTGG - Intronic
969495382 4:7523354-7523376 CCTGAAGGCTCTGTGACCTCAGG - Intronic
970310841 4:14780740-14780762 CCTGCAGGGCTAGAGCGCTCAGG - Intergenic
973784365 4:54321327-54321349 ACTGAAGGCCCTGTGTGATCTGG + Intergenic
985166516 4:187100731-187100753 CCTGAAGCACATGTGCCCTCAGG + Intergenic
986996451 5:13612572-13612594 CCTGAGTGGCCTGTGCGCAGAGG - Intergenic
989238951 5:39181542-39181564 ACTGAAGCTCCTGTGAGCTCTGG + Intronic
992509056 5:77415722-77415744 ACTGAAGGGGCTGTTAGCTCTGG - Intronic
998031969 5:138878183-138878205 CTGGAAGGGGCTGTGCTCTCTGG - Intronic
998205102 5:140152327-140152349 CCTTAAGGGCCTGTGATTTCTGG - Intergenic
1001803103 5:174560283-174560305 CCTGAAGGACCTCTCCCCTCTGG + Intergenic
1006780259 6:36627713-36627735 CCAGAAGGGCCTGGACCCTCAGG + Intergenic
1009407082 6:63326580-63326602 CCTGTGGGGCCTGAGGGCTCAGG - Intergenic
1011377955 6:86710737-86710759 CCTGAAGAGCCTGTGGGCCATGG + Intergenic
1013351987 6:109314128-109314150 GCTGGAGGGCCTGTGCGATGCGG + Intergenic
1013857351 6:114590234-114590256 TTTGAAGGGCCTGTGCGGTTTGG + Intergenic
1018423840 6:163662911-163662933 CCAGAAGGGCCTGAGGACTCTGG - Intergenic
1018683189 6:166281790-166281812 GCTGAAGGGCCTCTGCACACTGG + Intergenic
1019003567 6:168777523-168777545 CCTGTTGGGCCTGTGAGCCCAGG + Intergenic
1020916544 7:14200895-14200917 CATGAAGGGCCTGAGAGCTTGGG + Intronic
1027422368 7:78029585-78029607 CCTAAAGGGCCTCTGCGGTTGGG - Intronic
1029222805 7:99003610-99003632 CCGGAAGGGCCTGTGGGGTTGGG + Intronic
1030045390 7:105490592-105490614 CCTGAAGGGCCTGTTAGGTCAGG - Intronic
1032793555 7:135259808-135259830 CAGGAAGGGCCTTTGTGCTCAGG + Intergenic
1034632825 7:152543950-152543972 CCTGGGGGGCCTCTGGGCTCTGG + Intergenic
1034907860 7:154966406-154966428 ACTGAAGGCCATGTGCCCTCAGG - Intronic
1035765957 8:2105578-2105600 CCTGAAGATCCTGTTCTCTCTGG - Intronic
1036644011 8:10601078-10601100 CCTGCAGGGCCTTTGCTCTAGGG - Intergenic
1037639024 8:20725756-20725778 CCAGAAAAGCCTGTGGGCTCTGG - Intergenic
1048017804 8:130513130-130513152 CCTGTGGGGCCTGTGCAGTCTGG - Intergenic
1049122627 8:140752962-140752984 CTTGAAGGCCCTGTGTGGTCTGG - Intronic
1049288078 8:141787327-141787349 CCTGAAGGGCCTGCAAGCCCAGG + Intergenic
1049622810 8:143606197-143606219 CCTGAAGGTCCTGAGCCCCCAGG - Intronic
1049673388 8:143879309-143879331 CCTGGAGGTCCTGAGGGCTCAGG + Intergenic
1049703314 8:144024612-144024634 CCTGAAGAACCTGTCCCCTCAGG + Intronic
1051527010 9:18056706-18056728 CCTGAAGGGTCTGAGAGATCAGG - Intergenic
1056449085 9:86697913-86697935 CCTGAAAGGGCTGTGGGCTAAGG - Intergenic
1057192065 9:93093897-93093919 ACTGAAAGCCCTGTGCCCTCTGG - Intergenic
1057209767 9:93193365-93193387 CCTGAGGCCCCTGTGTGCTCAGG - Intronic
1060718304 9:125955294-125955316 CCTGAAGGGCTGGTGGGTTCTGG - Intronic
1061567030 9:131447755-131447777 CCTGAAGGGCCTTGACGATCTGG + Exonic
1062028601 9:134351963-134351985 CCAGAAGGGCCTGGGGGCTGAGG + Intronic
1062142370 9:134966746-134966768 CCTGAAGGCCCTGTGTGCCATGG + Intergenic
1062667457 9:137682966-137682988 GCGGAAGGGCCTGTGTGCCCTGG + Intronic
1062679685 9:137772037-137772059 CCTGCAGAGCCTGTGGGCACTGG + Intronic
1195614274 X:106900483-106900505 CCTGAATGGCCTGTGAGCTCAGG - Exonic
1200073463 X:153540092-153540114 CCTGAGGGCCCTGTGCTCACCGG + Intronic
1200115962 X:153769813-153769835 CCGGAAGGGCCAGTGCGGGCGGG + Exonic