ID: 1091694831

View in Genome Browser
Species Human (GRCh38)
Location 12:2621459-2621481
Sequence GCCCTTCAGGATCACGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091694827_1091694831 -10 Left 1091694827 12:2621446-2621468 CCAGAGCGCACAGGCCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091694831 Original CRISPR GCCCTTCAGGATCACGGTGA GGG Intronic
900826735 1:4933014-4933036 GCCCTTGAGAAACACGGGGAAGG - Intergenic
902161154 1:14531462-14531484 ACCCATCAGGATCACGTTGTGGG + Intergenic
902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG + Intergenic
905653049 1:39669182-39669204 GCCTTTCAGGGTCAGGCTGATGG + Intronic
905953740 1:41974911-41974933 GCCCTTCAGGACTGAGGTGAAGG + Intronic
915569350 1:156735894-156735916 TACCTTCAGGAACAGGGTGAGGG + Exonic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG + Intronic
1070746120 10:78935011-78935033 GCCCATCAGGATCACATGGATGG - Intergenic
1071481709 10:86069677-86069699 GCCGTTCAGGATGTCGGGGAAGG - Intronic
1075266250 10:121001608-121001630 GCCTTTCAGGATGGTGGTGAGGG - Intergenic
1076753451 10:132555251-132555273 GCCCTTCCCCAGCACGGTGAAGG - Intronic
1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG + Intergenic
1078935442 11:15945424-15945446 GCCCTTCAGCATCAGGCTGCTGG - Intergenic
1089868562 11:121652602-121652624 GCCCTTCTGGAGGACTGTGAGGG - Intergenic
1090028828 11:123190184-123190206 ACCATTCAGGTTCAGGGTGATGG - Intronic
1090046187 11:123335870-123335892 ACCATTCAGGATTACGTTGATGG + Intergenic
1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1100710986 12:97256849-97256871 TGCCTTGAGGAGCACGGTGAAGG - Intergenic
1118381048 14:65217694-65217716 GCCCTTCAGGTTCTAGGTAAGGG - Intergenic
1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG + Intronic
1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG + Intergenic
1142467184 17:142706-142728 CCCCTTCAGGGTCAGGGTCAGGG - Intergenic
1143972816 17:10807822-10807844 GCCCTTTAGGATCCAGGTCATGG - Intergenic
1145786058 17:27594608-27594630 GCCCTCCAGGATCCCACTGAAGG + Intronic
1146357184 17:32143838-32143860 ACCCCTCAGGGTCACCGTGATGG + Intronic
1149992597 17:61391248-61391270 GCCCTTCAGGTTGATGCTGAGGG + Intronic
1151265258 17:72950336-72950358 GCCCTGCAGTATCACGGTTAAGG + Intronic
1151384816 17:73748587-73748609 GTCCTTCAGCAGCCCGGTGAGGG + Intergenic
1151980848 17:77507539-77507561 TCCCTCCAGGGACACGGTGATGG - Intergenic
1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG + Intronic
1152987146 18:331256-331278 TCCCTTCAGGATCACACTGTGGG - Intronic
1157211050 18:45742261-45742283 GTCCTTCAAGATCAAGGAGAAGG + Intronic
1160419829 18:78736195-78736217 GCGCTTCACGCTCACGGGGAGGG - Intergenic
1160820384 19:1055044-1055066 GCGCTGCAGGGTCAAGGTGAAGG - Intronic
1161224317 19:3136143-3136165 GCCCGACAGGTTGACGGTGAAGG - Intergenic
1162145266 19:8609405-8609427 TCCCTTCAGGATCCCCGGGATGG - Intronic
1165369512 19:35395787-35395809 GACCTCCAGGGTCACTGTGAGGG + Intergenic
1165797292 19:38526511-38526533 GCCCTCAAGGACCAAGGTGAGGG - Intronic
925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG + Intergenic
928361412 2:30665011-30665033 GTCCTTCAGGGGCACGGCGATGG + Intergenic
931155639 2:59625626-59625648 GCCCTTCAGAATTACTGGGAAGG + Intergenic
938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG + Exonic
939243101 2:139587674-139587696 GCCCTTAAGGATCACAGTTAAGG - Intergenic
1172211409 20:33201124-33201146 GCCCTACAGGATCAGGAAGATGG - Intergenic
1174634867 20:51990290-51990312 GTCCTTGAGGATCATGATGATGG + Intergenic
1175465867 20:59191168-59191190 GGCCTTCAGGAACACAGTGGGGG - Exonic
1179812796 21:43883220-43883242 GCCCTTGAGGCTCAAGGAGAAGG - Intronic
1179912347 21:44456835-44456857 GAGCTTCAGGAGCACGGTGTTGG - Exonic
1179923160 21:44518420-44518442 GGGCTTTAGGATCACGGTGTTGG + Intronic
1181347814 22:22233126-22233148 CCCCTGTAGGATCATGGTGATGG - Intergenic
1183545215 22:38451801-38451823 ACCCATCAGGGTCACAGTGATGG - Intronic
1183698255 22:39435450-39435472 GCCCTTCAGGGGCTGGGTGAGGG - Intronic
950009534 3:9713032-9713054 GCCCTTCAGCATCCCTGTGCGGG + Exonic
950678504 3:14569060-14569082 GGCCATCAGGATTACGGGGAGGG + Intergenic
951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG + Intergenic
954821110 3:53328209-53328231 GCCCTTCAGGTTCAGTGTGCTGG - Intronic
963597493 3:147346696-147346718 GTCCTTCAGGCTCACGATCAAGG - Intergenic
982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG + Intronic
986223728 5:5793764-5793786 GACCTTCAGGACCTTGGTGAAGG - Intergenic
986697738 5:10373639-10373661 GCCCTCCAGGAACATCGTGACGG - Intronic
986702566 5:10425302-10425324 TCCCTTCAGGATCAGAGTGCAGG + Intronic
987458979 5:18183879-18183901 GCTATTCAGCATCACAGTGAAGG + Intergenic
997202599 5:132020818-132020840 ACCCTTGAGGAGCATGGTGATGG - Intergenic
1003899542 6:10641393-10641415 GCCCTTCAGTGTCACCCTGATGG + Intergenic
1004457145 6:15801649-15801671 GCCTTTCAGGATGAAGGTGGGGG + Intergenic
1006258883 6:32852588-32852610 GCCCTCCAGGATAATGGTGAGGG - Intronic
1006261726 6:32879783-32879805 GTCCTTCAGGATCCCCTTGAGGG + Intergenic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1030845145 7:114400507-114400529 TTCATTCAGGATCACTGTGATGG + Intronic
1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG + Intronic
1038680096 8:29658791-29658813 GCCCTTCAGGTTCATGGAGGGGG - Intergenic
1043997536 8:86836918-86836940 GTCCTTCAGGACCATGGAGAGGG - Intergenic
1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG + Intergenic
1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG + Intronic
1052273743 9:26655287-26655309 GCCCTTCAGGAGAACTGTGTAGG + Intergenic
1057877779 9:98771097-98771119 GCCGTGCAGGATCACAGTGTGGG + Intronic
1061546870 9:131309533-131309555 GTCCATCAGCATCACAGTGAGGG - Intergenic
1061891763 9:133625406-133625428 GCCCTGCAGAATCACAGGGATGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1203772988 EBV:58868-58890 GCCCCTCAGGACCACGGAGCTGG + Intergenic
1187985688 X:24808229-24808251 GCCCTTCATGGCCACCGTGATGG + Intronic
1188314020 X:28651708-28651730 GCCATTCAGAATGAAGGTGAAGG - Intronic
1191959150 X:66680345-66680367 GCCCTTCAGGAGCACTGGGCTGG - Intergenic