ID: 1091696282

View in Genome Browser
Species Human (GRCh38)
Location 12:2630405-2630427
Sequence CCTCCTAGGACCCAACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091696274_1091696282 10 Left 1091696274 12:2630372-2630394 CCTTCCACTCCCGAGAGTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1091696278_1091696282 1 Left 1091696278 12:2630381-2630403 CCCGAGAGTGTTGGGAAAAGTAT 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1091696279_1091696282 0 Left 1091696279 12:2630382-2630404 CCGAGAGTGTTGGGAAAAGTATT 0: 1
1: 0
2: 3
3: 23
4: 191
Right 1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1091696273_1091696282 11 Left 1091696273 12:2630371-2630393 CCCTTCCACTCCCGAGAGTGTTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1091696277_1091696282 6 Left 1091696277 12:2630376-2630398 CCACTCCCGAGAGTGTTGGGAAA 0: 1
1: 0
2: 3
3: 11
4: 75
Right 1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091696282 Original CRISPR CCTCCTAGGACCCAACCACC TGG Intronic
900389858 1:2429122-2429144 CCTCCTCGCACCCAATCCCCAGG - Intronic
900714789 1:4137410-4137432 CTTCCTGGGACCCAAAAACCAGG - Intergenic
906725542 1:48041653-48041675 CCTGCTAGGACCCAAGCAAATGG - Intergenic
906934064 1:50196337-50196359 CCTTCAAGTACCCAACCCCCAGG + Intronic
911896825 1:103446564-103446586 CCTCCCCAGACCCAACCAACAGG - Intergenic
917196117 1:172467516-172467538 CCTCATAGGGGCCTACCACCTGG + Intronic
922585946 1:226735709-226735731 CCTCCAAGGCCCCATCCTCCTGG + Exonic
922757860 1:228106394-228106416 CCTCCTAGGAACCAACCTGAGGG + Intergenic
922764932 1:228151758-228151780 CCACCTAGGACCCAAGCCCGAGG - Intronic
1062902550 10:1156927-1156949 CCTCCTAGGACCCCTGCCCCAGG - Intergenic
1069907107 10:71738436-71738458 CCTCCTTGGCCCCAAACACCTGG - Intronic
1070788858 10:79178000-79178022 CCTCCTAAGACCCCACCATGTGG - Intronic
1072456163 10:95578098-95578120 CCTCCTTCCACCCAAACACCTGG + Intergenic
1073410018 10:103332880-103332902 CCTCCGGTGACCCACCCACCTGG - Intronic
1077166466 11:1142002-1142024 CCTCCCATGACCCCAACACCTGG - Intergenic
1077514713 11:2994504-2994526 CCTCAGAGGATCCACCCACCCGG - Intergenic
1078003182 11:7513802-7513824 CCTGCTGGGACCCGTCCACCAGG - Exonic
1082991977 11:59214538-59214560 CCTCCTTGGAGCAAATCACCAGG - Intergenic
1083156894 11:60828853-60828875 ACTCCCAGGATCCACCCACCAGG + Intergenic
1083476983 11:62921281-62921303 TCTCCAGGGACCCAAACACCTGG + Exonic
1083756878 11:64796684-64796706 CTTCCTCGGCCCCTACCACCAGG + Exonic
1084393949 11:68896752-68896774 CACCCTAGGGCCCCACCACCAGG - Intronic
1085557873 11:77441862-77441884 CCTGCAAGGACCAAATCACCAGG + Intronic
1089684652 11:120139028-120139050 GCCCTGAGGACCCAACCACCTGG - Intronic
1090095653 11:123740263-123740285 CCTCCTAGGACCAAACGCCTGGG - Intronic
1090417228 11:126548837-126548859 GCTCCCAGGACCCACCCACGTGG - Intronic
1090920805 11:131204383-131204405 CCTCCAAGGAACAAACCCCCTGG - Intergenic
1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG + Intronic
1091701384 12:2665643-2665665 CATCCTTGGTCCCCACCACCTGG + Exonic
1092063327 12:5568492-5568514 TCTCCTAAGCCCCTACCACCAGG + Intronic
1092204199 12:6605974-6605996 CCTCCGAGGACCCACATACCAGG + Intronic
1092230501 12:6773220-6773242 CCTCCTGGGCCCACACCACCGGG - Exonic
1097465880 12:59923918-59923940 CCACATGGGTCCCAACCACCAGG + Intergenic
1097953558 12:65460208-65460230 CCTCCCAGGCCCCAGCCAACTGG - Intronic
1100459033 12:94780372-94780394 CCTCCCAGGACCCCACAACCTGG + Intergenic
1102509415 12:113403976-113403998 CCTGCCAGGACCCACCCCCCTGG + Intronic
1106593082 13:31114579-31114601 CCTCCTAGGAGACATCCACCTGG + Intergenic
1107966406 13:45602164-45602186 TCTCCTGGGACCCAGCCACTAGG - Intronic
1108684786 13:52809425-52809447 CCTCCCAGGCCCCGACCCCCAGG - Intergenic
1108727922 13:53201657-53201679 TCTCGGTGGACCCAACCACCAGG + Intergenic
1109787584 13:67200362-67200384 CCTGCTGGGACACAACCACCTGG - Intronic
1115342379 14:32306207-32306229 CCTTCCAGGAACCAAGCACCTGG - Intergenic
1118633387 14:67726133-67726155 CCACCTGGGAGTCAACCACCTGG + Exonic
1119461597 14:74809404-74809426 CCTCCTATGGGCAAACCACCAGG + Exonic
1121730396 14:96182877-96182899 CCTCCATGGATCCAACAACCAGG + Intergenic
1122971190 14:105152903-105152925 CCCCCCAGGACACAACCACCAGG + Intronic
1125595269 15:40881416-40881438 CCTCCAAGGACACAAGCACATGG - Intergenic
1126122689 15:45267789-45267811 CCTCCTTGGACTCACCCACGGGG - Exonic
1129251034 15:74309085-74309107 CCTCCTAAGACACAGCCACCAGG + Intronic
1129771177 15:78204468-78204490 CCTCCTAGGACCCTGCCATGTGG - Intronic
1129979823 15:79858203-79858225 CCCTCTAGGACCTAACAACCTGG + Intronic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1132583373 16:695197-695219 CCTCCTCGCTCCCACCCACCGGG + Intronic
1132677405 16:1126470-1126492 CCACCCAGGACTCACCCACCTGG + Intergenic
1132721008 16:1315561-1315583 GCTTCTAGGACACAACCTCCAGG - Intronic
1134098007 16:11431974-11431996 CCTCTTGGAACCCAGCCACCTGG + Intronic
1137613743 16:49835274-49835296 CCTCCTCAGACCCCACCTCCCGG - Intronic
1138584135 16:57959809-57959831 CCGCCTAACACCCAACCTCCTGG - Intronic
1138747162 16:59376745-59376767 CTTCCCATGACCCAAACACCAGG + Intergenic
1141134608 16:81457389-81457411 CCTCCCAGAATCCCACCACCTGG + Intronic
1141612013 16:85187179-85187201 CCTCCTAGGCCCCAAGCTCCAGG - Intergenic
1141619144 16:85227626-85227648 CCTCAAGTGACCCAACCACCCGG - Intergenic
1143215647 17:5222895-5222917 CCTCAGAGGATCCCACCACCTGG + Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145298759 17:21614552-21614574 CCTACCAGGATCCTACCACCAGG - Intergenic
1145312156 17:21706647-21706669 CCTCCTAGGACCCCAGTAGCAGG + Intergenic
1145351521 17:22088738-22088760 CCTACCAGGATCCTACCACCAGG + Intergenic
1145991508 17:29081789-29081811 CCTCCTAATACCCATCCACTGGG - Intronic
1146127405 17:30239781-30239803 CCTCCTAGCACCCCATCACCCGG + Intergenic
1148492550 17:48032645-48032667 CCTCCGAGGCCCCATCCCCCTGG - Intronic
1149134963 17:53353614-53353636 CCTCCTCCTACCCAAGCACCAGG - Intergenic
1149495742 17:57116160-57116182 CCTCGTAGGAGGCAACCACTTGG - Exonic
1150364283 17:64567802-64567824 CCTCCTGGGTCCCAACTAGCTGG + Intronic
1150460389 17:65345559-65345581 CGTCCCAGGAGCCAACCAGCAGG + Intergenic
1152271194 17:79325874-79325896 CCTCCTAGGAAAAACCCACCCGG + Intronic
1152461653 17:80445108-80445130 GCTCCTAGGCCCCAGCCACAAGG - Intergenic
1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG + Exonic
1156377388 18:36527124-36527146 CCTCCCAGGGCCCCTCCACCAGG - Intronic
1160209246 18:76862441-76862463 CCTGCTTGGGCCCAAGCACCGGG - Intronic
1160622433 18:80180492-80180514 CCTCCCAGGACCAACCCAGCCGG + Intronic
1160815887 19:1035497-1035519 CCTCCTCTGACCCAATCCCCGGG - Intronic
1161104213 19:2435203-2435225 CCGCCTGGGCCCCAAGCACCAGG + Intronic
1161581444 19:5083031-5083053 CCTCCAGGGACCCCACCAGCAGG - Intronic
1161805668 19:6441769-6441791 ACTCCTATGCCCCAACCACTGGG - Exonic
1161826749 19:6572619-6572641 CTTCCTAGGACCCAAAAATCAGG - Intergenic
1162071535 19:8155224-8155246 CCCACTGGGACCCCACCACCAGG + Intronic
1162310949 19:9906967-9906989 CCCTCTAGGACCCAGCCACCAGG - Intronic
1162822272 19:13230125-13230147 CATCCTGGGCCCCCACCACCTGG - Exonic
1163472292 19:17504692-17504714 CCGCCTAGTACACACCCACCTGG + Exonic
1163826630 19:19527936-19527958 CCTGCTAGGACCCATCCCCCAGG - Intronic
1164610618 19:29629100-29629122 CCACCAAGGACCCAGACACCAGG + Intergenic
1165067460 19:33237360-33237382 CCTCCCTGGACCAAACTACCTGG + Intergenic
1166252204 19:41578966-41578988 CCTCCTAGGATCCTACATCCAGG - Intronic
1167043735 19:47038123-47038145 CCTCTCAGGACCCATCCTCCAGG - Intronic
1167339410 19:48905953-48905975 CTGCCTAGCACACAACCACCTGG - Intronic
926122525 2:10252621-10252643 CCTCCTAGAACCCCAACAGCTGG - Intergenic
932514832 2:72334982-72335004 CCTCCTGGAACCCAGGCACCGGG + Exonic
933996996 2:87677372-87677394 CCTCCTCTGACCCAACCCCAAGG - Intergenic
936296855 2:111273538-111273560 CCTCCTCTGACCCAACCCCAAGG + Intergenic
938312606 2:130302703-130302725 CCTGCAAGGATCCTACCACCTGG - Intergenic
941917204 2:170820625-170820647 CCTCCTTGTCCCCAACCACTAGG + Intronic
943593802 2:189831025-189831047 TTTCCTATAACCCAACCACCTGG - Intronic
948589477 2:239039913-239039935 CCTCCTTGGTCCCAGCCACAGGG + Intergenic
948704253 2:239779309-239779331 CCTTCTGGGGCCCAGCCACCAGG + Intronic
1168908669 20:1427560-1427582 TCTCCTATGCCCCAGCCACCAGG + Intergenic
1178660454 21:34503366-34503388 CCTCCTAGGGACCACCCTCCAGG + Intergenic
1180231615 21:46429799-46429821 CCTTCCAGGGCCCACCCACCTGG - Intronic
1180305279 22:11068168-11068190 CCTCCAAGGATCCTACCACTTGG - Intergenic
1181052185 22:20243191-20243213 CCTCCTGAGACCCAATCTCCGGG - Intronic
1184245344 22:43232956-43232978 CCTCCTGGGTCCCGACCTCCAGG + Intronic
1184392361 22:44211808-44211830 CTTCCCAGGCCCCAACCTCCGGG + Intronic
952903533 3:38125529-38125551 CCCCCTATGACCCCACCGCCAGG + Intronic
953930223 3:47002292-47002314 CTTCCTGGGCCCCAACCTCCAGG - Intronic
954362918 3:50131861-50131883 CCTCCAAGGACCTAGCCTCCAGG - Intergenic
959111135 3:102123819-102123841 CCCCCATGGACCCAAGCACCAGG - Intronic
961456548 3:127027431-127027453 CCTCCTAGGGACCACCCAGCTGG - Intronic
963598678 3:147358907-147358929 CCCCCAAGGATTCAACCACCTGG - Intergenic
967989580 3:195121082-195121104 GCTCCCAGGGCCCAAACACCCGG + Intronic
969878422 4:10153360-10153382 GCACCTGGGACCCAGCCACCTGG - Intergenic
969881192 4:10175503-10175525 ACTCTTGGGACCCAGCCACCTGG - Intergenic
970932729 4:21531607-21531629 CCTCAAATGACCCAACCACCTGG + Intronic
972520879 4:39855141-39855163 CCTCATGGGACCCAGCAACCAGG + Intronic
972556490 4:40186738-40186760 CTTCCTAGGACTGAGCCACCAGG + Intergenic
974913261 4:68148684-68148706 CCTCCTGGGTCCAAACCATCCGG + Intergenic
979446100 4:120813856-120813878 CCTCCTCGGACCCATCCAGTGGG - Intronic
981965921 4:150603168-150603190 CCTCTTAGGACACAATCTCCAGG + Intronic
984635122 4:182102029-182102051 TCTCCTAGGGTCCAGCCACCTGG + Intergenic
984680962 4:182608792-182608814 CCTCCTAGGACCCCTGCAGCAGG - Intronic
991249081 5:64539640-64539662 CCTCCCGGGACCTGACCACCAGG + Intronic
1007389272 6:41540999-41541021 CCTCCAAGGGCCCAGGCACCCGG + Intergenic
1007987747 6:46224192-46224214 CCTCCTCTTACCCCACCACCTGG - Intronic
1008125799 6:47666835-47666857 CCTACTTGGACCCAGCCAACTGG - Intronic
1008672814 6:53790838-53790860 CCTCCTACAACCCAACTAACAGG + Intergenic
1009720116 6:67457894-67457916 ACTCCCATGACCCAAACACCAGG - Intergenic
1012477949 6:99635594-99635616 CCTACTAGGACCCAGCACCCTGG - Intergenic
1012960447 6:105616301-105616323 CCATCTAGGCCCCTACCACCAGG - Intergenic
1015587303 6:134789387-134789409 CCTCCTGAGCCCCCACCACCAGG + Intergenic
1015713952 6:136171463-136171485 CCTCCTAAGCCCAAACCACCAGG - Intronic
1016341041 6:143061331-143061353 CCTCCAAAGAGCCCACCACCTGG - Intronic
1019278643 7:188950-188972 CCTCCTTAGACCCATCCACCCGG + Intergenic
1020407906 7:7857414-7857436 CAGCCTAGGTCCCAACCATCTGG + Intronic
1022112594 7:27240545-27240567 CCTCTGAGGACCCAGCCCCCAGG + Intergenic
1026906131 7:74063674-74063696 CCTCCAAGGCCCCCAACACCTGG - Exonic
1032002372 7:128273748-128273770 CCTCCTGGGACACCACCACGAGG + Intergenic
1032932948 7:136695132-136695154 CCCCCTCGGTCCCAAACACCAGG + Intergenic
1033446762 7:141430086-141430108 CCTCCGAGGACCAAAACAGCTGG - Intronic
1033684223 7:143623952-143623974 CCTCATGGGACACAACCACGAGG - Intronic
1033687399 7:143703171-143703193 CCTCATGGGACACAACCACGAGG - Exonic
1033700389 7:143833671-143833693 CCTCATGGGACACAACCACGAGG + Intergenic
1033704835 7:143876413-143876435 CCTCATGGGACACGACCACCAGG + Exonic
1038319568 8:26514442-26514464 TCTCCGAGGACCCTTCCACCGGG - Intronic
1044531893 8:93316696-93316718 CCTCCAATGACCCATCCACAGGG + Intergenic
1044822075 8:96161311-96161333 CCTCCTCGGCCCCAACCGCCAGG + Intergenic
1044850181 8:96419915-96419937 CCTCCGAGGAACCAACAAACGGG - Intergenic
1047445059 8:124912279-124912301 CCTCCCAGGAGTCAACCTCCAGG - Intergenic
1048077937 8:131093913-131093935 CCACCAAGGACACCACCACCAGG - Intergenic
1049240383 8:141534933-141534955 CCTCCTCAGACCCCACCACAGGG + Intergenic
1049965682 9:776833-776855 CATCCTAGGACCCAATTACAGGG + Intergenic
1052762221 9:32604292-32604314 ACTCCTAGGACCAAGCCTCCTGG - Intergenic
1055502353 9:76913973-76913995 TCTCCTAGGACCCTAAGACCTGG - Intergenic
1061720224 9:132546753-132546775 CCTTCTGGGCCCCAGCCACCAGG - Intronic
1061905425 9:133694285-133694307 CCGCCTGGCACCCAGCCACCAGG - Exonic
1187547723 X:20268412-20268434 CCTCCCGGGACCCAGACACCTGG + Intergenic
1187652201 X:21421366-21421388 CCTCATAGGAACCAAACATCAGG - Intronic
1188183723 X:27088419-27088441 ACCCCTAGGACACTACCACCAGG - Intergenic
1189313397 X:40035796-40035818 CTTCCTGGAACCCAGCCACCAGG + Intergenic
1191807268 X:65148335-65148357 CCTCCATGAACCCAGCCACCAGG - Intergenic
1194693413 X:97014314-97014336 CTCCTTAGGACCCAACAACCTGG - Intronic