ID: 1091696316

View in Genome Browser
Species Human (GRCh38)
Location 12:2630500-2630522
Sequence CTGTTGAAATAGTGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091696303_1091696316 19 Left 1091696303 12:2630458-2630480 CCTTGTTTCTGGGCAGGGTGTGG 0: 1
1: 0
2: 3
3: 37
4: 349
Right 1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 255
1091696300_1091696316 25 Left 1091696300 12:2630452-2630474 CCTGGGCCTTGTTTCTGGGCAGG 0: 1
1: 0
2: 6
3: 35
4: 302
Right 1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 255
1091696311_1091696316 -5 Left 1091696311 12:2630482-2630504 CCAAGTGGGAGGAAGGGGCTGTT 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091696316 Original CRISPR CTGTTGAAATAGTGGGAGGA GGG Intronic
900753522 1:4416724-4416746 CTTTTAAAATCGTGGGAAGAAGG - Intergenic
900939309 1:5787522-5787544 CTGTCAAAATCCTGGGAGGAGGG - Intergenic
902043959 1:13512029-13512051 CTGCTGAAATCTTGGGAGCAAGG + Intronic
902072625 1:13753740-13753762 ATGTAGAAAGAGTGGCAGGATGG + Intronic
904995038 1:34625086-34625108 CTGCTGCAATAGTGGTGGGAAGG + Intergenic
905271871 1:36792670-36792692 CTGCTGAAGGAGTGGGTGGACGG + Intergenic
907711525 1:56887049-56887071 CTGTTCAATGAGTGAGAGGAAGG + Intronic
908019119 1:59881557-59881579 TTGTTTAAATGGTGGCAGGAGGG + Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
910449273 1:87329652-87329674 TTTTTGAAACAGTGGCAGGAAGG + Intronic
910719849 1:90274063-90274085 CTGGTGAAAAAGTGAGATGAGGG - Intergenic
911547668 1:99239319-99239341 CTCATGAAATATTGGGAGAAGGG - Intergenic
912115853 1:106406984-106407006 CTGATTAAATAGTGGGAGCATGG - Intergenic
918664848 1:187138057-187138079 ATGTTGAAATAATGGGAGGCTGG + Intergenic
920415823 1:205798816-205798838 CTGGTGAGCAAGTGGGAGGAGGG + Intronic
920518179 1:206602207-206602229 CTGTGGAAAGAGTGGAGGGAAGG - Intronic
920860056 1:209698566-209698588 CTGTTGAAACATTGGCAGCATGG - Intronic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
922799139 1:228356436-228356458 CTGCTGAAACAGTGGGACCACGG - Intronic
923866855 1:237948766-237948788 CTGTTGCTATAGTGGTAAGAAGG + Intergenic
1063773717 10:9235676-9235698 CTATGGAAATATTGGGAGGAGGG - Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064515619 10:16144586-16144608 CTGTTAACATAGGGGGAGGGAGG - Intergenic
1066519396 10:36198808-36198830 CAGTGGACATAGTGGCAGGAAGG - Intergenic
1066534545 10:36376334-36376356 TTTTTGAAATAGTTTGAGGAGGG + Intergenic
1068229687 10:54156233-54156255 ATGTTGAAACACTGAGAGGAAGG - Intronic
1068547835 10:58371145-58371167 CTTTTGAGATAGTTGGAGGATGG - Intergenic
1068555335 10:58452605-58452627 CAGTTGCAATACTGGGAAGAGGG + Intergenic
1070252058 10:74781659-74781681 CTTTTGAAATAATGTGTGGAAGG + Intergenic
1070650300 10:78230544-78230566 ATGTGGAGGTAGTGGGAGGAGGG - Intergenic
1071415472 10:85437235-85437257 CAGGTGAGATAGTGGGAGAAGGG - Intergenic
1071472240 10:85991851-85991873 ATGTGGAAAATGTGGGAGGAGGG + Intronic
1073337159 10:102718448-102718470 CTGAAGCAAGAGTGGGAGGAGGG - Intronic
1073982641 10:109172527-109172549 CTCTTGAAATCTTGGGAGAATGG - Intergenic
1075328343 10:121553202-121553224 ATGCTGAAACAGTGGGAAGAGGG + Intronic
1076138746 10:128063275-128063297 CTGCAGTGATAGTGGGAGGAAGG - Intronic
1078737754 11:14036170-14036192 CTGTTGAAATACTCTGAGGAAGG + Intronic
1080144891 11:28969712-28969734 CTATTGAAATAGTTGGATTATGG - Intergenic
1081181958 11:39994727-39994749 CTCTGGCAATATTGGGAGGAAGG + Intergenic
1083547673 11:63561042-63561064 CAGCTGAGATAGGGGGAGGAGGG - Intronic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1086992501 11:93319453-93319475 CTGTTCAAATAGTGGAAAAATGG - Intergenic
1087232852 11:95685378-95685400 CTGTTGAGAAAGTGAGGGGAGGG + Intergenic
1087400746 11:97664134-97664156 CTGATAAAATAGTGGGATAAAGG + Intergenic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088486637 11:110347211-110347233 CTGTTCTAAGGGTGGGAGGAAGG - Intergenic
1088811485 11:113395564-113395586 CTCTAGAAATAGAGGCAGGAAGG - Intronic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1090009132 11:123030410-123030432 CTTTTTAAATGGGGGGAGGAAGG + Intergenic
1090011986 11:123053537-123053559 CTCTTGGAAGAGTGGGAGGGTGG - Intergenic
1090446515 11:126769178-126769200 GTGTTGAAAGCGTAGGAGGAAGG - Intronic
1091046373 11:132329428-132329450 CTGTAGAAATGCTGGGAGGCTGG - Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1092479552 12:8847711-8847733 CTGCTGACAGAGTGGGAGGAGGG + Intronic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1097661955 12:62439935-62439957 CTGTTGAGACTGTGGGAGAAAGG - Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1100981384 12:100165482-100165504 TAGTTTAAATGGTGGGAGGAAGG - Intergenic
1101680351 12:106957648-106957670 CTGTTGAAATAATGTGAAGATGG + Intronic
1102930048 12:116855340-116855362 CTCTTGAGGTAGTGAGAGGATGG + Intergenic
1104634787 12:130431092-130431114 CTTTTGTAATATTGGGAGAATGG + Intronic
1105326950 13:19379338-19379360 CTGATGAAATAGTTTGAAGATGG - Intergenic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1106405767 13:29471635-29471657 GTGTGGTAATAGTGGGAGGGAGG - Intronic
1106577855 13:30992609-30992631 CTGGTGGAAGTGTGGGAGGAGGG + Intergenic
1107235536 13:38165141-38165163 ATCCTGAAAGAGTGGGAGGAGGG - Intergenic
1108208652 13:48116431-48116453 TTTTTGAAATAGTAGGATGAAGG + Intergenic
1108667686 13:52649177-52649199 TTATTGAAATCTTGGGAGGAAGG - Intergenic
1110999205 13:82156626-82156648 ATGTTGTAATTTTGGGAGGAAGG + Intergenic
1111177583 13:84617099-84617121 CTTTTGATTTAGTTGGAGGAAGG + Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1112709146 13:102106569-102106591 CTGTCGAAAAAGAGGGAGGGAGG + Intronic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1116181618 14:41543032-41543054 CTGTTGAAGTAGTGGGCCAAAGG + Intergenic
1119755431 14:77114636-77114658 CTGGTGAGAGAGTGGGATGATGG - Exonic
1120399415 14:84009702-84009724 CTATTGAAAAAGTGGAAAGAAGG + Intergenic
1123468625 15:20534065-20534087 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123649489 15:22466997-22467019 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1123728943 15:23129276-23129298 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123747107 15:23326741-23326763 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124053579 15:26221528-26221550 CTGTTGTAATAGTCTGTGGATGG - Intergenic
1124058131 15:26261341-26261363 CTGTTGATATGGTGGGTGGGAGG - Intergenic
1124279376 15:28350057-28350079 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124303322 15:28561551-28561573 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124532221 15:30517991-30518013 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1127543927 15:59971864-59971886 CTATAGAAATAATGGGAGCAGGG + Intergenic
1127821921 15:62665867-62665889 CTTTTAATTTAGTGGGAGGATGG - Intronic
1129030001 15:72611167-72611189 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129038220 15:72663915-72663937 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129211670 15:74073316-74073338 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1129398733 15:75267768-75267790 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129402341 15:75292044-75292066 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1129728792 15:77917591-77917613 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1129839726 15:78736280-78736302 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129976539 15:79826952-79826974 CTGTATATATAGTGGCAGGAAGG - Intergenic
1131371183 15:91883176-91883198 CTGTTAAAAAAGGGGAAGGAGGG - Intronic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1135122373 16:19777582-19777604 ATCTTCAAATAGAGGGAGGAAGG + Intronic
1138072420 16:54006223-54006245 CTGTTGAAATAAGGGGAGAAGGG - Intronic
1138156062 16:54703888-54703910 CCGTTGAAACACTAGGAGGAAGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1142663697 17:1449163-1449185 CTGTTGCGCTAGTGGGTGGAGGG - Intronic
1146508348 17:33424709-33424731 TTGTTGAAAGAGAGGAAGGAAGG - Intronic
1146665391 17:34699167-34699189 ATGTGGATAGAGTGGGAGGAAGG + Intergenic
1147196258 17:38768819-38768841 CTCTTGACCTAGTGGGAGGCAGG + Exonic
1150035652 17:61793768-61793790 CTGCTGAAATAGTGTGTGTAAGG - Intronic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151458365 17:74240044-74240066 GTATTAAAATAGTGGAAGGATGG + Intronic
1155994282 18:32313394-32313416 CAGTTGAAAAAATGGAAGGATGG + Intronic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1157827555 18:50825977-50825999 ATTTTTAAAAAGTGGGAGGAAGG - Intergenic
1158455451 18:57603024-57603046 CTGTTGAATTGATAGGAGGAAGG - Intronic
1159442913 18:68504761-68504783 CTGTTGAGAGAGAGAGAGGAAGG + Intergenic
1160893257 19:1390587-1390609 CTGTTGAAATGGTGGGACTTAGG + Intronic
1162795938 19:13087746-13087768 CTTTTGAAGTTGTGGGAGGGAGG - Intronic
1162865717 19:13545177-13545199 CTGATAGAATAGTGGGATGAGGG - Intronic
1163675639 19:18654071-18654093 CTGATGAAAGGGTGGGTGGATGG - Intronic
1167210869 19:48133383-48133405 CTGTTCTAATTGTGGGAGGAGGG - Intronic
925631057 2:5894036-5894058 CTGCTGAAATAATAGGAGCATGG + Intergenic
926756088 2:16237211-16237233 CTGTTGAAAGAATGGATGGATGG - Intergenic
927202273 2:20585143-20585165 CTCTGGACAGAGTGGGAGGAGGG - Intronic
927432824 2:23041444-23041466 CTGTTGGCAGACTGGGAGGAAGG - Intergenic
927458230 2:23275733-23275755 CTGTTGAAATTGTTGAAGGGAGG + Intergenic
928212090 2:29330780-29330802 CGTTTGGAGTAGTGGGAGGAAGG + Intronic
929736465 2:44555327-44555349 CTGTTGAAAGTGTGGGATAAGGG + Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
933511276 2:83245097-83245119 CTACTGAAAAATTGGGAGGAAGG - Intergenic
933594430 2:84268338-84268360 CTGTTGAGGTAGGGGGAGGGTGG + Intergenic
935286240 2:101566093-101566115 CTGCTGAGATAGCTGGAGGAAGG - Intergenic
939701456 2:145397563-145397585 ATGATGAAATATTAGGAGGATGG + Intergenic
942679679 2:178463998-178464020 ATGAAGAAATATTGGGAGGAAGG + Exonic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
945151042 2:206792289-206792311 CTGTTGAAAATGAGTGAGGATGG + Exonic
945633379 2:212313948-212313970 TTGTTTAAATTGTGGGATGAAGG - Intronic
948667109 2:239543177-239543199 CTGCTGATTTAGTAGGAGGAAGG + Intergenic
1170911862 20:20580175-20580197 CTGTTGAAATAGTCAGGGGAGGG - Intronic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1171416347 20:24983333-24983355 ATGTTGACATAGTTGCAGGAGGG - Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1175361829 20:58418008-58418030 CTGGTGAAATAGTGGGAACATGG + Intronic
1175858397 20:62135074-62135096 GTGTTGTAACAGTGGGTGGAGGG + Exonic
1179572354 21:42285119-42285141 CTGTTAAAATGGGGGGAGGGGGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1183214771 22:36472500-36472522 CTGTTGATAGTGTGGGAGGCTGG + Intronic
1183792446 22:40083744-40083766 CTGTTGAAATAGGGGAAAGAGGG + Intronic
1184175534 22:42786812-42786834 CAGTTCAAATGGTGGGAAGAAGG + Intergenic
1184576758 22:45374839-45374861 CTGTGAAAATAGGGGAAGGAAGG - Intronic
949319947 3:2798071-2798093 GAGTTGAAAGAGTGGGAGGGTGG - Intronic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950882640 3:16335619-16335641 CTGTTGGAGGTGTGGGAGGAGGG + Intronic
951177697 3:19620629-19620651 ATTTTGAAATAGTGTGAGTAGGG + Intergenic
954376283 3:50195666-50195688 TTGATGAAATACTGGGAGGGAGG - Exonic
954733848 3:52688396-52688418 TTGGTGAAAAGGTGGGAGGAGGG - Intronic
956408734 3:68956174-68956196 CCTTTGAAAAAGTGGGTGGATGG - Intergenic
957616078 3:82529113-82529135 CTTGTGCAATAGTGAGAGGAGGG + Intergenic
957867688 3:86045563-86045585 CTGCTGAAACAATGGGAGAAGGG - Intronic
958952124 3:100428055-100428077 CTCTTGAAATACTGGCAGGATGG + Intronic
959153871 3:102642122-102642144 CTGTTCACATAGTGGAAGGTTGG - Intergenic
961774514 3:129274740-129274762 CTGTGGAAAGAGTTGCAGGAAGG + Intronic
962346758 3:134624369-134624391 TTGTTGAAATAATGAGTGGATGG - Intronic
962904580 3:139790168-139790190 CTGATGAATGAATGGGAGGAGGG - Intergenic
963197193 3:142545444-142545466 ATGTTGAAATATAGGGAGAAAGG + Intronic
964945253 3:162214738-162214760 CTGTTAAAATTGTGGGAGTTAGG - Intergenic
965729288 3:171753709-171753731 CTGATGAAATAATGAGAGGACGG - Intronic
966343058 3:178946704-178946726 CTGTTGAGATGGTGGCAGGGAGG + Intergenic
966916802 3:184588838-184588860 ATGTAGAGATAGTGGCAGGAAGG + Intronic
968917345 4:3502342-3502364 CTGTTCACAAAGTGGGAGAAAGG + Intergenic
969229395 4:5819368-5819390 CTCTTGAGATTTTGGGAGGAGGG - Intronic
970938381 4:21601699-21601721 GATTTGAAAGAGTGGGAGGATGG - Intronic
971218070 4:24680487-24680509 CTGCTGAAAAAGAGGGAGAAGGG + Intergenic
971839521 4:31833470-31833492 TAGGTGAAATAGTGTGAGGATGG + Intergenic
972379470 4:38505609-38505631 CTGTTGACATTTTGGGATGATGG - Intergenic
972392412 4:38626300-38626322 CTGGGGAAATAGTGGGAGAGAGG + Intergenic
973730433 4:53817333-53817355 TTGTTGAATAAGTGGAAGGATGG + Intronic
973926167 4:55740078-55740100 CTTTGGATATAGTAGGAGGAGGG + Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977153382 4:93542639-93542661 ATGCTGAAAAAGTGTGAGGAGGG + Intronic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
979657280 4:123209880-123209902 CTGTTGAAGAAGTGGGGTGAAGG - Intronic
981130134 4:141149382-141149404 CTGGGGAAAGAGTGGGAGGGGGG - Intronic
982175926 4:152705505-152705527 CTGTTGAAATAGAGGTAGTGGGG - Intronic
983417044 4:167470795-167470817 CTGTTGAAATAGGGAGATGTAGG - Intergenic
983711718 4:170725443-170725465 TTGTTCAAATAGTTGGAGTAGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
988125883 5:27036113-27036135 CTGTAGAAATATTGTGGGGAAGG + Intronic
990171386 5:53053660-53053682 CTTGGGAAATAGTGGGAAGAGGG - Intronic
990209266 5:53464789-53464811 CTGGTGAAATGGTTGGGGGAGGG - Intergenic
990889026 5:60628903-60628925 CTGCTGAAATGGTGGGAGAAAGG + Intronic
992675579 5:79102537-79102559 CTGGGGACATAGTGAGAGGAGGG + Intronic
993821533 5:92623462-92623484 CTGTTGAAATAATTTGAAGAAGG + Intergenic
994413795 5:99442521-99442543 CAGTAGTAATATTGGGAGGATGG - Intergenic
995513716 5:112933790-112933812 CTGGTGAAATACTGGGAGACTGG - Intergenic
995759901 5:115552017-115552039 CTATTCAAATAGGGGGAAGAGGG - Intergenic
996280993 5:121728884-121728906 ATCTTGAAAGAGGGGGAGGATGG - Intergenic
996331539 5:122335043-122335065 TAGTTGAAAGGGTGGGAGGAAGG + Intronic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
998535057 5:142922529-142922551 GTGATGAAAGGGTGGGAGGAAGG - Intronic
1001975194 5:175993135-175993157 CTGTTGGAATTGTTGGAGGATGG - Intronic
1002242237 5:177850635-177850657 CTGTTGGAATTGTTGGAGGATGG + Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1007068724 6:39019085-39019107 CTGTTCAAATACTGGTGGGAAGG + Intronic
1007211349 6:40195530-40195552 CATTTGATGTAGTGGGAGGATGG - Intergenic
1008342758 6:50387682-50387704 CTGTAGACATGGTGAGAGGAGGG - Intergenic
1008580801 6:52904800-52904822 CTGCTCAAACACTGGGAGGATGG + Intronic
1009827621 6:68887248-68887270 TTGTTGAAAGAGTGAGGGGATGG - Intronic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1011575504 6:88793562-88793584 CTATTGAAATGATGGTAGGATGG + Intronic
1013328233 6:109069727-109069749 TTGTTGAGATGGTGGGAGGGGGG + Intronic
1014016990 6:116543517-116543539 TTGTTGCAATAATAGGAGGAAGG - Intronic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1015344800 6:132143779-132143801 CTTTTGAAAAAATGGGTGGATGG - Intergenic
1017689257 6:156946685-156946707 TTGTTGGAATAGAGGGAGGGAGG + Intronic
1017702612 6:157090218-157090240 GTGTTTAAATATTGAGAGGAGGG + Intronic
1019622452 7:1999255-1999277 CTGTAGAAATACTGGGGGGTGGG - Intronic
1021555314 7:21912864-21912886 CTTTTGAAATAGTGCAAAGATGG + Intronic
1021968844 7:25948743-25948765 CTGATGGAAAAGTGGGAGAATGG + Intergenic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022833430 7:34091020-34091042 CTGTTGAGGTACTGGGAGGTAGG + Intronic
1023298423 7:38740897-38740919 GTGTTCAAAAAGTGGGATGATGG - Intronic
1023349497 7:39306505-39306527 GTGATGTAATAGTGGTAGGATGG - Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1027384926 7:77650126-77650148 TTGTTGAATTAGTGGGGGAAGGG + Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028933111 7:96436387-96436409 CATTTGAAATTGTGGGAGGCAGG - Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029952120 7:104597552-104597574 CTATTGACATGGTGGGGGGAGGG + Intronic
1032062632 7:128737720-128737742 TTGTAGAGATAGGGGGAGGAAGG + Intergenic
1032999126 7:137483593-137483615 CTGTTGTAAGGGTGGGAAGAAGG - Intronic
1034111811 7:148544481-148544503 CTGGAGAAATAAGGGGAGGAAGG + Intergenic
1041809225 8:61888876-61888898 CTGTTCTAATAATGGGAGGCTGG - Intergenic
1042275049 8:66995989-66996011 CTACTGACATAGTGGGAGAAGGG - Intronic
1042460200 8:69056686-69056708 ATGTTGAAATAGTGAGATTATGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1045901090 8:107280789-107280811 CTGTTGAAATATATGAAGGAGGG + Intronic
1046160965 8:110364069-110364091 TTGTTGAAATATTAGGAAGAAGG + Intergenic
1046458046 8:114494404-114494426 TTGATGAAAAAGTTGGAGGATGG - Intergenic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048836635 8:138524969-138524991 ATGTTGAATGAATGGGAGGAAGG - Intergenic
1049457746 8:142702206-142702228 CAGATGAAATACTGGGAGGTAGG + Intronic
1051598281 9:18847107-18847129 CTGTTCAAAAACTGGGAGAAAGG - Intronic
1052482967 9:29055710-29055732 CTGGTGAAAGGGTGGGAGGGAGG - Intergenic
1052494544 9:29211600-29211622 CTGCTGAAATACTTGGAGGGAGG - Intergenic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1055289690 9:74769750-74769772 CCGTTGAAATAAAGGAAGGAAGG + Intronic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1060550290 9:124481734-124481756 CTGTTCACCTAGTGGGTGGAGGG + Exonic
1061062907 9:128259571-128259593 CGGTTTAAATGGTGGGAAGAAGG - Intronic
1061561510 9:131407216-131407238 CTGTTGACATGGTTGGAGGGTGG + Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1186344425 X:8677146-8677168 CTGTTGACATATTGGGCCGATGG + Intronic
1186788701 X:12976038-12976060 GTTTTGAAATATGGGGAGGAGGG + Exonic
1188172433 X:26943900-26943922 CTGTTGAAGTAGTGGAAAGTAGG + Intergenic
1188782733 X:34305714-34305736 CTGATGAGATAATGGAAGGAGGG + Intergenic
1190427553 X:50346965-50346987 TTTATGAAATAGTGGGAGGTGGG + Intronic
1191099598 X:56711461-56711483 CAGGTGAAAGAGTGGGAGCAGGG + Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1192436192 X:71145181-71145203 CTGTGGAAATAGAGGGACCATGG - Intronic
1192442523 X:71185230-71185252 CTGTTGAAAGAGTAGATGGAAGG - Intergenic
1193431050 X:81406412-81406434 TTCTTAAAATAGTGGGAGGTAGG + Intergenic
1196554887 X:117074690-117074712 CTTTTGAAATAATGCAAGGAGGG - Intergenic
1198161882 X:134016176-134016198 CTGATGAAAAAGGGGGAGAAAGG + Intergenic
1198446927 X:136726638-136726660 CAGTAGAAAATGTGGGAGGAAGG - Intronic
1200868279 Y:8068776-8068798 CTGTTGAAATAATTGGAGTCAGG + Intergenic
1201281846 Y:12349411-12349433 GGCTTGGAATAGTGGGAGGAGGG - Intergenic
1201860504 Y:18592414-18592436 ATGTTGAAATATTGGGGGCAGGG + Intergenic
1201872819 Y:18727967-18727989 ATGTTGAAATATTGGGGGCAGGG - Intergenic
1202604863 Y:26630264-26630286 CTGATGAAATAGTTTGAAGATGG + Intergenic