ID: 1091696330

View in Genome Browser
Species Human (GRCh38)
Location 12:2630561-2630583
Sequence TGGACCATGAAGACAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 143}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091696330_1091696344 25 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696344 12:2630609-2630631 ACCAAAGGCAGGACGGTGGGAGG 0: 1
1: 0
2: 3
3: 22
4: 336
1091696330_1091696343 22 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696343 12:2630606-2630628 GGCACCAAAGGCAGGACGGTGGG 0: 1
1: 0
2: 2
3: 7
4: 108
1091696330_1091696337 0 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696337 12:2630584-2630606 GCTGGAGGACTGAGGGGCTCTGG 0: 1
1: 0
2: 4
3: 60
4: 492
1091696330_1091696333 -8 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696333 12:2630576-2630598 ATGGTCCAGCTGGAGGACTGAGG 0: 1
1: 0
2: 1
3: 109
4: 309
1091696330_1091696339 10 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696339 12:2630594-2630616 TGAGGGGCTCTGGGCACCAAAGG 0: 1
1: 0
2: 4
3: 25
4: 266
1091696330_1091696338 1 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696338 12:2630585-2630607 CTGGAGGACTGAGGGGCTCTGGG 0: 1
1: 0
2: 3
3: 32
4: 361
1091696330_1091696341 18 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696341 12:2630602-2630624 TCTGGGCACCAAAGGCAGGACGG 0: 1
1: 0
2: 0
3: 21
4: 342
1091696330_1091696347 30 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696347 12:2630614-2630636 AGGCAGGACGGTGGGAGGATGGG 0: 1
1: 0
2: 2
3: 44
4: 657
1091696330_1091696335 -6 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696335 12:2630578-2630600 GGTCCAGCTGGAGGACTGAGGGG 0: 1
1: 1
2: 1
3: 29
4: 324
1091696330_1091696342 21 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696342 12:2630605-2630627 GGGCACCAAAGGCAGGACGGTGG 0: 1
1: 0
2: 1
3: 16
4: 183
1091696330_1091696346 29 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696346 12:2630613-2630635 AAGGCAGGACGGTGGGAGGATGG 0: 1
1: 0
2: 23
3: 413
4: 4606
1091696330_1091696334 -7 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696334 12:2630577-2630599 TGGTCCAGCTGGAGGACTGAGGG 0: 1
1: 0
2: 0
3: 110
4: 241
1091696330_1091696340 14 Left 1091696330 12:2630561-2630583 CCTGAAATTGTCTTCATGGTCCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1091696340 12:2630598-2630620 GGGCTCTGGGCACCAAAGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091696330 Original CRISPR TGGACCATGAAGACAATTTC AGG (reversed) Intronic
902953462 1:19906826-19906848 TGTACACTGAGGACAATTTCAGG - Intronic
903443488 1:23405757-23405779 AAGACCATGAAGACAAAGTCAGG + Intronic
904862701 1:33550718-33550740 TGGCCAATGAAGACAATCTGAGG - Intronic
907075461 1:51574159-51574181 TGGACAATGAAAGGAATTTCAGG - Intergenic
908339298 1:63160214-63160236 TGGGCCATGAAATCAATTTGGGG - Intergenic
909786423 1:79619824-79619846 TGGAATAAGAAGACAATTCCAGG + Intergenic
912168031 1:107063036-107063058 TGAGACATGAAGACAATTTGTGG + Intergenic
913989159 1:143594146-143594168 TTAATCATGAAGACATTTTCAGG + Intergenic
914734806 1:150405533-150405555 TGGAACATGAAGCCGATTTAGGG + Intronic
915510127 1:156382353-156382375 AGGACCAGGAAGGCAGTTTCTGG - Intronic
916501150 1:165388293-165388315 TGGAGCAAGAGGACAATTTTTGG - Intergenic
916575070 1:166059865-166059887 GGGCCCAGGAAGACAAATTCTGG + Intronic
917219037 1:172707674-172707696 TGGAAAATGAAGACAATCTGAGG - Intergenic
918299912 1:183193817-183193839 TGGACCATGAAGACTACATCAGG - Intronic
919180644 1:194076781-194076803 GGGACCGTGAAGACAATTGTTGG - Intergenic
920724536 1:208421685-208421707 TGGACCATGAAGAGGGTTTGAGG - Intergenic
921533259 1:216311509-216311531 TGGACTATCGTGACAATTTCTGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063729042 10:8675099-8675121 AGGACCATAAAGACATTTTTAGG + Intergenic
1064898845 10:20271357-20271379 TGTACCATGAAGGCAATTGATGG + Intronic
1069244831 10:66191312-66191334 AGGACCATGGAGACATTTTAAGG - Intronic
1070448409 10:76531905-76531927 TGGCCCATGAAGATAACTCCAGG - Intronic
1071061421 10:81574532-81574554 TGGACCACGAAGACATATCCAGG + Intergenic
1072846265 10:98834175-98834197 AGGACTCAGAAGACAATTTCAGG + Intronic
1073746951 10:106480030-106480052 TGGAAAATGAAGCCAATTTTTGG - Intergenic
1075465293 10:122646505-122646527 TGCCCCATGAAGCCAATCTCAGG + Intergenic
1077453909 11:2666626-2666648 TGGTCCATGAAGCCAAATTTGGG - Intronic
1077980554 11:7295564-7295586 TGGACCATTAAGAGCAATTCTGG - Intronic
1078596558 11:12692409-12692431 TGGAGAATGATGATAATTTCAGG - Intronic
1078902872 11:15657822-15657844 TGGACCATGGAGCAAATTTGTGG + Intergenic
1078991827 11:16655463-16655485 TGGAGCCTGAAGACATTTACAGG + Intronic
1079171642 11:18102026-18102048 AGGACCATAAAGAAACTTTCAGG + Intronic
1080536631 11:33228145-33228167 AGGTCCATGAAGCCATTTTCTGG + Intergenic
1081196168 11:40163440-40163462 TAGACTATGAAGACATTTGCTGG + Intronic
1084782584 11:71420202-71420224 TGGACCCTGAACTGAATTTCGGG + Intergenic
1085091438 11:73718387-73718409 TGGACCCAAAAGAAAATTTCTGG + Intronic
1087567436 11:99879233-99879255 TGGCCAGTGAAGATAATTTCTGG + Intronic
1090888238 11:130898319-130898341 TGGAACATGAGGACATTTTAAGG + Intronic
1090978729 11:131697859-131697881 TGGACTATGAGAACAACTTCAGG + Intronic
1091528402 12:1329771-1329793 TGGACCATGAAGAAATATTGAGG + Intronic
1091696330 12:2630561-2630583 TGGACCATGAAGACAATTTCAGG - Intronic
1093375381 12:18420246-18420268 TGGAGCAAGATGACAATTTGAGG + Intronic
1096240856 12:49959626-49959648 TGGACTATGAAGACAGTGCCTGG + Intergenic
1096714471 12:53482873-53482895 GGGACGATGAAGACATTTTGCGG + Exonic
1101096687 12:101349207-101349229 TGGCCCTTGTAGACAGTTTCTGG + Intronic
1105500688 13:20969001-20969023 GGGGACATGAAGACATTTTCAGG + Intergenic
1105743318 13:23351752-23351774 GTGACCATCAAGACAATTTCTGG + Intronic
1106898464 13:34330552-34330574 TGGATCAGGAACACAATTTGGGG - Intergenic
1114701909 14:24687206-24687228 TGGACCTTAAAAACATTTTCGGG - Intergenic
1115476452 14:33818986-33819008 TGGACAATGAAGACAATATTTGG + Intergenic
1116479541 14:45382096-45382118 GTGACCATGAAGACTACTTCAGG + Intergenic
1117738673 14:58793139-58793161 TGGAGCCTAAAGATAATTTCTGG + Intergenic
1119184966 14:72633883-72633905 TGAGCTATGAAGACATTTTCTGG + Intronic
1119834306 14:77734073-77734095 TGGATAAAGAAGACCATTTCAGG - Intronic
1202877470 14_KI270722v1_random:18644-18666 TTGATCCTGAACACAATTTCAGG - Intergenic
1126946918 15:53831771-53831793 TGGACCATGGAGGCAAATACAGG - Intergenic
1128397063 15:67238372-67238394 TGGAGCATTAAGACAATTTCAGG + Intronic
1128655456 15:69458133-69458155 TGGACCAAGAGTATAATTTCAGG - Intergenic
1131834349 15:96375272-96375294 TGGATTAAGAAGACAATATCTGG + Intergenic
1138309334 16:56009835-56009857 TGGGCCATGAAGACGCTTTTAGG + Intergenic
1140801057 16:78488702-78488724 TGGCCCATAAAGAAAATTCCAGG - Intronic
1142405886 16:89889495-89889517 TGGACCATGGAGAGTATTGCTGG + Intronic
1149181810 17:53948268-53948290 TGGAACATGAGGAAAAGTTCTGG - Intergenic
1155387923 18:25301241-25301263 CGGACCATGCAGATAATATCTGG + Intronic
1156291511 18:35752138-35752160 TGGCCCAGGAAGACCATTTCTGG + Intergenic
1162718681 19:12649059-12649081 TGGACCTTGAAGGCTGTTTCTGG - Intronic
1166604562 19:44129311-44129333 TGGAACATGAAAATAATTTGGGG - Intronic
925448955 2:3952011-3952033 AGGAACATGAAGACAAATTAGGG + Intergenic
929230387 2:39554200-39554222 TGGGCCAGGAAGCCAATTTGAGG + Intergenic
930818413 2:55621649-55621671 TGGACGCTGAAGAAAAATTCGGG + Intergenic
931587994 2:63849164-63849186 TGGTCCATGAAGACAATTAATGG - Intronic
931854798 2:66291880-66291902 TGAACCTTGAAGTGAATTTCCGG - Intergenic
932765891 2:74469607-74469629 TGGACCATGCAATCAATTTAGGG - Intergenic
933498524 2:83082505-83082527 AGGACGATGAAATCAATTTCTGG + Intergenic
936103699 2:109605840-109605862 TGGATCATTGAGAGAATTTCTGG - Intronic
941751727 2:169141748-169141770 TGGAACAAAATGACAATTTCAGG - Intronic
941819416 2:169828961-169828983 TGGAACATGATGTCAATGTCAGG + Intronic
943448313 2:188017749-188017771 TGGACCATCCAGTCAATTTCTGG - Intergenic
944433155 2:199658634-199658656 AGGAACATGAAGAAACTTTCTGG + Intergenic
945208210 2:207354972-207354994 TGAGCCATGAAAACAACTTCAGG - Intergenic
946435538 2:219649841-219649863 TGGACATTGAAGAGAATTTAAGG + Intergenic
946550596 2:220797598-220797620 TGGAACAGAAAGACAATTTGTGG - Intergenic
1174167670 20:48596773-48596795 TGTTCCCTGAAGACACTTTCTGG + Intergenic
1177558783 21:22723933-22723955 GGGAGAATGAAGAAAATTTCTGG - Intergenic
1177663440 21:24119379-24119401 TAGACCATGAAAAGAATTTTGGG + Intergenic
1183300878 22:37058606-37058628 GGGACCCTGAAGAGAATCTCAGG - Intronic
1183340657 22:37279096-37279118 TGGACCATGAAGAGAATTTGAGG + Intergenic
950057178 3:10034732-10034754 TTGAGGATGAAGACAGTTTCAGG + Exonic
952053518 3:29415485-29415507 TAGACAGTGAAGAGAATTTCAGG + Intronic
955733212 3:62009436-62009458 TGGATATTGAAGACAATTGCAGG - Intronic
956293482 3:67686797-67686819 TGTACCCTGAACCCAATTTCTGG + Intergenic
957879668 3:86195526-86195548 TGGTCCATGAAGACACATCCAGG + Intergenic
965515558 3:169617834-169617856 AGAACCATGAAGAGAGTTTCAGG + Intronic
966071112 3:175879291-175879313 GGGAGAATAAAGACAATTTCAGG + Intergenic
973784224 4:54320350-54320372 TGGACCATGAAGTAAACTTGAGG - Intergenic
973793070 4:54395730-54395752 TGGAGGATGAAGACCATTTGGGG - Intergenic
976447664 4:85150478-85150500 TGGAACATGTATACACTTTCAGG + Intergenic
978486246 4:109257204-109257226 TGCAGCATGAAGACAAGTTGTGG - Intronic
982210854 4:153034619-153034641 AATACCAAGAAGACAATTTCTGG - Intergenic
983093014 4:163528283-163528305 GGGATAATGCAGACAATTTCAGG + Exonic
986006995 5:3676861-3676883 TGGACCAGGAAGTCATTCTCAGG - Intergenic
986666208 5:10107209-10107231 TGCAGCATGAAGATAATTCCAGG + Intergenic
987139842 5:14933873-14933895 GGTACCATGAAGCCACTTTCTGG - Intergenic
988223142 5:28375422-28375444 TGGAGCATTAAGAGAATTTCTGG - Intergenic
990586535 5:57216899-57216921 TGGCTCATGACTACAATTTCAGG + Intronic
991246956 5:64518850-64518872 TGGAACATAGATACAATTTCTGG - Intronic
992166858 5:74061025-74061047 TGGAAAATGAGGACCATTTCTGG + Intergenic
992501446 5:77348000-77348022 AGATCCATGAAGACAATATCAGG + Intronic
995116408 5:108485269-108485291 TGGGCCATGAAATCAATTGCTGG + Intergenic
996157569 5:120120650-120120672 TGAAACATGAAGAAAATTTGAGG + Intergenic
996209901 5:120795648-120795670 TGGAACATGCATACAATGTCTGG - Intergenic
1001242421 5:170080645-170080667 TGGACCTGGAAGACTCTTTCTGG + Intronic
1001385827 5:171337755-171337777 AGGAGCAGGAAGACAATTTGTGG + Intergenic
1001810085 5:174620862-174620884 TGGACTTTGAAGAGAACTTCAGG + Intergenic
1003395721 6:5750429-5750451 TGGACAATGGAGATATTTTCAGG + Intronic
1004923828 6:20401319-20401341 TGGACCATGCGGACGATGTCTGG - Intergenic
1010992547 6:82496074-82496096 TGAAACTTGAAGACAATTTCAGG + Intergenic
1012874212 6:104707040-104707062 TTTACCATGAAGAAAATCTCAGG + Intergenic
1013267377 6:108513074-108513096 TGAATCCTGAAGACAAATTCAGG + Intronic
1013873096 6:114792081-114792103 TGAATCATGAAGACAGTATCTGG + Intergenic
1016267008 6:142244449-142244471 TGCAGCATGAAGACAAATACAGG + Intergenic
1020815576 7:12901432-12901454 TGGTACATTCAGACAATTTCGGG + Intergenic
1022345585 7:29511092-29511114 TGGTCAATGTAGACAATTTTCGG - Intronic
1023125521 7:36950793-36950815 TGGCCCATGAAGACAAGCTGAGG + Intronic
1024307672 7:47941929-47941951 GGGACAATTAAGCCAATTTCAGG - Intronic
1025170067 7:56748509-56748531 TAAACCATTAAGAGAATTTCTGG - Intergenic
1025701818 7:63827209-63827231 TAAACCATTAAGAGAATTTCTGG + Intergenic
1026128450 7:67600084-67600106 TGGAACATGAAGTCACTTTGGGG + Intergenic
1026898870 7:74026552-74026574 TGGACCTAGAAGTAAATTTCTGG - Intergenic
1028854595 7:95576553-95576575 TGGAGCATGAAGACAATCCAGGG + Intergenic
1029821556 7:103151758-103151780 TCTACCATGGAGACAAGTTCTGG + Intergenic
1030393063 7:108951071-108951093 CTGACCATGAAGTCAATTTAAGG - Intergenic
1033579707 7:142720953-142720975 TGGACCATGAAAATATGTTCTGG + Intergenic
1033832005 7:145266250-145266272 TGGAACATTAAGAGCATTTCTGG + Intergenic
1033837458 7:145332602-145332624 AGGTCCATGTAGACAATTTGAGG - Intergenic
1036144992 8:6246528-6246550 TGGACCATGAGCACAAGTTCTGG + Intergenic
1037558006 8:20044519-20044541 TGCACAATGAAGACTATTTGTGG - Intergenic
1038070993 8:24013323-24013345 TTGAACAGGATGACAATTTCAGG + Intergenic
1040062931 8:43119878-43119900 AGGACCATGAAGATCTTTTCTGG - Intronic
1040927276 8:52697911-52697933 TGTACCATGAAATCAATTTTAGG + Intronic
1042610013 8:70588237-70588259 TGGATCATGAAATCAATTTAGGG + Intronic
1043342237 8:79254321-79254343 TGGACCATCGAGATAAATTCAGG + Intergenic
1043928443 8:86064146-86064168 TGGACAATGAAGACACTCTGTGG - Exonic
1046518072 8:115289007-115289029 TGGGCCATAAAGACATTATCTGG - Intergenic
1046541356 8:115587422-115587444 TAGACCCTGAAGTCAATTTTGGG + Exonic
1047279542 8:123433188-123433210 TGTGCCATGAAGGCAATTTTGGG + Intronic
1050498030 9:6264862-6264884 TGGACCATGAAAACACATACAGG - Intergenic
1051399526 9:16664508-16664530 GGGACACTGAAGAGAATTTCTGG + Intronic
1052728216 9:32255785-32255807 AGGAGCATGAAGAAAATTTTGGG + Intergenic
1056308402 9:85314885-85314907 TGGGCAAGGCAGACAATTTCAGG + Intergenic
1061528346 9:131187860-131187882 TGGCCTATGAAGACAGTATCAGG - Intronic
1186161822 X:6784928-6784950 AGGAACATGAAGACAAATTCAGG + Intergenic
1186381237 X:9062148-9062170 TGGATCATGCTGACATTTTCAGG - Intronic
1189645622 X:43126701-43126723 TTAACCAGGAATACAATTTCAGG - Intergenic
1191790588 X:64968281-64968303 TTGCCCAAGAAGACAAATTCAGG + Intronic
1201049821 Y:9921454-9921476 TGGACCAGGGAGAGACTTTCAGG + Intergenic