ID: 1091697292

View in Genome Browser
Species Human (GRCh38)
Location 12:2636451-2636473
Sequence AGGAGCTGCTGGACGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091697292_1091697297 -7 Left 1091697292 12:2636451-2636473 CCTGAACCCGTCCAGCAGCTCCT 0: 1
1: 0
2: 1
3: 7
4: 191
Right 1091697297 12:2636467-2636489 AGCTCCTGACATTGGAATAGTGG 0: 1
1: 0
2: 0
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091697292 Original CRISPR AGGAGCTGCTGGACGGGTTC AGG (reversed) Intronic
900146417 1:1160771-1160793 AGGAGCGGCTGCACAGGCTCTGG + Intergenic
901192146 1:7418976-7418998 AGGAGCTGCTGCAGGGTTTCTGG - Intronic
901674169 1:10873241-10873263 AGGGGCCCCTGGACGGGGTCTGG + Intergenic
902378919 1:16043581-16043603 GGGTGCTGCTGGACGGGGGCTGG - Intergenic
902639858 1:17760222-17760244 AGGAGCTGCTGGAAGTTTTGTGG + Intronic
903790462 1:25889536-25889558 AGGAGCTGTTGGACTGGATGTGG - Intronic
903891468 1:26573106-26573128 AGGGGCTGCCGCAAGGGTTCAGG + Intronic
905211057 1:36374440-36374462 AGGAGCAGCCGGTCTGGTTCAGG - Intronic
905563724 1:38946925-38946947 AAGAGCTGCTGGAGGGGTGGGGG - Intergenic
907333281 1:53685048-53685070 AGGAGATGCTGGCAGAGTTCTGG + Intronic
910599131 1:89011828-89011850 AGGAGCTGCTGGACCTGCACAGG - Exonic
910603500 1:89056935-89056957 AGGAGCTGCTGGACCTGCACAGG - Exonic
910608514 1:89114097-89114119 AGGAGCTGCTGGACCTGCACAGG - Exonic
910621905 1:89264767-89264789 AGGAGCTGCTGGACCTGCACAGG - Exonic
910637218 1:89422181-89422203 AGGAGCTGCTGGACCTGCACAGG + Intergenic
917834673 1:178931953-178931975 AGCCGCTGCTGGTGGGGTTCGGG - Intergenic
918302467 1:183216607-183216629 AGGAGGCGCTGCACGGCTTCGGG - Intronic
918703591 1:187635548-187635570 AGGCGCTGCTGGCCAGGCTCAGG - Intergenic
919875500 1:201863510-201863532 AGGAACTGCTGGATCAGTTCAGG - Exonic
920349623 1:205329265-205329287 AGGAGCAGCTGGACGCATTCAGG + Intergenic
920349933 1:205331270-205331292 AGGAGCAGCTGGACGTATTCAGG + Intergenic
922567410 1:226610000-226610022 AGGAGCTGCAGGCTGGGGTCCGG + Intergenic
922934151 1:229410915-229410937 AGCAGCTGCAGGAGGGGCTCAGG - Intergenic
923033078 1:230265174-230265196 AGGGGCTGGTGGACGGGAGCTGG + Intronic
923144405 1:231187789-231187811 AGGAGCTGCTGTAGTGCTTCTGG + Intronic
923692725 1:236211653-236211675 AGGAGCTGCTGAAAAGGATCAGG + Intronic
924821159 1:247491905-247491927 AGTAGCTGTTGGCCGGCTTCAGG - Intergenic
1063455286 10:6178550-6178572 CGGAGCTGCTGGAGAGCTTCCGG + Intronic
1064418932 10:15173520-15173542 AGGAGCTGCTGGGCTAGTGCTGG - Intergenic
1065322000 10:24519010-24519032 GGCAGCTGCGGGAGGGGTTCAGG - Intronic
1066435491 10:35393553-35393575 ACGAGCTGCAGGAGGGCTTCAGG - Intronic
1069438509 10:68407225-68407247 AGGAGCTGCTGGACAGGCCGAGG - Intronic
1071293619 10:84204046-84204068 TGGTGCTGCTGGAAGGGTTTGGG - Intronic
1072107949 10:92291514-92291536 AGCAGATGCTGGACAGGTACGGG + Exonic
1073190902 10:101650097-101650119 AGGAGCTTGGGGATGGGTTCTGG - Intronic
1073421131 10:103424600-103424622 GGGAGCTGCAGGACAGATTCAGG + Intronic
1075918686 10:126191490-126191512 AGGAGGAGCTGGATGGATTCAGG + Intronic
1076714274 10:132355440-132355462 AGGCGCTGCACGACGGGTTGGGG - Intronic
1076719289 10:132386248-132386270 AGGTGCTGCTGGATGGGCCCTGG + Intergenic
1076894263 10:133302163-133302185 AGGAGCTGCTGGGGGGAGTCAGG + Intronic
1076907961 10:133372831-133372853 AGGGGCTGCGGGTCGGGGTCAGG + Intronic
1077052920 11:575879-575901 AGGAGCTGCGGGCGGGGTTGCGG + Intergenic
1077155299 11:1088416-1088438 AGGAGCGGCGGTGCGGGTTCAGG - Intergenic
1083923492 11:65792690-65792712 AGTGCCTGCAGGACGGGTTCTGG + Intronic
1084670409 11:70603449-70603471 ACCAGCTGCTGGACAGGGTCAGG - Intronic
1088604542 11:111515150-111515172 AAGGGTTGCTGGAAGGGTTCAGG - Intronic
1089352165 11:117828017-117828039 AGGAGCTGCTGGTTGTGTCCAGG + Intronic
1089459099 11:118642300-118642322 AGGAGCTGATGGCCGGGCTGGGG + Exonic
1091325473 11:134683800-134683822 AGGAGCTGCCAGACAGGTGCTGG + Intergenic
1091697292 12:2636451-2636473 AGGAGCTGCTGGACGGGTTCAGG - Intronic
1092240447 12:6832891-6832913 ACTAGCTGCAGGCCGGGTTCCGG - Intronic
1094833364 12:34310943-34310965 AGCAGCTCCTGCACGGGTCCCGG + Intergenic
1096331697 12:50718764-50718786 ACAAGCTGCTGGAAGGGATCTGG + Exonic
1103194002 12:119026256-119026278 TGGAGCTGCTGGAGAGGTTCAGG + Intronic
1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG + Exonic
1110656595 13:78007400-78007422 AGCAGCTCCTGGACGGGAGCTGG - Intergenic
1112341607 13:98557255-98557277 TGGAGCTGGTGGAAGAGTTCAGG - Intronic
1112431461 13:99354269-99354291 AGGAGCTCCTGGACAGATGCTGG - Intronic
1118347437 14:64950386-64950408 AGGATCTTCTGGACGCCTTCTGG + Exonic
1119009227 14:70966524-70966546 AGAATCTGCTGGAGGGCTTCAGG - Intronic
1120461526 14:84803568-84803590 CTGAGCTGCTGGATGGGCTCGGG - Intergenic
1120888364 14:89469681-89469703 AGGAGCTGATGGACTAGCTCTGG + Intronic
1122414567 14:101542755-101542777 AGGAGCTGCTGGCCAGGCCCTGG - Intergenic
1122457774 14:101867963-101867985 AGGATCTGTTGGCCGGGTCCTGG + Intronic
1123143710 14:106108191-106108213 AGGATCTCCTGTAAGGGTTCTGG - Intergenic
1125747493 15:42006880-42006902 TGGAGCTGCTGGGTTGGTTCTGG - Intronic
1127853864 15:62938880-62938902 AGGACCTGATGGAAGGGTTGGGG - Intergenic
1132640201 16:974699-974721 AGCAGCTGCGGGCCGGCTTCAGG + Intronic
1132771473 16:1565915-1565937 TGGAACTTCTGGAAGGGTTCTGG - Intronic
1136510854 16:30737551-30737573 ATGAGCTGGTGGAGGGGTACAGG - Exonic
1136616592 16:31402051-31402073 AGGAGCTGCAGGAGGGGGTTGGG + Intronic
1137273729 16:46919695-46919717 AGGAGCTGTTGGAGGGGGTGTGG + Intronic
1139796125 16:69484435-69484457 AAGAGCTGCTGCAAAGGTTCTGG + Intergenic
1140497326 16:75400528-75400550 AGGTGCTGCTGAAGGGGATCTGG - Intronic
1141449960 16:84092560-84092582 AGAACCTGCTGGACGGGGACAGG + Intronic
1142140413 16:88470264-88470286 CAGGGCTGCTGGACGGGTTGGGG + Intronic
1143514709 17:7413935-7413957 TGGAGCTGCTGGGAGGGTCCTGG - Intronic
1146400229 17:32495625-32495647 AGGAGCTGGAGGAAGGGCTCGGG - Intronic
1146840160 17:36146480-36146502 AGGAGATGATGGAGGGGTTGTGG - Intergenic
1148486921 17:47996536-47996558 AGAAGCTGCAGGACAGGTTTGGG + Intergenic
1148837714 17:50474692-50474714 AAGAGCTCCTGGATGGGTCCGGG + Exonic
1148838359 17:50478625-50478647 AAGAGCTCCTGGATGGGTCCGGG + Intergenic
1150216933 17:63476481-63476503 GGGAGGTGCTGGAGGGGCTCAGG - Intergenic
1151474533 17:74338224-74338246 GGGAGCAGCTGGCTGGGTTCTGG + Intronic
1152594068 17:81229657-81229679 AGCAGCTGCTGGGCTGGTGCTGG + Intronic
1153105743 18:1523942-1523964 AGGTGCTGCTGGTCGGTATCAGG - Intergenic
1153179818 18:2420519-2420541 AGCAGCTCCTGGTGGGGTTCAGG + Intergenic
1155152933 18:23136343-23136365 TGCAGCTGCTCGACGGGTCCGGG + Exonic
1158492093 18:57919357-57919379 AGGAGTTGCTGTACAGGTTCAGG - Intergenic
1161290765 19:3492341-3492363 AGGCGCTGCTGGATGAGTCCCGG - Exonic
1161514583 19:4689519-4689541 GGGAGCTGTTGGACGGGCACAGG + Intronic
1162088318 19:8261774-8261796 TGCAGCTGCTGCACGTGTTCTGG + Exonic
1162571880 19:11479145-11479167 AGGAGATGCTGGACTGTTGCGGG + Intronic
1162901816 19:13799744-13799766 ATGCGCTTCTGGACGGGCTCAGG - Exonic
1163591148 19:18194819-18194841 AGGAGCTGCGGGAGAAGTTCTGG + Exonic
1165232350 19:34395041-34395063 AAGAGCTGCTGGACAGGGACTGG - Intronic
1165329904 19:35135537-35135559 GGGAGCAGCTGGACGTGATCTGG - Intronic
1165732819 19:38157470-38157492 TGGAGCTTATGGAGGGGTTCTGG - Intronic
1167041051 19:47022577-47022599 CAGGGCTGCTGGAGGGGTTCGGG + Intronic
1167306683 19:48713869-48713891 AGGAGCTGCAGGAAGCGATCCGG - Exonic
1167332929 19:48867572-48867594 AGGCGCTGCTGGCCAGGCTCAGG + Exonic
1167715147 19:51138217-51138239 GGGAGCTGCTGGACGGGTGCTGG + Intergenic
1168648968 19:58080683-58080705 AGGGGCAGCTGGGCTGGTTCAGG - Intronic
925669688 2:6297633-6297655 AGGGGCTGCTGGGCTGGGTCAGG + Intergenic
928381718 2:30823850-30823872 AGGAGGGGCTTGACGGGTCCTGG + Intergenic
929483699 2:42336723-42336745 AGGAGCTGCTGTAAGGCATCTGG - Intronic
930603383 2:53467535-53467557 AGGAGATGTTGGACTGGTGCTGG + Intergenic
931262691 2:60633954-60633976 AGAAGATGCAGGACGGGGTCCGG + Intergenic
932030047 2:68174040-68174062 AAGAGCTGCTGAACAGCTTCAGG + Intronic
932768895 2:74489601-74489623 AGGAGCTGCTGTACTTGTTTAGG + Intronic
935124156 2:100208227-100208249 AAGGGCTTCTGGACGTGTTCAGG + Intergenic
936572122 2:113626150-113626172 AGGGGCTCCTGGGAGGGTTCGGG - Intergenic
937906347 2:127054707-127054729 AGGGGCTGCTGGGAGGGGTCAGG - Intronic
947595975 2:231412142-231412164 AGGAGCTGCTGGGTGGGCGCGGG + Intergenic
948013563 2:234669856-234669878 AGGAGGTGCTGGCCTGATTCCGG + Intergenic
948124699 2:235556170-235556192 AGGAGCTGCTGCAGGTGTGCAGG - Intronic
948807948 2:240461005-240461027 AGGAGCAGCTGAATGGGTTCTGG + Intronic
948808292 2:240462344-240462366 AGGAGACGCTGGCCGAGTTCTGG + Exonic
1171970484 20:31562003-31562025 ATGAGATGCTGAAAGGGTTCTGG - Intronic
1172110879 20:32544270-32544292 AGGAGCTGCTGGAAGGATGATGG + Intronic
1175768610 20:61608429-61608451 AGGTGCTGCTGGACACGTGCTGG - Intronic
1175796833 20:61776535-61776557 AGGGGCTGCTGGACGAGTCAGGG - Intronic
1176147181 20:63570796-63570818 AGGAGCTGCAGGAGTGGGTCCGG - Exonic
1176287488 21:5026017-5026039 AGGAGCGGCTGGATGGGGCCTGG - Intronic
1178828471 21:36035125-36035147 AGGGGCTGCTGGTCCTGTTCAGG - Exonic
1178845044 21:36167677-36167699 AGGAACTGCTGAATGGGTACGGG - Intronic
1179647004 21:42782176-42782198 AGGAGCAGCTGCACTGGGTCAGG + Intergenic
1179869693 21:44237458-44237480 AGGAGCGGCTGGATGGGGCCTGG + Intronic
1182104951 22:27682646-27682668 AGGGGCTGGTGGCCGGGTCCTGG - Intergenic
1183186257 22:36293267-36293289 GGGAGCTGCTGGCCGGGCACTGG - Intronic
1184040443 22:41940018-41940040 GGGAGCTGCTGGAGGGCTTGGGG - Intronic
1184518710 22:44979468-44979490 AGGGGCTGCAGGAAGGGGTCAGG - Intronic
1185339387 22:50284723-50284745 AGGAGGGGCTGCAGGGGTTCTGG - Intronic
950136347 3:10583932-10583954 AGGAGCTGCTGTCAGGGTCCTGG - Intronic
950808922 3:15632719-15632741 GGTAGCTGCTGGAAGGCTTCTGG + Intronic
951040540 3:17984166-17984188 AGGAGATGCTGGAAGAGTTTGGG - Intronic
954481292 3:50803815-50803837 AGGGGCAGCTGGCCGGGTTGGGG + Intronic
955429897 3:58831960-58831982 GGGAGCTGCTGTAGGGGTTAAGG - Intronic
960789993 3:121418416-121418438 AGGCGCTGCTGGAGGGGTGATGG + Exonic
961348180 3:126278462-126278484 AGGAGCTGCTGGGAGATTTCAGG + Intergenic
966965922 3:184993604-184993626 AGGAGTTGTTGGACAGATTCTGG + Intronic
968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG + Intergenic
968308491 3:197665221-197665243 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
971375355 4:26051622-26051644 AGGATCTCCTGGACGGCTGCAGG + Intergenic
971555601 4:28010879-28010901 GGGAGCTGGTGGACGGGTGGCGG + Intergenic
975741373 4:77432364-77432386 AGGAGTTGCTGTACTGGTTAGGG + Intronic
982208577 4:153016942-153016964 ATGAGCTGCTGTACTAGTTCAGG + Intergenic
985662020 5:1162043-1162065 AGGAGCTACGGGAGGGGTTGGGG + Intergenic
985747148 5:1654009-1654031 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
986200633 5:5575193-5575215 AGGAGCTGATTGAGGGATTCTGG + Intergenic
993452982 5:88095394-88095416 AGCAGCTGCTGGATGGCTTTGGG - Intergenic
995705429 5:114984282-114984304 AGAAGCTGCTGGAGGCCTTCTGG + Intergenic
997647572 5:135491309-135491331 AGGAGCGGCTGGATGGCCTCTGG - Intergenic
998253444 5:140567675-140567697 AGCAGCTGCTGGAGGGGGACTGG - Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1001858279 5:175031741-175031763 AGGAGCTGGGGGAGGGGCTCTGG - Intergenic
1001958702 5:175866622-175866644 AGGAGCTGCTGGGCAGATGCTGG + Intronic
1005379490 6:25218538-25218560 TGGAGCTGTTGGATGTGTTCAGG + Intergenic
1007109435 6:39304468-39304490 GGGGGCTGCTGGACGGGGTGGGG - Intronic
1007414578 6:41684230-41684252 AGGACATGCTTGAGGGGTTCGGG - Exonic
1008879031 6:56362077-56362099 AGGAGATGGTGGACGGGTCGGGG - Intronic
1009377165 6:62987206-62987228 AGCAGATGCTGGAGAGGTTCTGG + Intergenic
1016885416 6:148955245-148955267 AGGAGCTGCTGCTCTGGTCCAGG + Intronic
1017557124 6:155583493-155583515 AGGAGGTGCTGGATGGGTGGTGG + Intergenic
1018632530 6:165833587-165833609 AGGAACTGCTTGATGGGCTCTGG - Intronic
1019647789 7:2140285-2140307 GGGGGCTGCTGGAGGGGTGCTGG - Intronic
1020035151 7:4959645-4959667 AGGGGGTGCTGGAGGGGTTGGGG + Intergenic
1022507680 7:30916690-30916712 AGGAGCTGCTGGAAGGGCCGGGG - Intronic
1022763183 7:33380058-33380080 AGGAGCAGCTGCACGGGAGCTGG + Intronic
1024089059 7:45920805-45920827 AGGCGCTGCTGGACGGCCGCGGG - Exonic
1026489049 7:70846927-70846949 AGGCGCTGCTGGCCAGGCTCAGG - Intergenic
1029615111 7:101651386-101651408 GGGAGCTGCTGGAGCCGTTCTGG + Intergenic
1029906759 7:104100593-104100615 AGGAAGTGCTGAGCGGGTTCAGG - Intergenic
1032012795 7:128357810-128357832 AGGAGCTGGAGGAGAGGTTCTGG - Intronic
1035256016 7:157628095-157628117 GGGTGCTGCTAGACGGGTTTTGG + Intronic
1035756766 8:2039528-2039550 AAGAGCTGCTGGTGGGTTTCTGG - Intergenic
1039548656 8:38428132-38428154 AGGAGCAGCTGGTCAGGCTCAGG + Intronic
1043050232 8:75377024-75377046 AGGAGCTGGAGGAGGGGCTCTGG - Intergenic
1045501717 8:102748845-102748867 AGGAGCTGCTGCAGGAGTGCAGG + Intergenic
1046474554 8:114724937-114724959 AGCAGCTGCTGGAGAGGTTATGG + Intergenic
1049589727 8:143451935-143451957 AGGTGCTGATGGAAGGGATCGGG + Intronic
1054827308 9:69586069-69586091 AGCAGCTGCAGTAAGGGTTCAGG - Intronic
1056127874 9:83554739-83554761 AGGAGTTGCTGAACTGGTACTGG + Intergenic
1056494665 9:87144194-87144216 AAGAGCTACTGGAAGGTTTCAGG + Intergenic
1057219375 9:93247774-93247796 AGGAGGTGCTGGTCGGCCTCCGG - Exonic
1059737779 9:117119476-117119498 AGGAGGTGCTGGAGAGGGTCAGG - Intronic
1060197144 9:121631179-121631201 AGGAGCTCCTGGCCTGGTTGCGG + Intronic
1062231934 9:135486705-135486727 TGGAGCAGCTGGGCGGGCTCCGG + Exonic
1062253110 9:135608204-135608226 AGGAGGTGCTCCAGGGGTTCTGG + Intergenic
1062314408 9:135959303-135959325 AGGAGCTTCTGTACTGGCTCAGG + Intronic
1062404963 9:136391858-136391880 GGAGGCTGCTGGACGGGTGCGGG - Intronic
1062425816 9:136505725-136505747 AGGGGCTGCTGGCCGGGAACTGG + Exonic
1062630391 9:137460685-137460707 AGGAGCTGCTGGACGTCCCCAGG - Exonic
1188228053 X:27626219-27626241 AGGAGCTGCAAGACGGGAGCTGG + Intronic
1189369185 X:40414276-40414298 AGGAAATGCTGGAAGGGTTGGGG + Intergenic
1190748529 X:53341340-53341362 AGGAGCTGCAGGACAAGTTCTGG + Intergenic
1191252730 X:58267152-58267174 AGGGGCTGCTGGAAAGGCTCTGG + Intergenic
1191257700 X:58286842-58286864 AGGAGCTGCTGGGAAGGTACTGG - Intergenic
1196791747 X:119469959-119469981 ATCAGCTGCTAGACGGGTACGGG - Exonic
1200986071 Y:9304366-9304388 AGGGTCTGCAGGACGGGTCCAGG + Intergenic