ID: 1091697305

View in Genome Browser
Species Human (GRCh38)
Location 12:2636570-2636592
Sequence CACCTTTAGCATCAGCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091697305 Original CRISPR CACCTTTAGCATCAGCAAAT TGG (reversed) Intronic
900178477 1:1301194-1301216 CACCTGTAGCCTCAGCTACTTGG - Intronic
900857114 1:5195090-5195112 CACCTTTAGGTTTAGTAAATGGG - Intergenic
901084992 1:6605045-6605067 CACCTTTAGTCTCAGCTACTTGG + Intronic
901607591 1:10471748-10471770 CAGTTTTCTCATCAGCAAATTGG - Intronic
901937643 1:12637550-12637572 CACCTGTAGTCTCAGCAACTCGG - Intergenic
904205571 1:28852842-28852864 CACCTGTAGTCTCAGCAACTCGG - Intronic
904687646 1:32272457-32272479 CACCTTTAGTCTCAGCTACTGGG + Intronic
905144884 1:35880434-35880456 CACCTGTAGTCTCAGCAACTCGG + Intronic
905339923 1:37271538-37271560 GCCCTTGACCATCAGCAAATGGG + Intergenic
905460897 1:38122400-38122422 CACCTTTAGCCTTAGCTATTTGG - Intergenic
905634924 1:39544072-39544094 CACCTGTAGTCTCAGCTAATTGG + Intergenic
906271944 1:44486273-44486295 CACCTTTAACAGGAGCACATAGG + Intronic
906844537 1:49177487-49177509 CAGTTTTTTCATCAGCAAATAGG - Intronic
908497552 1:64709909-64709931 CACCCTTGGCTACAGCAAATTGG + Intergenic
908877427 1:68693876-68693898 CATCTTTATTATCAGCAAGTTGG - Intergenic
910900213 1:92112276-92112298 CACCTGTAGTCTCAGCTAATCGG + Intronic
911955821 1:104233813-104233835 CACCTGTAGCCTCAGCCATTTGG - Intergenic
913136211 1:115891853-115891875 CACCTATAACTTCAGCACATTGG + Intergenic
914434704 1:147649568-147649590 CACCTTTAGTCTCAGCTACTCGG - Intronic
915424017 1:155808732-155808754 CACCTGTAGCCTCAGCTACTTGG - Intronic
917769436 1:178260763-178260785 CACCATTAGCATCAGTCAGTAGG - Intronic
920326915 1:205172423-205172445 CACCTGTAGTATCAGCTACTTGG - Intronic
921112603 1:212053709-212053731 CACCTATAGCCTCAGCTACTTGG - Intronic
921859456 1:220026654-220026676 CACCTGTAGTATCAGCTACTTGG - Intronic
924326029 1:242894652-242894674 CACCTGTAGCCTCAGCTACTCGG - Intergenic
1065148618 10:22798947-22798969 CACCTGTAGCCTCAGCTACTTGG + Intergenic
1065563396 10:26985576-26985598 TAGCTGTAGCATCAGCAGATTGG + Intergenic
1065564424 10:26994624-26994646 TAGCTGTAGCATCAGCAGATTGG + Intronic
1067781383 10:49209843-49209865 CACCTATAGCTTCAGCTACTTGG - Intergenic
1070393300 10:75989712-75989734 CACCTTTCTCATCTGCAAAGTGG - Intronic
1071472382 10:85992826-85992848 CACCTGTAGTCTCAGCAACTTGG + Intronic
1071992095 10:91109476-91109498 CATCTTTTGCATCAGGACATTGG - Intergenic
1073353914 10:102838581-102838603 CACCTTAAACAACAGCAAACAGG + Intergenic
1073589291 10:104741085-104741107 CACCTGTAGTATCAGCTACTTGG - Intronic
1074730076 10:116362062-116362084 CACCTGTAGCCTCAGCTACTCGG + Intronic
1075181878 10:120218729-120218751 CATCTTTAACAGCATCAAATTGG + Intergenic
1075227868 10:120645829-120645851 AACCTTTAGCATCCACATATCGG - Intergenic
1076017027 10:127035874-127035896 CACCTGTAGCCCCAGCAACTTGG + Intronic
1079195577 11:18323473-18323495 CAATTTTAGCATCAGTAAAATGG + Intronic
1079363187 11:19786862-19786884 CACCTGTAGCCTCAGCTACTGGG + Intronic
1080337499 11:31215167-31215189 CACCTGTAGTCTCAGCAACTCGG + Intronic
1080363172 11:31540355-31540377 CATCTATATAATCAGCAAATTGG + Intronic
1080400845 11:31934267-31934289 CACCATTAGCATCAGACAAAAGG + Intronic
1080556905 11:33426395-33426417 CTCCTTTAGCTTCAGAAAATTGG - Intergenic
1081127026 11:39333742-39333764 CACCTGAAGCATCACCAAAATGG + Intergenic
1081754688 11:45536175-45536197 CACTTTTCCCATCAGTAAATGGG - Intergenic
1082570498 11:54732259-54732281 CACCTTAAGCAACAGAAAACAGG + Intergenic
1084902135 11:72317547-72317569 CAGTTTTCTCATCAGCAAATTGG + Intronic
1085186345 11:74579086-74579108 CACCTGTAGCCCCAGCTAATCGG + Intronic
1085577873 11:77623466-77623488 CACCTGTAGTCTCAGCTAATCGG + Intronic
1089022328 11:115229207-115229229 CACCTTCAGCATCAGCTGACTGG + Exonic
1089242258 11:117091906-117091928 CACCTGTAGCCTCAGCTACTTGG - Intronic
1089873034 11:121693759-121693781 CACCTTTAGCCCCAGCTACTTGG + Intergenic
1091295259 11:134469476-134469498 CAATTTTAGCATCTGCAAAATGG - Intergenic
1091697305 12:2636570-2636592 CACCTTTAGCATCAGCAAATTGG - Intronic
1092745351 12:11667653-11667675 CACCTGTAGCCTCAGCTACTTGG - Intronic
1092825007 12:12390658-12390680 CACCTGTAGCCTCAGCTACTTGG + Intronic
1093769609 12:23003405-23003427 CACCTCTAGCACCATCACATTGG + Intergenic
1093971884 12:25383387-25383409 CATCTGTAGCATCAGCTATTTGG + Intergenic
1094181030 12:27592877-27592899 CACCTGTAGTATCAGCACTTTGG + Intronic
1094207768 12:27858789-27858811 CACCTGTAGCACCAGCACTTGGG - Intergenic
1094595521 12:31862688-31862710 CACCTGTAGTACCAGCAACTCGG + Intergenic
1094637645 12:32242087-32242109 CACCTTTAGTCTCAGCTACTCGG + Intronic
1096194458 12:49640986-49641008 CACCTCTGCCATCAGCAAAAAGG + Exonic
1096265521 12:50119566-50119588 CACCTGTAGCGTCAGCTACTTGG + Intronic
1097115825 12:56696361-56696383 CACCTGTAGTATCAGCTACTTGG - Intergenic
1099866358 12:88287290-88287312 CACCTGTAGCACCAGCTATTCGG + Intergenic
1100651147 12:96590279-96590301 CACCATTGGCAACTGCAAATAGG + Intronic
1101639231 12:106574870-106574892 CACCTTTAGTCTCAGCTACTCGG + Intronic
1101742802 12:107514100-107514122 CAGCTTCTGCATCAGCAAAGAGG - Intronic
1103183275 12:118933890-118933912 CACCTGTAGCCTCAGCTACTTGG + Intergenic
1104835487 12:131787259-131787281 CACCTTTCACTTCAGGAAATAGG + Intronic
1105392808 13:19996758-19996780 CACCTGTAGCCTCAGCTACTTGG + Intronic
1105831427 13:24165598-24165620 CAACTTTAGCAGCAGGAAAGGGG + Intronic
1106534676 13:30629359-30629381 CGCCTTTAGCACCAGCTACTTGG + Intronic
1112349425 13:98620541-98620563 CACCTGTAGCCTCAGCTACTCGG + Intergenic
1115231227 14:31162943-31162965 CGCCTGTAGTATCAGCAACTTGG + Intronic
1116746335 14:48824080-48824102 CACCTGTAGCCTCAGCTACTTGG + Intergenic
1116800375 14:49437354-49437376 CACATTTAACATCAGAAAGTTGG + Intergenic
1117494163 14:56285322-56285344 GACTTTTAGCTTGAGCAAATTGG + Intronic
1118791691 14:69099124-69099146 CACCTGTAGTATCAGCTACTTGG + Intronic
1119050422 14:71362467-71362489 CACCATTAGAGTCAGCCAATTGG - Intronic
1120565509 14:86050500-86050522 CATTTATAGCATCAGCAAACAGG - Intergenic
1121497199 14:94401458-94401480 CACCTGTAGCCTCAGCTACTTGG + Intergenic
1123702388 15:22924944-22924966 CACCTATAGTTTCAGCTAATGGG + Intronic
1125172131 15:36777734-36777756 CACCTGTAGTCTCAGCTAATTGG - Intronic
1125958181 15:43805736-43805758 CACCTGTAGCCTCAGCTACTCGG - Intronic
1126520614 15:49590296-49590318 AACCATTAGAATCAGGAAATTGG + Intronic
1126792687 15:52235366-52235388 GAGCTTTTGCATCAGGAAATGGG - Intronic
1126935815 15:53706587-53706609 CATCTTTAGCATCAAGACATGGG - Intronic
1128930079 15:71696577-71696599 CACCATTATCTTCAGCTAATTGG - Intronic
1129025024 15:72563450-72563472 CAGGTTTAGCATCAGGATATTGG - Exonic
1130371925 15:83292227-83292249 TACCTTGAGCTTCAGCAACTGGG - Intergenic
1130568683 15:85021279-85021301 CACCTGTAGTCTCAGCAATTTGG + Intronic
1131851011 15:96543103-96543125 CACCTATAGCCTCAGCTACTTGG - Intergenic
1132014732 15:98305569-98305591 CACCTGTAGTCTCAGCAACTTGG + Intergenic
1133558422 16:6927285-6927307 CACCTGTAGTATCAGCTACTTGG + Intronic
1133610411 16:7428017-7428039 AACTTTTAGGATGAGCAAATAGG - Intronic
1133794369 16:9034003-9034025 CACCTGTAGTCTCAGCAACTTGG - Intergenic
1134060509 16:11196985-11197007 CACCTGTAATATCAGCAATTTGG - Intergenic
1134501978 16:14776544-14776566 CACCTGTAACACCAGCACATTGG - Intronic
1134578583 16:15352349-15352371 CACCTGTAACACCAGCACATTGG + Intergenic
1134724005 16:16405195-16405217 CACCTGTAACACCAGCACATTGG - Intergenic
1134943425 16:18306674-18306696 CACCTGTAACACCAGCACATTGG + Intergenic
1135011933 16:18888946-18888968 CACCTGTAGTCTCAGCTAATTGG - Intronic
1135492282 16:22919905-22919927 CAATTTTATCATCAGTAAATTGG + Intergenic
1136589114 16:31206586-31206608 CACCTGTAGTATCAGCTATTTGG - Intergenic
1137945505 16:52730135-52730157 CACCTGTAGCCTCAGCTACTTGG + Intergenic
1138454086 16:57111300-57111322 CACCTGTAGCCCCAGCTAATCGG - Intronic
1138898878 16:61244369-61244391 CACCTGCAGCTTCGGCAAATGGG + Intergenic
1140555628 16:75917749-75917771 GACCTAAAGCATCAGCTAATGGG - Intergenic
1142723740 17:1796394-1796416 CACCTTTAACCTCAGCATTTTGG - Intronic
1142843004 17:2648550-2648572 CACCTGTAGCCCCAGCTAATTGG + Intronic
1143654204 17:8283937-8283959 CACCTGTAGTATCAGCTACTTGG - Intergenic
1144264709 17:13556724-13556746 CACCTGTAGCCTCAGCTACTCGG + Intronic
1146220297 17:31012694-31012716 CACCTGTAGTACCAGCAACTCGG - Intergenic
1146798018 17:35796100-35796122 CACTTTTCTCATCAGTAAATGGG + Intronic
1147687586 17:42296022-42296044 CACTTTTACCATCTGCAAAAGGG - Intronic
1148346582 17:46907574-46907596 CACCTGTAGCTCCAGCAGATTGG + Intergenic
1148434492 17:47672129-47672151 CACCTTTAGTACCAGCTACTCGG - Intronic
1148541128 17:48481471-48481493 CACCTTTAGTCTCAGCTACTTGG - Intergenic
1148696681 17:49564287-49564309 CACCTGTAGTCTCAGCAACTCGG + Intergenic
1149873287 17:60203273-60203295 CACCTGTAGTATCAGCTACTTGG + Intronic
1150087067 17:62280525-62280547 CACCTGTAGTATCAGCTACTTGG + Intronic
1152029893 17:77835647-77835669 CACCTTTAGTCTCAGCTACTTGG + Intergenic
1152256198 17:79241272-79241294 CACCTGTAGCCCCAGCACATTGG - Intronic
1153249448 18:3106695-3106717 CACCTGTAGCACCAGCTACTAGG + Intronic
1154319699 18:13337633-13337655 CACCTGTAATATCAGCAACTTGG + Intronic
1156210950 18:34941999-34942021 CAATTTTAGCATCAAAAAATTGG - Intergenic
1156339013 18:36194616-36194638 CACCTTTATGCTCAGCAATTTGG - Intronic
1157898183 18:51488390-51488412 CACCTTTAGTCTCAGCTACTTGG - Intergenic
1159161854 18:64652372-64652394 CCCACTTAGCATCAGTAAATAGG - Intergenic
1159224379 18:65513379-65513401 CACCTGTAGCCTCAGCTACTCGG + Intergenic
1159228604 18:65574422-65574444 TAGGTTTAGCATCACCAAATGGG - Intergenic
1160495896 18:79374955-79374977 CAGCTTTTGCATCTGCAAACTGG + Intronic
1161416182 19:4148053-4148075 CACCTGTAGCCTCAGCTACTTGG + Intergenic
1161466854 19:4435828-4435850 CACCTTTAACATCAGAGAAGAGG - Intronic
1162129405 19:8516527-8516549 CACCTTTAGTACCAGCTACTAGG - Intergenic
1162313497 19:9921966-9921988 CACCTATAGCTCCAGCAACTCGG + Intronic
1162928562 19:13943585-13943607 CACCTTTAGTCCCAGCTAATTGG - Intronic
1163001542 19:14371134-14371156 CACCTGTAGTCTCAGCAACTTGG - Intergenic
1164521812 19:28985382-28985404 CACCATTTGCACCAGCAAAGTGG - Intergenic
1164549522 19:29197607-29197629 CACCTGTAGCCTCAGCTACTTGG - Intergenic
1166229747 19:41419565-41419587 CACCTGTAGTCTCAGCTAATCGG - Intronic
1166335775 19:42106229-42106251 CACCTGTAGCCTCAGCTACTTGG - Intronic
1166553620 19:43683745-43683767 CACCATTAGCATTAGTAAAGAGG + Intergenic
1167188208 19:47963097-47963119 CACCTGTAGCCCCAGCAACTTGG - Intergenic
1167891639 19:52544587-52544609 CACCTTTAACCTCAGCACTTAGG - Intronic
1167922108 19:52790369-52790391 CACCTTTAGCCCCAGCTACTTGG + Intronic
1168657111 19:58138367-58138389 CACCTTAAACATCAGAAAAAAGG + Intronic
926532177 2:14062268-14062290 CATTTTTAGCATTTGCAAATGGG - Intergenic
928064522 2:28149813-28149835 TACCTCTCGCTTCAGCAAATTGG + Intronic
930068980 2:47350378-47350400 CACCTGTAGCCTCAGCTACTTGG - Intronic
930815973 2:55598092-55598114 CACCTGTAGTCTCAGCTAATCGG + Intronic
933080463 2:77978312-77978334 CACCTTTAGTCTCAGCTACTTGG - Intergenic
933676848 2:85064807-85064829 CACTTTTATCATCAGTAAAATGG - Intergenic
933967268 2:87440229-87440251 AACCTTCAGCAGCAGCAAGTGGG - Intergenic
934704357 2:96466295-96466317 TACCTGTAGCATCAGCTACTCGG - Intergenic
935768234 2:106390758-106390780 CATCTTTTGCATCTGCAAAAAGG - Intergenic
935845332 2:107159957-107159979 CACCTTCAGCATCATCACCTGGG - Intergenic
936326527 2:111510266-111510288 AACCTTCAGCAGCAGCAAGTGGG + Intergenic
936456556 2:112679370-112679392 CACCTGTAGCCTCAGCTACTTGG - Intergenic
936783609 2:116065420-116065442 AACTTTTAGCATCAGAAAGTAGG - Intergenic
938914439 2:135921547-135921569 GTCCTATACCATCAGCAAATGGG - Intronic
939556544 2:143681067-143681089 CACCTTTCGAAGGAGCAAATGGG + Intronic
939628239 2:144504751-144504773 CAGCTTTCGCATCTGCAATTAGG - Intronic
939862819 2:147439767-147439789 CAGATTTAGAATGAGCAAATTGG - Intergenic
941049894 2:160721126-160721148 CACTTCTACCATCTGCAAATGGG + Intergenic
941588503 2:167389490-167389512 CAGCGGTAGCATCAGCAAGTTGG - Intergenic
945899584 2:215523014-215523036 CACCTTTAGTCTCAGCTACTTGG + Intergenic
947266705 2:228290295-228290317 CACCTGTAGTCTCAGCCAATTGG + Intergenic
947395161 2:229679296-229679318 CACCTTTTGCCTAAGCAAAAAGG + Intronic
1169567332 20:6869343-6869365 GACCTTTAGCAGCAGGGAATAGG - Intergenic
1170195547 20:13685401-13685423 CACCTTTAATACCAGCACATTGG + Intergenic
1170935872 20:20808885-20808907 CACCTGTAGCCTCAGCTACTTGG + Intergenic
1171108692 20:22460439-22460461 CACCTTTATATTCAGCAAATAGG + Intergenic
1172652146 20:36511326-36511348 CACCTGTAGCCTCAGCTACTTGG - Intronic
1174049070 20:47754957-47754979 CACCTGTAGTAGCAGCTAATGGG - Intronic
1174571036 20:51501453-51501475 CACCTTGAGCATCAGTACAGAGG - Intronic
1175090851 20:56502822-56502844 CATATTTAGCTTCAGGAAATGGG + Intronic
1178856949 21:36258279-36258301 CACCTGTAGCCTCAGCTACTTGG + Intronic
1178862059 21:36297792-36297814 CACCTGTAACCTCAGCAATTTGG - Intergenic
1179371311 21:40808597-40808619 CACCTGTAGTCTCAGCAACTGGG - Intronic
1179917839 21:44489285-44489307 CACATGTAGCATCAGGAAAGGGG + Intergenic
1180655559 22:17417879-17417901 CACCTGTAGTATCAGCACTTTGG - Intronic
1181152450 22:20894633-20894655 CACATTTGGCATCTGCAAGTAGG + Intergenic
1181257276 22:21571532-21571554 CACCTATAGTATCAGCTACTTGG - Intronic
1181282522 22:21730024-21730046 CACCTTTAGTCTCAGCTACTAGG + Intronic
1183900778 22:41004348-41004370 CACCTTTAGCCTCAGCTACTTGG - Intergenic
1184158775 22:42685942-42685964 CACCTGTAGCCTCAGCACTTTGG - Intergenic
1184771983 22:46602535-46602557 CACCTCTAGTCTCAGCAACTTGG + Intronic
949324960 3:2853368-2853390 CACCTGTAGCCTCAGCTACTTGG - Intronic
949858892 3:8487538-8487560 CACCTGTAGCCCCAGCAACTTGG + Intergenic
950762907 3:15249888-15249910 CACCTGTAGCCTCAGCTACTTGG - Intronic
950780132 3:15384611-15384633 CACCTGTAGCCTCAGCTACTCGG + Intronic
950941823 3:16900673-16900695 CACCTTTAACATCAGCTTAGTGG + Intronic
950949715 3:16985767-16985789 CACCTTTAGTAAGAGCACATGGG + Intronic
955372844 3:58368446-58368468 CACCTGTAGCCTCAGCTACTCGG - Intronic
955646913 3:61149752-61149774 CACCTGTAGCCTCAGCTACTCGG + Intronic
956151608 3:66249343-66249365 CTCCTTTGGTATCAGCATATGGG + Intronic
956419096 3:69066876-69066898 CACCTTTATCAAAAACAAATTGG + Intronic
956666235 3:71644520-71644542 CACCTTTAGCCCCAGCTACTTGG + Intergenic
958068676 3:88580085-88580107 CACCTGTAGCCTCAGCTACTCGG + Intergenic
958947490 3:100379740-100379762 CACCTGTAGTCTCAGCAACTGGG - Intronic
959039239 3:101401856-101401878 CACCTGTAGCCTCAGCTACTCGG + Intronic
959041511 3:101427362-101427384 CACCTTTAGTCTCAGCTACTCGG + Intronic
959284168 3:104386029-104386051 TATCTTTAGAATCAGGAAATTGG - Intergenic
959337578 3:105085420-105085442 CACATTTAACATTAGCAAATGGG + Intergenic
959599614 3:108166230-108166252 CTTCTTTAACATCAGAAAATAGG + Intronic
961692776 3:128682051-128682073 GGCATTCAGCATCAGCAAATAGG - Intergenic
961709516 3:128816862-128816884 CACCTGTAGCCTCAGCTACTTGG + Intergenic
961908687 3:130290623-130290645 CACCTGTAGTATCAGCTACTTGG - Intergenic
962409292 3:135127438-135127460 CACCTTCACCATCACCCAATGGG + Intronic
962566265 3:136663346-136663368 CTACTTTAGAATAAGCAAATAGG + Intronic
963422523 3:145078246-145078268 CATCTATAAAATCAGCAAATTGG + Intergenic
963472733 3:145763119-145763141 CACGTTTGTCATCAGTAAATGGG - Intergenic
963564386 3:146909587-146909609 CACCTGTAGTCTCAGCAACTTGG + Intergenic
964084962 3:152805802-152805824 CACCTCTAGAATAATCAAATTGG - Intergenic
965429974 3:168574393-168574415 CACCTGTAGCCTCAGCTACTTGG - Intergenic
966406753 3:179605915-179605937 CACCTGTAGCCTCAGCTACTGGG - Intronic
967546904 3:190741316-190741338 CACCTATAGTCTCAGCAACTTGG - Intergenic
967574210 3:191071386-191071408 CAACTTTAACTTCAGCAAATTGG - Intergenic
967938686 3:194749397-194749419 CACCTTTAGCACAAGAAAAGAGG - Intergenic
968566104 4:1313906-1313928 CACCTGTAGTCTCAGCTAATTGG + Intronic
970633263 4:17978471-17978493 CACCTGTAGTCTCAGCTAATTGG + Intronic
972648420 4:40992287-40992309 CACCTTTAGTACCAGCTACTCGG - Intronic
973152460 4:46905742-46905764 CACCTTTAGCTGCACCAAAGTGG - Intronic
976127160 4:81845926-81845948 CAGCTTTATCATCTGCAAATGGG - Intronic
976413259 4:84741573-84741595 CACCTGTAGTATCAGCACTTTGG - Intronic
981048947 4:140292312-140292334 CACCTGTAGCCCCAGCAACTTGG - Intronic
981092764 4:140749103-140749125 CACCTCTAATATCAGCAATTTGG + Intronic
982430837 4:155320277-155320299 GACCATTAGCATAAGCAAATAGG + Intergenic
983346160 4:166527268-166527290 CACTTTTAGTTTCATCAAATTGG + Intergenic
983740570 4:171126580-171126602 CACCTTTAGTCTCAGCTACTAGG + Intergenic
984126320 4:175815313-175815335 CACCATTAGCAACAACAACTTGG - Intronic
984843641 4:184091644-184091666 CACCTGTAGTCTCAGCAAGTTGG + Intronic
984878357 4:184389290-184389312 CACCTTTAGCCCCAGCAACTCGG + Intronic
986121585 5:4842502-4842524 CACTTTTGGCATCTGCAAAATGG + Intergenic
986186520 5:5446254-5446276 CACCTGTAGTATCAGCACTTTGG - Intronic
987146576 5:14996687-14996709 CACCTGTAGCCTCAGCTACTTGG - Intergenic
987945813 5:24607078-24607100 CACCCTCAGCTTCAGCAAACAGG + Intronic
988926927 5:35999360-35999382 CAGCTGTGGCATCAGCCAATTGG - Intergenic
990567666 5:57045865-57045887 CACCTGTAGCCTCAGCTACTAGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991336531 5:65554275-65554297 CACCTTTAGTCTCAGCTACTCGG - Intronic
991503043 5:67296363-67296385 CAGTTTTATCATCAGCAAAATGG + Intergenic
991705610 5:69355271-69355293 CACCTGTAGCCTCAGCACTTTGG + Intronic
992212691 5:74496246-74496268 CACCTGTAACCTCAGCAATTTGG - Intergenic
992843874 5:80725086-80725108 CACCTGTAGCTTCAGCTACTCGG + Intronic
997290616 5:132730843-132730865 CACCTGTAGCCTCAGCTACTGGG + Intronic
997443436 5:133925020-133925042 GGCTTTCAGCATCAGCAAATGGG - Intergenic
997551024 5:134753455-134753477 CACTTTTAATCTCAGCAAATTGG - Intergenic
997695305 5:135856673-135856695 CACCTTCATCTTCAGCATATTGG + Intronic
997953792 5:138262712-138262734 CACCTGTAACTTCAGCAACTTGG - Intronic
998946393 5:147344510-147344532 CACCTGTAGTATCAGCTACTTGG + Intronic
999006126 5:147981528-147981550 CACCTTTAGAACCAGTAACTAGG - Intergenic
999139796 5:149351869-149351891 GACCTTTAGCCCCTGCAAATGGG - Exonic
1000778642 5:165451176-165451198 CACCTGTATATTCAGCAAATGGG - Intergenic
1001207527 5:169778252-169778274 CAGCTTTAGCACCTGCAAAGAGG - Intronic
1002146281 5:177184652-177184674 CACCTGTAGTTTCAGCAACTTGG - Intronic
1002504148 5:179667233-179667255 CACCTGTAGCCCCAGCAACTCGG - Intergenic
1003013239 6:2446229-2446251 CACCTTTAGTCTCAGCTACTTGG + Intergenic
1003790438 6:9540759-9540781 AAATTTTAACATCAGCAAATAGG - Intergenic
1004266582 6:14153304-14153326 CACCTTTAGCTGCAGTAACTGGG - Intergenic
1004889849 6:20090049-20090071 CACCTTTAGTAACAGCACTTTGG - Intergenic
1008016177 6:46522392-46522414 CACTTTTCTCATCTGCAAATGGG - Intergenic
1008636431 6:53415626-53415648 CAGCTTTAGCATCAATAAACTGG + Intergenic
1010440793 6:75891504-75891526 CACCTGTAGCCCCAGCTAATTGG + Intronic
1011021813 6:82822375-82822397 CACCTGTAGCCCCAGCATATTGG + Intergenic
1011608109 6:89124859-89124881 CACTTGTAGCACCAGCAACTTGG - Intergenic
1012356390 6:98319393-98319415 CACCTTTAGTATTAGCAGAATGG - Intergenic
1013599166 6:111688181-111688203 CACCTTTCTCATCATAAAATAGG - Intronic
1013951319 6:115785565-115785587 CACTTTCAACTTCAGCAAATGGG + Intergenic
1016462781 6:144295804-144295826 CACATTTATCATCTGCAAAATGG - Intronic
1016947362 6:149547062-149547084 CACCTGTAGCCCCAGCAACTCGG - Intergenic
1017395045 6:153988993-153989015 CACCTGTAGCCTCAGCTACTTGG - Intergenic
1018129074 6:160710929-160710951 CATCTTTTGCATCTGCAAAAAGG - Intronic
1019787270 7:2985073-2985095 CACCTGTAGTCTCAGCAATTTGG + Intronic
1021658755 7:22897729-22897751 CACCTGTAGCCTCAGCTACTTGG - Intergenic
1021860456 7:24900893-24900915 CACCTGTAGTATCAGCTACTGGG + Intronic
1021964835 7:25907125-25907147 CATCTTTACCATCAGGAATTGGG + Intergenic
1022013061 7:26325851-26325873 CACCTGTAGTATCAGCTACTCGG - Intronic
1023437220 7:40151112-40151134 CACCTGTAGTACCAGCTAATTGG + Intronic
1023918040 7:44605371-44605393 CACCTGTAGTCTCAGCTAATTGG - Intergenic
1024077080 7:45826847-45826869 CACCTTTAATCTCAGCAATTTGG + Intergenic
1024828513 7:53420776-53420798 CACCTTTGGCATCAGGTATTTGG + Intergenic
1025183217 7:56835269-56835291 CACCTATAGTCTCAGCAACTTGG + Intergenic
1025688710 7:63741706-63741728 CACCTATAGTCTCAGCAACTTGG - Intergenic
1026022203 7:66717683-66717705 CACCTTTAGTCTCAGCTACTTGG - Intronic
1026305315 7:69135136-69135158 CATGTTTAACATGAGCAAATAGG + Intergenic
1026447220 7:70495491-70495513 TACCTTTAGCAGCAGAAATTTGG + Intronic
1026589500 7:71682826-71682848 CACCTGTAGCCTCAGCACTTTGG - Intronic
1026594096 7:71719757-71719779 CACCTGTAGCCTCAGCTACTTGG - Intergenic
1028244929 7:88465541-88465563 CACCTGTAGCCTCAGCTACTTGG - Intergenic
1029099986 7:98121505-98121527 CACCTTTAGTCCCAGCAACTCGG + Intronic
1029227134 7:99036350-99036372 CACCTGTAGCCTCAGCTACTCGG + Intronic
1030054818 7:105574833-105574855 CACCTGTAGCTTCAGCACTTTGG + Intronic
1030839239 7:114328044-114328066 CACCTTTAGGCTCAGCTACTAGG - Intronic
1031364272 7:120885606-120885628 CACCTGTAGCCCCAGCAACTTGG + Intergenic
1031592229 7:123607610-123607632 CACCTGTAGTATCAGCTACTTGG - Intronic
1031597505 7:123664965-123664987 CATCCTTAGCATCAGCCAAAAGG - Intergenic
1032199868 7:129812411-129812433 CACTTTTAGCCTCAGCTACTCGG - Intergenic
1032497428 7:132373245-132373267 CACCTTTAGCCCCAGCAACCAGG + Intronic
1032867644 7:135943289-135943311 CCTTTTTAGCATAAGCAAATTGG - Intronic
1036190237 8:6663371-6663393 CACCTTTAGCAACAAGAACTTGG - Intergenic
1036506760 8:9363923-9363945 GACTTATACCATCAGCAAATTGG - Intergenic
1036811990 8:11873427-11873449 CACCTGTAGCCCCAGCTAATTGG - Intergenic
1037214490 8:16432054-16432076 CACCTGTAACATCAGCACTTTGG + Intronic
1038313099 8:26460768-26460790 CACCTGTAGTCTCAGCAACTCGG + Intronic
1038794156 8:30694941-30694963 CACCTGTAGCCTCAGCTACTTGG + Intronic
1039141940 8:34400423-34400445 GACCTACAGCATCAGCAACTAGG - Intergenic
1039578286 8:38643345-38643367 CACCTGTAGTCTCAGCTAATTGG + Intergenic
1040653570 8:49478227-49478249 CACCTGTAACTTCAGCAATTTGG + Intergenic
1041403918 8:57474989-57475011 CACCTTTAACATCATTACATTGG + Intergenic
1041710902 8:60893352-60893374 GACTTTCAGCATCAGCAAACTGG + Intergenic
1041717829 8:60948202-60948224 CACCTGTAGTACCAGCTAATCGG - Intergenic
1042807930 8:72792077-72792099 CCCATTTAGCAGCAGTAAATGGG + Intronic
1043236437 8:77874111-77874133 CACCTGTAGTACCAGCTAATTGG - Intergenic
1043414311 8:80032441-80032463 CACCTTTAGTCTCAGCTACTCGG + Intronic
1044557822 8:93583721-93583743 CACCAGCAGCATCAGCAAACTGG - Intergenic
1045469108 8:102495477-102495499 CACCTGTAGCCCCAGCTAATTGG - Intergenic
1045918455 8:107501761-107501783 CACATTTCTCATCAGCAAAATGG - Intergenic
1045977471 8:108146136-108146158 CTCCTTTTGCATGAGCAAATGGG - Intergenic
1047168669 8:122467689-122467711 CATCTTCAACATCATCAAATAGG + Intergenic
1048563902 8:135573332-135573354 CACATTTAGCAACAGCAATGTGG - Intronic
1049704190 8:144032401-144032423 CACCTTTAGTCCCAGCAACTCGG - Intronic
1050231733 9:3532953-3532975 CACCTTTAGTCTCAGCACTTTGG + Intergenic
1051254205 9:15195542-15195564 CACCTGTAGCCTCAGCTACTCGG + Intronic
1051774316 9:20618858-20618880 CACCTTGACAATCAACAAATTGG - Intronic
1051798623 9:20905443-20905465 TACCCTTAGCCTCAGCAAATTGG - Intronic
1051811999 9:21059842-21059864 CACCTTAGACATCAGGAAATTGG - Intergenic
1051829825 9:21263424-21263446 CACATCTGGCATAAGCAAATGGG - Intergenic
1053438972 9:38098374-38098396 TACCTTTACCATCTGCTAATTGG + Intergenic
1054764450 9:69031855-69031877 CACCTGTAACCTCAGCAATTTGG + Intergenic
1055862377 9:80767957-80767979 CACCTATAGTATCAGCTATTCGG + Intergenic
1056646322 9:88415027-88415049 CACCTTTAGTCTCAGCTACTCGG - Intronic
1056743513 9:89280773-89280795 CACCTGTAGTCTCAGCAACTTGG - Intergenic
1060654079 9:125356625-125356647 CACCTATAGTACCAGCAATTTGG - Intronic
1060862646 9:126967660-126967682 CACCTGTAGCACCAGCACTTTGG - Intronic
1187074531 X:15921053-15921075 CACCTGTAGTCTCAGCTAATTGG - Intergenic
1187074718 X:15922449-15922471 CACCTGTAGTCTCAGCTAATTGG + Intergenic
1187273148 X:17797004-17797026 CACTTTTAGCATGAAAAAATAGG - Intergenic
1187564014 X:20430428-20430450 CAGCAGTAGCATCAGCAACTGGG + Intergenic
1190257055 X:48771439-48771461 CACCTGTAGTACCAGCAACTTGG - Intronic
1190362405 X:49661726-49661748 CAAATGTAGCATCAGCATATCGG + Intergenic
1190832785 X:54074205-54074227 CACCTTCCTCATCAGCAAATGGG - Intronic
1191581130 X:62762408-62762430 TACCTTTTGATTCAGCAAATTGG - Intergenic
1193829210 X:86267812-86267834 AACATTTAATATCAGCAAATGGG - Intronic
1197180052 X:123525136-123525158 CACCATTAGCAGCAGCAAGAGGG - Intergenic
1197265384 X:124363766-124363788 CACCTGTAGCCTCAGCTACTCGG + Intronic
1197855814 X:130912697-130912719 CAACCATAGCATCAGAAAATAGG - Intergenic
1198188129 X:134274989-134275011 CACCTGTAGTCTCAGCAACTTGG - Intergenic
1201223475 Y:11793211-11793233 CACCTGTAGCCTCAGCTACTTGG - Intergenic
1201715399 Y:17039121-17039143 CACCTATAGTATCAGCTACTTGG - Intergenic
1201926226 Y:19290872-19290894 TAGCTGTAGCATCAGCCAATTGG + Intergenic
1202268782 Y:23049321-23049343 CACCTGTAATATCAGCAATTTGG - Intergenic
1202421774 Y:24683061-24683083 CACCTGTAATATCAGCAATTTGG - Intergenic
1202449012 Y:24987017-24987039 CACCTGTAATATCAGCAATTTGG + Intergenic