ID: 1091699676

View in Genome Browser
Species Human (GRCh38)
Location 12:2651416-2651438
Sequence TAGACTGTGCCCAGGCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091699676_1091699686 23 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699686 12:2651462-2651484 GGCTGTCCACTCATTAAAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1091699676_1091699685 22 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699685 12:2651461-2651483 GGGCTGTCCACTCATTAAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 65
1091699676_1091699681 -3 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699681 12:2651436-2651458 CTAGCTCTGCAGAGACCATGGGG 0: 1
1: 0
2: 2
3: 28
4: 200
1091699676_1091699682 1 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699682 12:2651440-2651462 CTCTGCAGAGACCATGGGGCTGG 0: 1
1: 0
2: 4
3: 32
4: 390
1091699676_1091699679 -5 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699679 12:2651434-2651456 GTCTAGCTCTGCAGAGACCATGG 0: 1
1: 0
2: 2
3: 13
4: 159
1091699676_1091699683 2 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699683 12:2651441-2651463 TCTGCAGAGACCATGGGGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 286
1091699676_1091699680 -4 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699680 12:2651435-2651457 TCTAGCTCTGCAGAGACCATGGG 0: 1
1: 0
2: 0
3: 10
4: 151
1091699676_1091699687 26 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091699676 Original CRISPR TAGACTGTGCCCAGGCCGCT GGG (reversed) Intronic
902361818 1:15946089-15946111 TACCCTGTGCCCAGGCTGCTGGG + Intronic
904033576 1:27547719-27547741 TAGGCTGTGCCCTTGCAGCTGGG + Exonic
905268340 1:36770335-36770357 TAGACGTTGCCCAGGTTGCTGGG - Intergenic
907335468 1:53696734-53696756 TACACTTTGCCCATGCCGCCTGG + Intronic
909232162 1:73104993-73105015 TAGCCTCTGCCCAGGCCACCCGG - Intergenic
909301533 1:74018743-74018765 TAGTCAGTGCCCAGGCCACAAGG - Intergenic
914846487 1:151286602-151286624 GAGACGGGGCCCAGGCTGCTGGG + Exonic
915913317 1:159927624-159927646 TAGACTGTGCCTTGCCCCCTTGG - Intronic
923199124 1:231694582-231694604 CAGACTTGGCCCAGGCCGCAAGG + Exonic
1063716695 10:8534591-8534613 TAAACTGTACCAACGCCGCTCGG - Intergenic
1064788024 10:18920374-18920396 GAGACTGTGCCCGCGCCACTGGG - Intergenic
1066111213 10:32198761-32198783 GACACTGTGCCCAGCCTGCTTGG - Intergenic
1067684867 10:48460036-48460058 AAGGCTGTGCCCTGGCCGCCCGG + Intronic
1073300655 10:102469248-102469270 TAGAGGCTGCCCAGGCTGCTGGG + Intronic
1084172572 11:67407603-67407625 TAGACTGTAGCCTGGCCCCTGGG - Intronic
1085615908 11:77998428-77998450 GAGACTGTCCCCAGACCACTGGG - Intergenic
1090440000 11:126717514-126717536 TAGACTCTGCTCAGGCAGGTTGG + Intronic
1090766696 11:129882378-129882400 TAGGCTGTGCCCTGGCCCCTAGG - Intronic
1091499270 12:999879-999901 GCCACTGTGCCCAGCCCGCTAGG + Intronic
1091699676 12:2651416-2651438 TAGACTGTGCCCAGGCCGCTGGG - Intronic
1096386348 12:51197545-51197567 GAGAATGTGCCCAGCCCTCTTGG + Intronic
1102547483 12:113667156-113667178 AAGACTCTGCCCAGACCCCTGGG + Intergenic
1104271336 12:127285120-127285142 TGGACTGTGCCAAGGCTTCTTGG + Intergenic
1104923394 12:132302986-132303008 CAGACTCTGCACAGGCCCCTGGG - Intronic
1107645521 13:42490991-42491013 CAGACTGTGGCCAGGCTGCCAGG - Intergenic
1120979848 14:90279952-90279974 GATGCTGTGCCCCGGCCGCTTGG - Intronic
1122145943 14:99688868-99688890 TCGGCTCTGCCCAGGCTGCTGGG - Intronic
1129844058 15:78760183-78760205 GAGACTGAGCCCAGCCTGCTGGG + Intronic
1130730421 15:86486530-86486552 TGGACTGTGCCCAGGTGCCTGGG - Intronic
1132373915 15:101316009-101316031 ACGACTGTGCCCAGGCCCCTGGG + Intronic
1132859151 16:2061539-2061561 TTGGCTGTGCCCATGCAGCTGGG - Intronic
1140944509 16:79755251-79755273 TAGACTGGGCTCAGGCTGGTAGG + Intergenic
1142186730 16:88698278-88698300 TAGAGGGTGCCCAGGCCTCTCGG - Intronic
1142322314 16:89391404-89391426 TAGACAGTGTCCAGGCTGCACGG + Intronic
1142764200 17:2056535-2056557 TCGCCGGTGCCCAGGCCGCAGGG + Intronic
1143391947 17:6564273-6564295 TAGACTGTGCCCAGACTGGGGGG - Intergenic
1158540069 18:58345543-58345565 TCAACAGTGCCCAGGCCGATGGG - Intronic
1160914200 19:1489039-1489061 TAGACAGGGCCCAGCCCGATGGG + Intronic
1165088754 19:33371055-33371077 TAGTCAGTGCCCAGGACACTCGG - Intergenic
1165309346 19:35021233-35021255 TAGACAGGGCTCAGGCCGCCGGG + Intronic
932684347 2:73855331-73855353 TTCACTGTGCCCATGCTGCTGGG - Intronic
934711355 2:96516350-96516372 TTGTCTTTGCCCAGGCCTCTGGG + Intergenic
936461530 2:112717948-112717970 GGGACTGAGCCCAGGCAGCTGGG - Intergenic
938105984 2:128530187-128530209 GACTCTGTGCCCAGGCCGCCAGG + Intergenic
938310881 2:130287461-130287483 GAGACTGCGGCCAGGCCTCTTGG - Intergenic
946276273 2:218634152-218634174 GAGTCTGTCCTCAGGCCGCTGGG - Exonic
946476410 2:220010674-220010696 AAAACTGTGCCCAGGCCTCAGGG + Intergenic
1173586407 20:44186606-44186628 TGGACTGTGCACAGGCCCCAAGG - Exonic
1173761274 20:45562640-45562662 TAGAGTGTGCCCAGGCCCTCTGG - Intronic
1174797062 20:53531076-53531098 GAGACTGAGCTCAGGCCTCTTGG + Intergenic
1176385136 21:6135339-6135361 GCCACTGTGCCCAGGCCCCTGGG + Intergenic
1179738337 21:43402913-43402935 GCCACTGTGCCCAGGCCCCTGGG - Intergenic
1183146346 22:35995969-35995991 TGGATTTTGCCCAGGCCCCTTGG - Intronic
1183648571 22:39140808-39140830 GAGACTGTGCCTGGGCCACTTGG + Intronic
1184569707 22:45314443-45314465 CAGACAATGCCCAGGCCGGTGGG + Intronic
954650114 3:52156013-52156035 CATGCTGTGCCCAGGCCACTTGG + Intergenic
962410019 3:135132884-135132906 GAGTTTGTGCCCAGGCAGCTGGG + Exonic
964296786 3:155241709-155241731 TAGCCTGTTCCCAGGACACTTGG + Intergenic
969452369 4:7281930-7281952 TGGCGTGTGCCCAGGCAGCTGGG - Intronic
969525469 4:7701900-7701922 TGCACTGTGCCCAGGGGGCTGGG - Intronic
981817981 4:148852667-148852689 GAGACTGTGGCAAGGCTGCTAGG + Intergenic
985851285 5:2390730-2390752 TACACTGTGCCCTGGCCCCAAGG - Intergenic
991049835 5:62261029-62261051 TAGCATGTGCCCAGGCCTCCTGG + Intergenic
993334445 5:86640222-86640244 TAGACTGTGGCCTGACTGCTAGG + Intergenic
998373592 5:141676971-141676993 AAGACTGTGTTCAGGCAGCTGGG - Intronic
998764062 5:145465123-145465145 TAGACTGAGACCAGGACTCTAGG - Intergenic
998895597 5:146796502-146796524 TATACTGTGCCAAGGGCCCTGGG + Intronic
1001483323 5:172103183-172103205 GTGACTGGCCCCAGGCCGCTTGG - Intronic
1004251289 6:14025054-14025076 AAGGCTGTGCTCAGGCTGCTGGG - Intergenic
1008760796 6:54849283-54849305 TAGACAGTGCCCATGCCCATTGG - Intronic
1010233694 6:73557591-73557613 TTGGCTGTGCCCAGGGTGCTCGG + Intergenic
1023856182 7:44185686-44185708 CTGCCTGTGCCCAGGCCTCTGGG - Intronic
1036632318 8:10524459-10524481 AAGGCAGTGCCCAGGCTGCTTGG + Intergenic
1049587506 8:143438847-143438869 TAGCCTGGGCCCTGGCTGCTGGG - Intronic
1058514661 9:105758091-105758113 TCGCCACTGCCCAGGCCGCTGGG + Intronic
1061398318 9:130355262-130355284 CTGACTGTGCCCAGGACCCTGGG + Intronic
1061919405 9:133774487-133774509 CAGACTGTGCCAAAGCCGCAAGG + Intronic
1195614906 X:106904250-106904272 AGGACTGTGCTCAGGCCTCTGGG - Intronic