ID: 1091699677

View in Genome Browser
Species Human (GRCh38)
Location 12:2651417-2651439
Sequence CTAGACTGTGCCCAGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091699677_1091699687 25 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93
1091699677_1091699683 1 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699683 12:2651441-2651463 TCTGCAGAGACCATGGGGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 286
1091699677_1091699682 0 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699682 12:2651440-2651462 CTCTGCAGAGACCATGGGGCTGG 0: 1
1: 0
2: 4
3: 32
4: 390
1091699677_1091699681 -4 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699681 12:2651436-2651458 CTAGCTCTGCAGAGACCATGGGG 0: 1
1: 0
2: 2
3: 28
4: 200
1091699677_1091699686 22 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699686 12:2651462-2651484 GGCTGTCCACTCATTAAAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1091699677_1091699685 21 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699685 12:2651461-2651483 GGGCTGTCCACTCATTAAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 65
1091699677_1091699680 -5 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699680 12:2651435-2651457 TCTAGCTCTGCAGAGACCATGGG 0: 1
1: 0
2: 0
3: 10
4: 151
1091699677_1091699679 -6 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699679 12:2651434-2651456 GTCTAGCTCTGCAGAGACCATGG 0: 1
1: 0
2: 2
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091699677 Original CRISPR CTAGACTGTGCCCAGGCCGC TGG (reversed) Intronic
902361817 1:15946088-15946110 CTACCCTGTGCCCAGGCTGCTGG + Intronic
905268341 1:36770336-36770358 CTAGACGTTGCCCAGGTTGCTGG - Intergenic
911445252 1:97984445-97984467 CCAGATTCTGCCCAGGCCCCAGG + Intergenic
916172601 1:162011866-162011888 CTAAACTGTTCCTAGGCCGACGG + Intronic
918105606 1:181413163-181413185 GTGGACTGAGCCCAGACCGCAGG + Intronic
918308381 1:183267685-183267707 CAGGAGTGTGCCCAGGCCTCTGG + Intronic
920372074 1:205485440-205485462 CCAGACTGAGGCCAGGCCACTGG - Intergenic
1070589938 10:77794493-77794515 TGGGACTGTGCCCAGGCCACTGG + Intronic
1070827683 10:79400743-79400765 CCAGCCAGTGCCCAGGCCCCAGG - Intronic
1071600245 10:86955474-86955496 CTAGGCTGGGCCCAGGATGCAGG - Intronic
1072451538 10:95543003-95543025 CTAGACTATGCCCATGCTGCAGG + Intronic
1072754691 10:98011448-98011470 CTTGACAGTGCCTAGGCTGCTGG + Intronic
1073300654 10:102469247-102469269 CTAGAGGCTGCCCAGGCTGCTGG + Intronic
1076901828 10:133343135-133343157 GGAGGCTGTGCTCAGGCCGCGGG + Intronic
1083052180 11:59787298-59787320 CTTGACTGTGGCCAGGCAGTAGG - Intronic
1083282160 11:61633782-61633804 CCAGAGTGAGCCCAGGCAGCTGG - Intergenic
1083781627 11:64921397-64921419 CCAGGCTTTGCCCAGGCCGGGGG + Intronic
1085711552 11:78833569-78833591 CCAGACTGTGGCCAGGCAGAGGG - Intronic
1089050490 11:115540857-115540879 GTAGACGGTGCACAGGCAGCTGG - Intergenic
1091699677 12:2651417-2651439 CTAGACTGTGCCCAGGCCGCTGG - Intronic
1092261107 12:6953759-6953781 CTAGCCTGTCCCCAGGCGGTGGG + Intronic
1092945231 12:13448156-13448178 CTCGACTGTGGCAAGGCCCCTGG + Intergenic
1093114276 12:15190397-15190419 ATATGCTGTGCACAGGCCGCAGG + Intronic
1102586066 12:113923823-113923845 CTAGACTGTGTGCATGCTGCGGG + Intronic
1108247490 13:48532694-48532716 CTACATCCTGCCCAGGCCGCCGG - Intronic
1108247508 13:48532776-48532798 CTACACCCAGCCCAGGCCGCAGG - Intronic
1116435032 14:44887080-44887102 CTTTACTGTGGCCAGGCGGCAGG - Intergenic
1118780465 14:69004448-69004470 CTTGCCTGTGCCTAGGCCTCTGG - Intergenic
1120852886 14:89186995-89187017 CTGGACTGTGGCCAGTCTGCCGG + Intronic
1120916514 14:89715277-89715299 CTAGACTGTGGCCAAACCCCAGG - Intergenic
1124325261 15:28754676-28754698 CAAGACTGCGCCCAGACTGCAGG - Intergenic
1129032304 15:72628341-72628363 CTAGCATGTGCCCAGGCCCAGGG - Intergenic
1129217592 15:74108898-74108920 CTAGCATGTGCCCAGGCCCAGGG + Intronic
1129407067 15:75327087-75327109 CTAGCATGTGCCCAGGCCCAGGG - Intergenic
1129734753 15:77953199-77953221 CTAGCATGTGCCCAGGCCCAGGG + Intergenic
1129840837 15:78742792-78742814 CTAGCATGTGCCCAGGCCCAGGG - Intergenic
1131062065 15:89410410-89410432 CCAGACTGGACTCAGGCCGCAGG + Intergenic
1131443673 15:92477699-92477721 CTTCACTGTGCCCAGGCTTCAGG + Intronic
1132373914 15:101316008-101316030 CACGACTGTGCCCAGGCCCCTGG + Intronic
1132859152 16:2061540-2061562 CTTGGCTGTGCCCATGCAGCTGG - Intronic
1136276046 16:29180072-29180094 CTGGACTGTGCCCAAGGAGCTGG - Intergenic
1142080421 16:88146134-88146156 CTGGACTGTGCCCAAGGAGCTGG - Intergenic
1142764199 17:2056534-2056556 TTCGCCGGTGCCCAGGCCGCAGG + Intronic
1143391948 17:6564274-6564296 ATAGACTGTGCCCAGACTGGGGG - Intergenic
1144777172 17:17790820-17790842 CGGGCCTGTGCCCAGGCCGAGGG - Intronic
1147705301 17:42421822-42421844 CCAGACTGCGCCCAGACCGCCGG + Intronic
1148264762 17:46216818-46216840 CGCCACTGTGCCCAGGCCCCTGG - Intronic
1148566025 17:48633562-48633584 CTGGACTGGGCCGCGGCCGCTGG - Intronic
1149495882 17:57117148-57117170 CTAGACTGTACTCAGACCTCAGG + Intronic
1151491876 17:74436691-74436713 CTAAACTGGGCCCTGGCCGAGGG + Intronic
1156500444 18:37554179-37554201 CCAGACAGTTCCCAGGCCCCCGG - Intronic
1157637981 18:49181041-49181063 CTAGCCTGAGTCCAGGCTGCAGG + Intronic
1160578603 18:79871093-79871115 CTAGCCTGTGGCCAGGCAGGAGG + Intronic
1160914199 19:1489038-1489060 CTAGACAGGGCCCAGCCCGATGG + Intronic
1162391578 19:10393280-10393302 CTCGACGGGGTCCAGGCCGCCGG + Exonic
1164624241 19:29715629-29715651 CTCTTCTGTGCCCAGGCTGCGGG - Intronic
1165309345 19:35021232-35021254 GTAGACAGGGCTCAGGCCGCCGG + Intronic
1165951344 19:39475466-39475488 CTAGACTGTCCAGAGGGCGCCGG + Intronic
925832230 2:7907217-7907239 CTCGCCTGTGCCCAGCCGGCCGG + Intergenic
927135481 2:20093503-20093525 CAGGACTGTGCCCAGGCTGTGGG + Intergenic
946476409 2:220010673-220010695 TAAAACTGTGCCCAGGCCTCAGG + Intergenic
948113190 2:235473422-235473444 CCAGGCTGAGCCCAGGCTGCTGG + Intergenic
948951509 2:241255270-241255292 CTGCACTGTGTCCAGGCCCCAGG + Intronic
1171377239 20:24701834-24701856 CCAGCATGTGCCCAGGCCCCTGG + Intergenic
1175860319 20:62147048-62147070 CTAAACTGTACCCAGACCCCTGG - Intronic
1176000070 20:62827691-62827713 CTCGACTGAGCCCTGGCAGCCGG + Intronic
1176385135 21:6135338-6135360 CGCCACTGTGCCCAGGCCCCTGG + Intergenic
1178672379 21:34603317-34603339 GAAGGCTGTCCCCAGGCCGCAGG - Intronic
1179628041 21:42659564-42659586 CTATGCTGTGCCCAGGCCTGAGG - Intronic
1179738338 21:43402914-43402936 CGCCACTGTGCCCAGGCCCCTGG - Intergenic
1180955127 22:19738048-19738070 CTAGGCCCTGCCCTGGCCGCCGG - Intergenic
1181323484 22:22026246-22026268 GCAGACTGTGCCCAGGACCCTGG - Intergenic
1184569706 22:45314442-45314464 CCAGACAATGCCCAGGCCGGTGG + Intronic
1185182525 22:49371675-49371697 CTCGAGTGTGCCCAGGCTGAAGG - Intergenic
1185208056 22:49551531-49551553 CTTGCCAGTGCCCAGGCCCCAGG + Intronic
949401169 3:3666477-3666499 ACAGACTGTGCCCAGGCTGGTGG - Intergenic
950197181 3:11017393-11017415 CCAGACGTTGCCCAGGCCGATGG - Exonic
952282696 3:31938813-31938835 CTCGACTTTGCCCAAGCCTCAGG + Intronic
952904975 3:38133887-38133909 CTTTACTGGGCCCAGGCCCCAGG - Intronic
960617102 3:119606036-119606058 CTAGACTGAGGCTAGTCCGCAGG + Intronic
967652073 3:191998174-191998196 CTTGACTTTGCCCAGGCATCAGG - Intergenic
968570951 4:1340450-1340472 CTAGACTCAGCCCAAGCCGCAGG - Intergenic
969452370 4:7281931-7281953 CTGGCGTGTGCCCAGGCAGCTGG - Intronic
976002546 4:80388456-80388478 CGAGACTGTGTCCAGGTCGGGGG + Intronic
980237787 4:130131445-130131467 CAAGACTGTTCCCAGGCAGTGGG - Intergenic
1000924726 5:167179815-167179837 CAAGACTGTGCCCAAACCACAGG - Intergenic
1017067942 6:150547632-150547654 CTTGTCTGTGTCCAGGCAGCTGG + Intergenic
1017931746 6:158961521-158961543 CTAGACTCTGACCATGCCACGGG + Intergenic
1022521072 7:31007185-31007207 CTAGACTGTAGCCAGGAAGCCGG - Intergenic
1023045786 7:36209001-36209023 CTAGACTGGTCTCAGGCCTCAGG + Intronic
1023600820 7:41880316-41880338 CTGGACTCTGTCCAGGCCTCTGG - Intergenic
1025190573 7:56892746-56892768 CAGGACTGTGCCCAGGCTGCAGG + Intergenic
1025681379 7:63684230-63684252 CAGGACTGTGCCCAGGCTGCAGG - Intergenic
1029271455 7:99379585-99379607 CTAGACTAGGCACAGGCTGCGGG - Intronic
1029582768 7:101448283-101448305 CCAGGCTGAGCCCAGGCCCCCGG - Intronic
1033842797 7:145395532-145395554 CTTGACTTTGCCCTGGCCTCAGG - Intergenic
1035579008 8:728227-728249 CAAGACTCCGCCCAGGCAGCAGG + Intronic
1036662390 8:10716547-10716569 CCATACTGTGACCAGGCTGCAGG - Intergenic
1037905577 8:22714159-22714181 CCAGACGGTGCCCAGGTCGGAGG + Intronic
1039410924 8:37354462-37354484 CTAGACTGTGACCACACCCCAGG + Intergenic
1040512032 8:48104666-48104688 CTAGACTGTGCCTAGCCTTCTGG + Intergenic
1050400418 9:5247867-5247889 CTAGTCTGTTTCCAGGCAGCCGG - Intergenic
1057223008 9:93267894-93267916 CTCCCCGGTGCCCAGGCCGCAGG - Exonic
1058514660 9:105758090-105758112 CTCGCCACTGCCCAGGCCGCTGG + Intronic
1058801495 9:108548760-108548782 CTATATTGTGCCCAGGCCTGGGG - Intergenic
1061398317 9:130355261-130355283 CCTGACTGTGCCCAGGACCCTGG + Intronic
1185633159 X:1531460-1531482 CCTGACTGTGCCCAGCCCGAGGG + Intronic
1185866112 X:3625438-3625460 CTAGTTTGTGCCCAGGGGGCTGG + Intronic
1189195357 X:39147915-39147937 CTAGATTGTGCCCTGGCAGTTGG + Intergenic
1198451012 X:136767258-136767280 CAAGCCTGTGCCAAGGCTGCGGG + Intronic
1200779747 Y:7203782-7203804 CTATTCTGTGCCCAGGTAGCTGG - Intergenic
1200797715 Y:7356891-7356913 CTAGTTTGTGCCCAGGGGGCTGG - Intergenic