ID: 1091699678

View in Genome Browser
Species Human (GRCh38)
Location 12:2651424-2651446
Sequence TGCAGAGCTAGACTGTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091699678_1091699687 18 Left 1091699678 12:2651424-2651446 CCTGGGCACAGTCTAGCTCTGCA 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93
1091699678_1091699682 -7 Left 1091699678 12:2651424-2651446 CCTGGGCACAGTCTAGCTCTGCA 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1091699682 12:2651440-2651462 CTCTGCAGAGACCATGGGGCTGG 0: 1
1: 0
2: 4
3: 32
4: 390
1091699678_1091699685 14 Left 1091699678 12:2651424-2651446 CCTGGGCACAGTCTAGCTCTGCA 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1091699685 12:2651461-2651483 GGGCTGTCCACTCATTAAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 65
1091699678_1091699683 -6 Left 1091699678 12:2651424-2651446 CCTGGGCACAGTCTAGCTCTGCA 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1091699683 12:2651441-2651463 TCTGCAGAGACCATGGGGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 286
1091699678_1091699686 15 Left 1091699678 12:2651424-2651446 CCTGGGCACAGTCTAGCTCTGCA 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1091699686 12:2651462-2651484 GGCTGTCCACTCATTAAAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091699678 Original CRISPR TGCAGAGCTAGACTGTGCCC AGG (reversed) Intronic
900936342 1:5768590-5768612 TGCAGAGCCAGAATCTGCACTGG + Intergenic
904472884 1:30746724-30746746 TGCAGAGCTCGGCTGGGGCCTGG - Intronic
906609119 1:47190023-47190045 TCCAGGGCCAGACTGAGCCCAGG - Exonic
908429384 1:64041116-64041138 AGCATAGCTAGACTGTACACAGG - Intronic
912759167 1:112351246-112351268 TGTAGAGCTAGACTTTGTCTTGG - Intergenic
916824179 1:168428481-168428503 TGCAAAGCCACACTGTGCTCCGG - Intergenic
918044895 1:180935724-180935746 TGCGGAGGTGGACTCTGCCCTGG + Exonic
920373229 1:205492627-205492649 TGCAGAGCTAGGCTGGCCCCTGG + Intergenic
922480637 1:225938165-225938187 GGCAGAGCTAGATGGAGCCCAGG + Intronic
923047889 1:230368820-230368842 TGCAGAGGTAGGGTGTGCGCTGG + Intronic
924015149 1:239713065-239713087 TGCAGAAGCAGATTGTGCCCGGG - Intronic
1063012390 10:2036918-2036940 AGAAGAGCCAGACTGTGCACTGG + Intergenic
1063880712 10:10529142-10529164 TGCATTGCTAGACTCTGCCCAGG - Intergenic
1063925691 10:10975134-10975156 GACAGAGCAAGACTGTGCCTTGG - Intergenic
1065552616 10:26884437-26884459 TGCAGAGGAAGAATGTGCCATGG + Intergenic
1066676364 10:37891667-37891689 TGCAGAACTACATTGGGCCCAGG - Intergenic
1067699006 10:48555435-48555457 TGCAGAGCTGGAAGGTGCTCAGG + Intronic
1069751351 10:70747318-70747340 GGCAGAGCCAGTCTGGGCCCAGG + Intronic
1070737236 10:78871616-78871638 GGCAGAGCAAGTCTGGGCCCAGG - Intergenic
1071347055 10:84702677-84702699 TGCTGAGCTTGACTGTGTCTTGG + Intergenic
1071777028 10:88800581-88800603 TGCCTAGCTAGACTGTGGCAAGG - Intergenic
1072754690 10:98011441-98011463 TGGAGAGCTTGACAGTGCCTAGG + Intronic
1074093807 10:110289485-110289507 TACAGTGCTATTCTGTGCCCTGG - Intergenic
1074889157 10:117720838-117720860 TACTGGGCTAGTCTGTGCCCTGG + Intergenic
1077247000 11:1544540-1544562 CACAGAGCTAGCCTGTGCACAGG + Intergenic
1077311467 11:1890742-1890764 TGCTGAGCTCGACTGTGCCTTGG + Exonic
1077991437 11:7415563-7415585 TGCAGAGCTACCCTGGGCCGTGG + Intronic
1078071300 11:8113345-8113367 TGCAGAGCTGGACTGAGGCCTGG - Intronic
1078175176 11:8964599-8964621 TGCAAAGCTCTACTGGGCCCAGG - Exonic
1081569675 11:44281865-44281887 TGCAGAGACAGACAGTGTCCCGG + Intronic
1083688034 11:64389008-64389030 TGGAGAGCTTGTTTGTGCCCCGG + Intergenic
1086812985 11:91334282-91334304 AGCAGAGGTAAACTGTGTCCTGG - Intergenic
1087184180 11:95169108-95169130 AGCAGACCTAGAATCTGCCCAGG - Exonic
1089554062 11:119305299-119305321 TCCAGAGCTAGCCTGTTCCTGGG + Exonic
1091110533 11:132962359-132962381 TGCAGACCAAGAGTGTGCCTGGG + Intronic
1091276727 11:134357814-134357836 TGCAGAGCTAGGCTGGGAGCAGG - Intronic
1091699678 12:2651424-2651446 TGCAGAGCTAGACTGTGCCCAGG - Intronic
1094215212 12:27933349-27933371 TGCTGATCTAGACTGTGCACAGG + Intergenic
1095971330 12:47903952-47903974 AGCAGAGCTGAACTCTGCCCAGG + Intronic
1096284178 12:50283697-50283719 TGCCGAGGTAGACTAGGCCCCGG - Intergenic
1097188496 12:57208456-57208478 TGCACAGCCACACTCTGCCCTGG + Intronic
1098274865 12:68803207-68803229 GGCAGAGCAAGACTCTGTCCTGG - Intergenic
1099038033 12:77614327-77614349 TGAAGAGGTTGTCTGTGCCCAGG - Intergenic
1100053092 12:90474723-90474745 TGCAAAGATAGACTGTGTCTGGG + Intergenic
1102332883 12:112050200-112050222 TGCAGAGCTAGACAAGGGCCTGG + Intronic
1108802944 13:54121626-54121648 TGCAGAGGTATACTGAGACCAGG - Intergenic
1110060620 13:71033952-71033974 TGCATTGCTGGACTGTGCCAGGG - Intergenic
1112122629 13:96430445-96430467 TGGAGGGCCAGACAGTGCCCAGG - Intronic
1112490095 13:99855031-99855053 TCCAGAGGTGGACTCTGCCCAGG - Intronic
1116473588 14:45313971-45313993 TGCAGAGCTACCTTGTTCCCTGG + Intergenic
1119749420 14:77066959-77066981 TGCACAGGCAGACTGGGCCCTGG - Intergenic
1123087107 14:105721749-105721771 TGCACAGCTGGACGGAGCCCTGG + Intergenic
1124361868 15:29042994-29043016 TGCAGAGGTAGACTTTGCCAAGG + Intronic
1127998647 15:64170813-64170835 AGCCGAGCCAGACTGTGACCAGG - Exonic
1128159087 15:65411263-65411285 TGCAGTGCTAAACTGTAGCCTGG - Exonic
1128847475 15:70913415-70913437 TGCAGAGCCAGACAATTCCCAGG - Intronic
1129661751 15:77556619-77556641 TGCAGAGGGAAACTGGGCCCAGG - Intergenic
1130221315 15:82021924-82021946 TGCAGGGCAAGACTGAGCCCAGG - Intergenic
1131116970 15:89801752-89801774 GGCAGAGCTGGACGGTACCCTGG - Intronic
1131595093 15:93790196-93790218 TGCAGAGCCAGACCCTGCCAGGG - Intergenic
1134598559 16:15515211-15515233 CGCAGAGCAAGGCTGTGCCCTGG + Intronic
1135665249 16:24330215-24330237 TGCAGAGCTGGTCTGTACCTTGG - Intronic
1136385075 16:29919547-29919569 TGAAGATCTAGACTGGACCCTGG + Intronic
1137669332 16:50270359-50270381 GGCAGAACTGGACTGTGCTCTGG + Intronic
1137867498 16:51915815-51915837 TGTAGACCTTGACTTTGCCCTGG - Intergenic
1141762604 16:86038664-86038686 TGCAGAGCTTCCCTGTGCCATGG + Intergenic
1142813386 17:2407108-2407130 TGCAGAGCTCGACTGGGCTCTGG - Intronic
1142888158 17:2926158-2926180 AGCAGAGCAAGGCTGAGCCCTGG + Intronic
1143178511 17:4970016-4970038 TGCAGAGAGAAACTCTGCCCAGG + Exonic
1143896647 17:10141656-10141678 GGCAGAGCTGGAATGTGCCCTGG - Intronic
1144702139 17:17346942-17346964 TGCTGAGCTGGACTGTGCTTCGG + Exonic
1145392880 17:22469645-22469667 TGCAGGGCTGGACTGAGCACTGG + Intergenic
1146633716 17:34488774-34488796 GTCAGAGCTAGATTGAGCCCAGG + Intergenic
1147134541 17:38427666-38427688 TGCAGAGCAGGACTGTGGGCTGG + Intergenic
1147232563 17:39029893-39029915 TGCTGAGCTTGACAGTGACCTGG - Intergenic
1147445936 17:40475370-40475392 TGAAGAGCTGGACTGTGGTCGGG - Intergenic
1149493683 17:57103164-57103186 TGCAGGGCTAGGCAGTGGCCAGG - Intronic
1149685361 17:58531805-58531827 AGCAGTGCCAGCCTGTGCCCGGG + Intronic
1155580321 18:27297702-27297724 TGTGAAGCTAGCCTGTGCCCTGG + Intergenic
1157289776 18:46401127-46401149 GGCACAGGAAGACTGTGCCCTGG + Intronic
1157623163 18:49027583-49027605 GGCAGAGCTGGACTTTGTCCTGG + Intergenic
1159047551 18:63383735-63383757 TGCAGAGTTAAACGGGGCCCTGG + Intergenic
1159609927 18:70513746-70513768 AGCTGAGCTGGGCTGTGCCCTGG + Intergenic
1160188080 18:76691146-76691168 TGCTGAGAAAGTCTGTGCCCAGG - Intergenic
1162066106 19:8126330-8126352 TGCAGACCCTGCCTGTGCCCGGG - Exonic
1162877756 19:13633405-13633427 TGCATAACTAGACTTTGCCCAGG - Intergenic
1163777923 19:19228654-19228676 TGGAGAGCTGGACAGAGCCCCGG - Intronic
1163844365 19:19630014-19630036 TGGACAGCGAGGCTGTGCCCAGG - Exonic
1165140581 19:33697645-33697667 TTCAGAGCTAGGATGTGGCCTGG + Intronic
1167031873 19:46967689-46967711 GGCAGAGCTAGACAGTGGGCAGG - Intronic
1167567666 19:50267098-50267120 GGCTGAGCCAGCCTGTGCCCAGG + Intronic
1168148205 19:54430991-54431013 TGCAGAGCTAGGCGGGGCCTTGG + Intronic
1168270387 19:55246680-55246702 TGCAGACCAAGCCTGTGCTCTGG - Intronic
926200139 2:10789237-10789259 GGCAGAGCCAGGCTGTGTCCAGG - Intronic
926982808 2:18589539-18589561 TGCAAAGCTAGACTGAGCAAGGG - Exonic
927246177 2:20958611-20958633 TTCAGAGCTAGACAGACCCCAGG + Intergenic
927455048 2:23241980-23242002 TGCAGAGCTAGGGGGTTCCCTGG + Intergenic
927587822 2:24324586-24324608 TGAAGTGCTGGGCTGTGCCCAGG - Intronic
928249219 2:29660193-29660215 TGCAGAGTCTGACTGGGCCCTGG - Intronic
930245549 2:48979854-48979876 TGCTGATCTTGACTGTGCCTTGG - Intronic
932557707 2:72840159-72840181 TGCAGAGTTACCCTGTCCCCTGG + Intergenic
933788666 2:85865773-85865795 TGCTGAGCCAGACAGTGCTCTGG + Intronic
934056880 2:88258561-88258583 TGGAGAGCATGGCTGTGCCCAGG - Intergenic
934766843 2:96884467-96884489 TGGATACCTAGACCGTGCCCCGG - Intronic
937760847 2:125601942-125601964 AGAAGAGCTTGACTGTGCCAAGG - Intergenic
938501356 2:131832660-131832682 TGCCAAGCTAGAATGTTCCCAGG - Intergenic
942508723 2:176672789-176672811 TGAGGAGCTTGACTGTGGCCTGG - Intergenic
945188445 2:207163508-207163530 TGCAGATCTAGAGTTTGTCCTGG + Intronic
946431626 2:219629556-219629578 TGCAGACATAGAATGTGCCCTGG - Intronic
947435408 2:230068377-230068399 TGGAGGGCGAGACTGTGCCGGGG - Intronic
948588360 2:239035184-239035206 GGCAGTGGTGGACTGTGCCCTGG + Intergenic
949007366 2:241657314-241657336 TACAGAGCTAGACTCTGTCTCGG - Intronic
1169348914 20:4852345-4852367 TGAAGAGCAAAACTGTGTCCAGG + Exonic
1169931906 20:10842746-10842768 TACAGAGCTAGACTGGGCTGGGG + Intergenic
1174962752 20:55176664-55176686 GGCAGAGCTGGACAGAGCCCAGG + Intergenic
1179639513 21:42738113-42738135 AGCAGAGCTGCCCTGTGCCCTGG - Intronic
1179802171 21:43816281-43816303 GGCTGAGCTGGGCTGTGCCCTGG - Intergenic
1179910387 21:44444355-44444377 TGCTGAGCCTGTCTGTGCCCTGG + Intergenic
1180902757 22:19386548-19386570 TGCAGGGCTTGAATGTGGCCAGG + Intronic
1181019236 22:20090107-20090129 TGCAGAGCTGGAGTTTCCCCTGG + Exonic
1182565752 22:31197646-31197668 GGCTGAGGTAGACTGAGCCCAGG - Intronic
1182664373 22:31946241-31946263 TCCAGACCTAGACCGTCCCCCGG - Intronic
1185376449 22:50484658-50484680 TGCCAAGCTGGACTTTGCCCAGG - Exonic
952876164 3:37946321-37946343 TCCAGGGCAATACTGTGCCCTGG - Intronic
953912506 3:46900063-46900085 TGCAGAGCTTGGCTGGGCTCCGG + Intronic
954954703 3:54508789-54508811 TGCAAAGCTACATTGTGCTCAGG + Intronic
961336681 3:126184539-126184561 TGCAGAGAGAGCCTCTGCCCGGG + Intronic
961364922 3:126393591-126393613 TGCAGAGGTAGGCTGGGGCCGGG + Intergenic
962922501 3:139963824-139963846 TGCTGTGCAAGACTCTGCCCAGG - Intronic
962994682 3:140614163-140614185 TGGAAAGCTGGATTGTGCCCAGG - Intergenic
963301477 3:143601955-143601977 TGCAGAGCAAGTCTGAGCCAGGG - Intronic
964546606 3:157840474-157840496 CCCAGAGCTAGACAGTGCCTAGG + Intergenic
966354673 3:179067563-179067585 AGGGGAGCAAGACTGTGCCCTGG - Exonic
968960337 4:3740061-3740083 TGCAGAGCCCACCTGTGCCCAGG - Intergenic
971240682 4:24886104-24886126 GGCAGAGCCAGACTGTTACCTGG + Intronic
971312025 4:25533421-25533443 TGCAGTGCTTGACTGTTCCCTGG + Intergenic
972981130 4:44703356-44703378 TGCAGATCTAGAATGTGTACAGG + Intronic
977615829 4:99086988-99087010 TGCAAAGCTATGCTGTGCCAAGG - Intronic
980195480 4:129582883-129582905 TGCAGTGCTGTACTGTGGCCTGG + Intergenic
985851286 5:2390738-2390760 CACAGGGCTACACTGTGCCCTGG - Intergenic
986684323 5:10262573-10262595 TGCTGAGATATCCTGTGCCCTGG + Exonic
988935611 5:36079584-36079606 TGTACAGCTACACTGTGGCCGGG - Intergenic
996135098 5:119831965-119831987 TGCAGAGACAGAATCTGCCCTGG - Intergenic
999126509 5:149250142-149250164 TCCAGAGCCAGCCTGTGGCCAGG + Intronic
1003185118 6:3823687-3823709 AGCAGTGCTGGACTGGGCCCTGG + Intergenic
1006874686 6:37285190-37285212 TGCATAGTTAGACTGGGCACTGG + Intronic
1010857785 6:80863221-80863243 TGCAGAGCCAGGCTGGGCCCAGG + Intergenic
1013609659 6:111782582-111782604 TGAACAGCTAGTCTGTTCCCAGG - Intronic
1016273103 6:142313628-142313650 TCCAGAACTATGCTGTGCCCTGG - Intronic
1017208851 6:151833204-151833226 TGGAGAGGCAGACTGTGGCCAGG + Intronic
1017322092 6:153106060-153106082 TGAAGAGGTAGACTGAGCCCTGG + Intronic
1018928589 6:168224211-168224233 TGGACAGCCAGGCTGTGCCCAGG + Intergenic
1019201249 6:170317990-170318012 TGCAGAGCATGACGGTGTCCAGG - Exonic
1019919075 7:4151286-4151308 TGCAGAGGGTGACTGTGCCAGGG - Intronic
1022472169 7:30688703-30688725 TGCAGAGCTGCACAGAGCCCTGG - Intronic
1023594473 7:41814696-41814718 TGCAGAGTCAGCCTTTGCCCTGG - Intergenic
1023610180 7:41964859-41964881 TGCAGAGCAAGGCTGTCCCTCGG + Exonic
1023939215 7:44759383-44759405 TGCAGGGGCAGCCTGTGCCCAGG - Exonic
1023982104 7:45076277-45076299 TGCAGGGCTTGGCTGAGCCCTGG - Exonic
1026041213 7:66869595-66869617 AACAGAGCAAGACTGTGCCTCGG + Intergenic
1026099862 7:67375888-67375910 GGCAGAGCAAGACTCTGCCTTGG - Intergenic
1028417765 7:90597131-90597153 TGAAACGTTAGACTGTGCCCTGG + Intronic
1029109552 7:98205675-98205697 TGCAGAGCGAGGCCGTGTCCAGG + Exonic
1029582771 7:101448290-101448312 TCCAGAGCCAGGCTGAGCCCAGG - Intronic
1031996528 7:128235601-128235623 TGTAGAGCTGGACCCTGCCCAGG - Intergenic
1032582828 7:133118893-133118915 GCCACTGCTAGACTGTGCCCTGG + Intergenic
1034757786 7:153639429-153639451 TGCAGAGCTGGACGATGCTCAGG - Intergenic
1035761729 8:2073525-2073547 TGCAGACCTTGTGTGTGCCCGGG + Intronic
1041758156 8:61336399-61336421 TGCAGAGCCAGACTGCAGCCTGG + Intronic
1047358802 8:124148387-124148409 AGCAGTGCTACATTGTGCCCAGG + Intergenic
1047424028 8:124729226-124729248 TGCAGAGCGCAAATGTGCCCAGG + Intergenic
1049043930 8:140134283-140134305 GACAGAGCAAGACTCTGCCCCGG - Intronic
1049240758 8:141536370-141536392 TGCAGAGCTCCACAGGGCCCAGG - Intergenic
1053282989 9:36833140-36833162 TGCAGAATTGGGCTGTGCCCTGG - Intergenic
1058082550 9:100715192-100715214 TGCCGAGCTTGTCTGTGCTCAGG + Intergenic
1059285097 9:113165704-113165726 TCCAGTGCTCAACTGTGCCCCGG - Exonic
1059614281 9:115931974-115931996 TGCAGAGGTAGGGTGGGCCCTGG - Intergenic
1060189589 9:121583580-121583602 AGCAAAGCCAGCCTGTGCCCAGG - Intronic
1060197303 9:121632016-121632038 TGGAGAGCTGAACTGAGCCCAGG + Intronic
1060403980 9:123363942-123363964 TGCAGACTCAGACTCTGCCCTGG - Intronic
1061218620 9:129236226-129236248 GGCAGAGCCAGGCTGTGTCCTGG + Intergenic
1061300572 9:129702615-129702637 TACAGAGCTAGAGTGTGGACTGG + Intronic
1062672586 9:137720182-137720204 TCCATATCTCGACTGTGCCCTGG - Intronic
1193335622 X:80285293-80285315 TGCAGTCCTTGACTGAGCCCTGG + Intergenic
1195676278 X:107509410-107509432 TCCAGTGCTGGGCTGTGCCCCGG + Intergenic
1196403537 X:115341012-115341034 TTCAGATCTAGAGTGTGCACTGG + Intergenic
1200154329 X:153967333-153967355 TCCTGAGCAAGGCTGTGCCCCGG + Intronic