ID: 1091699684

View in Genome Browser
Species Human (GRCh38)
Location 12:2651451-2651473
Sequence GAGTGGACAGCCCAGCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 387}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091699684_1091699691 10 Left 1091699684 12:2651451-2651473 CCATGGGGCTGGGCTGTCCACTC 0: 1
1: 0
2: 4
3: 40
4: 387
Right 1091699691 12:2651484-2651506 GCGGCCGCCCTCCCATCGGAGGG 0: 1
1: 0
2: 1
3: 1
4: 58
1091699684_1091699690 9 Left 1091699684 12:2651451-2651473 CCATGGGGCTGGGCTGTCCACTC 0: 1
1: 0
2: 4
3: 40
4: 387
Right 1091699690 12:2651483-2651505 GGCGGCCGCCCTCCCATCGGAGG 0: 1
1: 1
2: 2
3: 4
4: 76
1091699684_1091699693 12 Left 1091699684 12:2651451-2651473 CCATGGGGCTGGGCTGTCCACTC 0: 1
1: 0
2: 4
3: 40
4: 387
Right 1091699693 12:2651486-2651508 GGCCGCCCTCCCATCGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 65
1091699684_1091699687 -9 Left 1091699684 12:2651451-2651473 CCATGGGGCTGGGCTGTCCACTC 0: 1
1: 0
2: 4
3: 40
4: 387
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93
1091699684_1091699692 11 Left 1091699684 12:2651451-2651473 CCATGGGGCTGGGCTGTCCACTC 0: 1
1: 0
2: 4
3: 40
4: 387
Right 1091699692 12:2651485-2651507 CGGCCGCCCTCCCATCGGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
1091699684_1091699689 6 Left 1091699684 12:2651451-2651473 CCATGGGGCTGGGCTGTCCACTC 0: 1
1: 0
2: 4
3: 40
4: 387
Right 1091699689 12:2651480-2651502 GTGGGCGGCCGCCCTCCCATCGG 0: 1
1: 0
2: 1
3: 15
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091699684 Original CRISPR GAGTGGACAGCCCAGCCCCA TGG (reversed) Intronic
900135132 1:1113816-1113838 GGGTGGACGGCCCACCCCGAGGG - Intronic
900288781 1:1915030-1915052 CAGCGGGCAGCCCAGCCCCCAGG + Exonic
900400310 1:2470344-2470366 GGGCAGCCAGCCCAGCCCCAGGG + Intronic
900525222 1:3125257-3125279 TAGCGGACGGCCCAGCCCCTGGG + Intronic
900610489 1:3542551-3542573 GAGTGGGGAGCCCAGGCCGAGGG + Intronic
900792000 1:4686953-4686975 AAGTGGGCAGCCCAACCTCACGG - Intronic
901193654 1:7427712-7427734 GAGAGGACAGCCCATCCCAGGGG - Intronic
901729229 1:11266798-11266820 ATGTGGACAGCCCACCCCAAGGG - Intergenic
902239126 1:15076612-15076634 GAGGGCACAGCCCAGACTCAGGG - Intronic
903397166 1:23010615-23010637 GAGTGAACAGCACAGGGCCAGGG + Intergenic
904359080 1:29960678-29960700 GGGTGGGCAGCGCAGACCCACGG - Intergenic
904943245 1:34179379-34179401 GAGAGCAGAGCACAGCCCCATGG - Intronic
907020194 1:51059584-51059606 GAGCTGACAGCCCAGCCCCCAGG - Intergenic
912044483 1:105437257-105437279 GAGCTGGCAGCCCAGCCCCAAGG - Intergenic
912940064 1:114036935-114036957 ATGTGGACAGCCCACCCCAAGGG - Intergenic
913367043 1:118050157-118050179 ATGTGGACAGCCCCACCCCAAGG + Intronic
914239834 1:145846060-145846082 CTGTGGGCAGCTCAGCCCCAGGG - Exonic
915701113 1:157797646-157797668 AATTTGACAGCCCATCCCCAGGG + Intronic
916438615 1:164799899-164799921 GAGAGGGCAGGACAGCCCCATGG - Intronic
917411988 1:174768592-174768614 ATGTGGACAGCCCACCCCAAGGG + Intronic
917854120 1:179087795-179087817 GGGTGGGGAACCCAGCCCCAGGG + Intronic
918074101 1:181156598-181156620 GAGAGGAAAGGTCAGCCCCATGG + Intergenic
918217954 1:182409418-182409440 GACTGGACAGCACAGCTCTAGGG - Intergenic
920403852 1:205694250-205694272 GAGAGGACAGGCCAACCTCAGGG - Intergenic
920879134 1:209864026-209864048 ATGTGGACAGCCCACCCCAAGGG - Intergenic
921522024 1:216167579-216167601 ACGTGGACAGCCCACCCCAAGGG + Intronic
922334641 1:224608763-224608785 ATGTGGACAGCCCACCCCAAGGG - Intronic
922630064 1:227097831-227097853 ATGTGGACAGCCCACCCCAAGGG + Intronic
922663521 1:227449979-227450001 CTGTGGACAGCCCACCCCAAGGG - Intergenic
922704190 1:227780369-227780391 GAGCCGGCAGCCCAGCACCAGGG - Intronic
922799230 1:228357075-228357097 TAGTGGACAGCACAGCCTTAGGG + Intronic
922892761 1:229074281-229074303 GAGTGGGCACCCCAGCCCACAGG + Intergenic
924392817 1:243581256-243581278 GAGCTCACTGCCCAGCCCCAGGG - Intronic
924820762 1:247488021-247488043 GAGATGGCAGACCAGCCCCAGGG - Intergenic
1063018847 10:2105589-2105611 ATGTGGACAGCCCACCCCAACGG - Intergenic
1063121734 10:3109483-3109505 GAGTGGGCAGCCCATGGCCAAGG + Intronic
1063545843 10:6980739-6980761 GGCAGGACAGGCCAGCCCCACGG - Intergenic
1064215557 10:13397364-13397386 CAGTGGACAGGCCACCCCAAAGG + Intergenic
1065041910 10:21705838-21705860 GTGTTGACAGCACAGCCACAGGG - Intronic
1066084450 10:31962704-31962726 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1066289342 10:33999572-33999594 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1067030262 10:42875088-42875110 GAGTTCCCAGCTCAGCCCCAGGG + Intergenic
1067047125 10:42991115-42991137 GGGTGCTCAGCCCAGCCTCAGGG + Intergenic
1067170040 10:43898752-43898774 GGGTGGCCAGCCCTGCCCCTTGG + Intergenic
1067173931 10:43929361-43929383 GAGTGCACATCACAGACCCAGGG + Intergenic
1067466257 10:46501555-46501577 GAGAGGGCAGTCCAGGCCCAGGG + Intergenic
1067620931 10:47883050-47883072 GAGAGGGCAGTCCAGGCCCAGGG - Intergenic
1067697008 10:48542806-48542828 CAGTGGACAGGCCACCCCCAAGG - Intronic
1069107157 10:64397270-64397292 CTGTGGACAGCCCATGCCCAAGG - Intergenic
1069615816 10:69805461-69805483 TATTGGACAGCCCAACCCTAGGG - Intronic
1069956184 10:72053444-72053466 AAGTGGACATCCCATCTCCAAGG + Intergenic
1070847322 10:79533952-79533974 ACGTGGACAGCCCACTCCCAGGG - Intergenic
1070926474 10:80226340-80226362 ACGTGGACAGCCCACTCCCAGGG + Intergenic
1072257962 10:93638852-93638874 GAGGGGTCAGCCCAGGCTCAGGG + Intronic
1072721940 10:97786633-97786655 GAGTAGACAGCCCTGCCTCGAGG - Intergenic
1074817265 10:117151788-117151810 GAGTGACCAGGCCAGCCTCATGG - Intergenic
1075007419 10:118840912-118840934 GAGTGGGCAGCTGAGCCGCAGGG - Intergenic
1075651428 10:124130193-124130215 GATGGGACAGCCCAGCCCAGAGG + Intergenic
1076746496 10:132517337-132517359 CAGTGGGCAGCCCAGGCCCAGGG - Intergenic
1076775778 10:132697286-132697308 CAGTGGATAGGCCAGGCCCAGGG - Intronic
1076923949 10:133471898-133471920 CAGAGAACAACCCAGCCCCAAGG - Intergenic
1077079761 11:719997-720019 GTGTCGAAAGCCCAGCCCCCAGG - Intronic
1077524809 11:3057606-3057628 GAGTAGTCAGCCCAGCCGCGGGG + Intronic
1078216825 11:9318690-9318712 ATGTGGACAGCCCATCCCAAGGG - Intergenic
1078549927 11:12272952-12272974 GGGTGTATAGCCCTGCCCCATGG - Intergenic
1079032634 11:16997087-16997109 GAGTGGAGTCCCCTGCCCCAAGG + Intronic
1079249762 11:18778942-18778964 GCATGGGCAGCCCAGGCCCAGGG - Intronic
1079503966 11:21133343-21133365 GAACTGACAGCCCAGCCCCCAGG + Intronic
1079998352 11:27320188-27320210 GAGTGGTCAGGGAAGCCCCAAGG - Intergenic
1080201823 11:29680493-29680515 GAGTGGACAGAACAGAGCCAAGG - Intergenic
1082942761 11:58725827-58725849 ATGTGGACAGCCCACCCCCATGG - Intronic
1083041188 11:59688882-59688904 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1083373730 11:62202969-62202991 GAGAGGACAGGTCAGCTCCAGGG + Intergenic
1083486788 11:62988245-62988267 GTGTAGACTGCCCAGCCCAAAGG + Intergenic
1083738202 11:64693791-64693813 AAGAGGACAGCCGAGCCCTATGG + Intronic
1083755373 11:64789253-64789275 GAATGGATGGCCCAGGCCCAGGG + Exonic
1083802905 11:65057249-65057271 GAGTGGGGAACCAAGCCCCAGGG - Intronic
1084030171 11:66476399-66476421 TGGAGGAAAGCCCAGCCCCATGG + Exonic
1084068766 11:66720473-66720495 GAGCGGAGAGCCCAGGCCCTGGG + Intronic
1084688297 11:70710207-70710229 GAGGGGACGGCACAGCCCCCAGG - Intronic
1084732853 11:71084530-71084552 GAATGGACAGCCCTGTCCCAGGG - Intronic
1085187443 11:74588436-74588458 GAGTGCCCAGCCCAACCCAATGG - Intronic
1085218842 11:74855512-74855534 GAGAGAACAGGCTAGCCCCATGG - Intronic
1086203748 11:84234127-84234149 ATGTGGACAGCCCACCCCGAGGG + Intronic
1086412492 11:86556579-86556601 GTGCTGACAGGCCAGCCCCACGG + Exonic
1086850137 11:91798964-91798986 GAAAGGGCAGCCCAGCCCCCAGG - Intergenic
1086947062 11:92853890-92853912 GAACTGACAGCCCAGCCCCCAGG + Intronic
1087338927 11:96878287-96878309 GAACTGACAGCCCAGCCCCCAGG + Intergenic
1087701892 11:101444269-101444291 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1087969488 11:104461823-104461845 GTGTGGACAGCACAGGCCAAGGG + Intergenic
1088626829 11:111735670-111735692 AAGTGGCGGGCCCAGCCCCAGGG + Intronic
1089146281 11:116331639-116331661 CAGTGGACAGTCCAGCAGCAGGG - Intergenic
1089638819 11:119833488-119833510 GAGTGGAGGGCCCAGGCCCATGG + Intergenic
1090629268 11:128632399-128632421 GAGGGGTCTGCCCAGGCCCAGGG - Intergenic
1090904288 11:131061050-131061072 GAGTGGACAGCCATGGGCCAAGG + Intergenic
1091304624 11:134529707-134529729 GCGTGCACGGCCCTGCCCCAGGG - Intergenic
1091699684 12:2651451-2651473 GAGTGGACAGCCCAGCCCCATGG - Intronic
1091752270 12:3030375-3030397 CACTGGACAGTCCAGCCCCCAGG - Intronic
1092575144 12:9774666-9774688 ATGCGGACAGCCCAGCCCAAGGG - Intergenic
1093525719 12:20102134-20102156 GAGCTGGCAGCCCAGCCCCCAGG + Intergenic
1096195601 12:49647164-49647186 GAGTGGACAGACCACCCAGAGGG - Intronic
1097192464 12:57226057-57226079 GAGTGCGCAGCCTAGCGCCAAGG - Exonic
1098569457 12:71972516-71972538 TAGTGGTCAGCCCATTCCCAGGG + Exonic
1101406925 12:104436916-104436938 GACAGGACAGCCCATCCCAAGGG - Intergenic
1101897667 12:108768601-108768623 GAGGGGACCGGCCAGTCCCAAGG - Intergenic
1103161463 12:118732806-118732828 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1104720300 12:131041642-131041664 GAGTGGATGGCCAAGCCCCTGGG - Intronic
1106298622 13:28441270-28441292 ATGTGGACAGCCCATCCCAAAGG + Intronic
1108483019 13:50894528-50894550 AAGTGGTCAGCCCACCCCAAGGG + Intergenic
1111043173 13:82778478-82778500 GTGAGGACAGCCCAGCCCAAGGG - Intergenic
1111476859 13:88761199-88761221 CAGCGGACAGCCCACCCCAACGG - Intergenic
1111525413 13:89461911-89461933 GAATTGAGAGCCCAGTCCCATGG + Intergenic
1113650044 13:112028279-112028301 GAGAGGACAGCCCAGCCAGAAGG + Intergenic
1113765001 13:112875712-112875734 GAGTAGAGAGGCCAGCCCCAGGG + Intronic
1113849838 13:113411861-113411883 GAGTGGCCAGGCCAGACCCAGGG - Intergenic
1113955607 13:114098683-114098705 GAGAGACCAGCCCAGACCCAGGG + Intronic
1115887884 14:37994094-37994116 ATGTGGACAGCCCATCCCAAGGG + Intronic
1116229796 14:42201979-42202001 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1120742350 14:88122065-88122087 GAGTGCAGAGCCCAGCCCCAGGG + Intergenic
1122036945 14:98955924-98955946 AAGTTGACAGCCCAGTCGCAAGG + Intergenic
1122397291 14:101442365-101442387 AAGTGGTCAGACGAGCCCCAGGG - Intergenic
1122633105 14:103116846-103116868 GTGCGGACAGCCCAGCCCAAGGG + Intergenic
1122826876 14:104374849-104374871 GCCTGGCCAGCACAGCCCCAGGG - Intergenic
1122994524 14:105255695-105255717 GAGTGGAAAGACCAACCCCAGGG - Intronic
1125142921 15:36431216-36431238 GAGTTCAAATCCCAGCCCCACGG - Intergenic
1126122624 15:45267378-45267400 GTGTGCCCACCCCAGCCCCAGGG - Intronic
1126755996 15:51925382-51925404 GAGTGGAGAGCCCAGCCTGCCGG + Intronic
1127358477 15:58224406-58224428 GAGTGGACAGCCCAGCAGCAAGG - Intronic
1128245062 15:66127438-66127460 GGGTGGATAGCCCAGCCCTAGGG - Intronic
1128692996 15:69739557-69739579 GAGGGCACAGACCAGCCCCCAGG + Intergenic
1129384452 15:75188261-75188283 GGGTGGAGAGCCCAGCTCCCTGG + Intergenic
1129393158 15:75230670-75230692 GAGTGGAGGGCCCTGCCCAAGGG + Intergenic
1129772695 15:78212905-78212927 GAATGGAGACCACAGCCCCAAGG - Intronic
1129869167 15:78929751-78929773 GAGTGCACAGCCCCACACCATGG + Intronic
1130542937 15:84835032-84835054 GAATGGACCCCACAGCCCCAGGG - Intronic
1130788275 15:87123917-87123939 GAGTGGAGAGCCAAGCAGCAAGG + Intergenic
1131661644 15:94523793-94523815 AAGTGGACAGCCCACCCCAAGGG - Intergenic
1132566362 16:625369-625391 GCATGGCCAGCCCAGGCCCAGGG - Intronic
1132865381 16:2090509-2090531 GGGTAGAGAGCCCAGTCCCAGGG + Exonic
1132882924 16:2170380-2170402 GAGCGGGCAGCCCAGCACCCCGG + Intronic
1133192961 16:4147780-4147802 GCTTGGACAGCCCTGCCCTACGG - Intergenic
1133321312 16:4915284-4915306 GAGCAGACAGGCCAGGCCCAAGG + Intronic
1134003821 16:10804144-10804166 GTGTGGATAGGCCAGCCCCACGG - Intronic
1134133881 16:11667531-11667553 GAGAGGACACCCCAGCCCTGGGG - Intergenic
1134256836 16:12619345-12619367 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1135986805 16:27189946-27189968 GAACTGACAGCCCAGCCCCCAGG - Intergenic
1136383343 16:29907218-29907240 GAGAGGCCAGGCCAGGCCCAAGG - Intronic
1136415405 16:30100160-30100182 CAGTGGACAGTCCTACCCCAGGG + Intergenic
1137753804 16:50885990-50886012 GAGGAGACAGCCCTGCCACAGGG - Intergenic
1138445524 16:57060923-57060945 GCCTGGACAGCAGAGCCCCACGG + Intronic
1138446934 16:57070467-57070489 GACAGGACAGCTCAGCTCCAGGG + Intronic
1138481358 16:57305477-57305499 GAGAAGCCAGGCCAGCCCCAGGG + Intergenic
1138988615 16:62362654-62362676 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1139434574 16:66928608-66928630 GAGTGAACAGCTGAGCCCCAGGG - Intergenic
1139483497 16:67243913-67243935 GATTGGATAGTCCAGCCCCAGGG + Intronic
1139590282 16:67929386-67929408 CAGTGGAGAACCAAGCCCCATGG + Exonic
1140993149 16:80233714-80233736 GTGTGGACAGCCCAAGGCCAAGG + Intergenic
1142105072 16:88298228-88298250 GAGTGGACAGCACAGCCCAGAGG - Intergenic
1142110522 16:88328694-88328716 GTGTGCACATCCCAGCCCCCCGG - Intergenic
1142336705 16:89494009-89494031 AGGTGGCCAGCACAGCCCCAAGG + Intronic
1143051278 17:4127991-4128013 GAGTGGACAGCCCAGGCCACCGG + Intronic
1143329068 17:6120707-6120729 GAGTGGGGAGCGCAGCCCCGTGG - Exonic
1144099748 17:11933038-11933060 GAGTGGGCTTCCCAGGCCCAAGG - Intronic
1144820154 17:18067149-18067171 GGAAGGACAGCACAGCCCCATGG - Exonic
1145203323 17:20966690-20966712 AAGTGGGCAGCCCTGACCCAGGG + Intergenic
1145302883 17:21653371-21653393 AAGTGGACACCCAGGCCCCATGG + Intergenic
1145347157 17:22048470-22048492 AAGTGGACACCCAGGCCCCATGG - Intergenic
1145781770 17:27568294-27568316 GAATGGACAGACCACCCCAAAGG + Intronic
1147371175 17:39994149-39994171 CAGTGGACAGGGCAGCCTCATGG + Intronic
1149304214 17:55332865-55332887 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1150931531 17:69590282-69590304 CACTGGACAGCCAAACCCCAGGG - Intergenic
1151051140 17:70979601-70979623 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1151233324 17:72700530-72700552 GAATGCACAGCCCTGCCCCCAGG + Intronic
1151343072 17:73484324-73484346 GGGTGGCCAGAGCAGCCCCATGG + Intronic
1151673861 17:75588294-75588316 TCGGGGACAGCCCAGCCCCTGGG - Intergenic
1152241403 17:79163213-79163235 GAGTGTGCTGCCCGGCCCCAAGG - Intronic
1152362930 17:79840683-79840705 GAGCGGACAGCGCGGCCCGAGGG + Intergenic
1152439094 17:80294464-80294486 GAGTGGAAAGCCCAGGGTCATGG - Intronic
1152591820 17:81217340-81217362 GAGTGGAAACCCCAGGCCAATGG + Intronic
1152637963 17:81437919-81437941 CAGTGGACAGCCCAGGCCAGGGG - Intronic
1152682323 17:81675062-81675084 GAGAGAACAGCACTGCCCCATGG - Intergenic
1152817333 17:82415759-82415781 GAGTGGACAGCGCTGGCCCCAGG - Intronic
1153218203 18:2839432-2839454 ATGCGGACAGCCCAGCCCAAGGG + Intergenic
1154112942 18:11585952-11585974 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1157336299 18:46739913-46739935 GAAGAGACAGCCCAGCTCCAGGG + Intronic
1157572379 18:48721530-48721552 TGGTGGGCAGCCCAGGCCCAGGG + Intronic
1158812935 18:61058660-61058682 GTGTGGACAGCCCACCCCAAGGG - Intergenic
1159189053 18:65017752-65017774 GAACTGACAGCCCAGCACCAGGG + Intergenic
1160105028 18:75965844-75965866 GTATGGACAGCCCACCCCAAGGG + Intergenic
1161864962 19:6826899-6826921 CAGGGGTCAGCCCAGACCCAGGG - Intronic
1163267028 19:16227703-16227725 CTGCCGACAGCCCAGCCCCAGGG - Intronic
1165141868 19:33704491-33704513 AAGTGGACAGACAGGCCCCAGGG + Intronic
1165236311 19:34424575-34424597 ATGTGGACAGCCCACCCCAAGGG - Intronic
1165351964 19:35280410-35280432 GAGTGGCAAGCCCAGCTCCTGGG - Intergenic
1165533423 19:36422587-36422609 CAGTGTAAAGCCCAGTCCCAGGG - Intergenic
1165926150 19:39327462-39327484 GAACGGGCAGCCCAGGCCCAAGG + Intergenic
1166392063 19:42413900-42413922 GAGAGGACGGCCCCTCCCCAGGG + Intronic
1167302026 19:48683536-48683558 AAGTGAACAGCCCACCCCAAGGG + Intergenic
1167903309 19:52638118-52638140 CCGGGGACAGCCCAGCCTCAGGG + Intronic
1168277051 19:55284290-55284312 GGGGGGCCAGCCCAGCCCCCTGG + Exonic
925854524 2:8116877-8116899 GTGTGGACAGCCCAGCCCAGTGG - Intergenic
925883285 2:8370478-8370500 GAGTTGATAGCCCAGCTCCGGGG - Intergenic
925910019 2:8567705-8567727 GAGTTGACAGCCTGGCCACAGGG - Intergenic
926226638 2:10971626-10971648 GAGGGGACAGCACAGGTCCAGGG + Intergenic
926274783 2:11395596-11395618 GTGTGGATAGCCCAGGCTCATGG + Intergenic
928015363 2:27651304-27651326 GACTGCTCAGCCCACCCCCAGGG - Exonic
928052689 2:28016479-28016501 GTGTGCTCAGCCCAGCACCATGG - Intronic
928470264 2:31568608-31568630 GAATTGACAGCCCAGCACCCAGG + Intronic
929009223 2:37424562-37424584 GTGCGGACAGCCCACCCCAAGGG - Intergenic
931885011 2:66607678-66607700 ATGTGGACAGCCCACCCCAAGGG + Intergenic
933759103 2:85662039-85662061 GTGTGGGCATCCCAGCCCCTGGG + Exonic
934079208 2:88452773-88452795 GCGTGGAGAGCCCAGGCCCGCGG - Intergenic
934716566 2:96548098-96548120 GTCTGCACAGACCAGCCCCAGGG + Intronic
937997957 2:127709359-127709381 CAGGAGACAGCCCAGCCCCCCGG + Intronic
938288791 2:130138675-130138697 GAAAGGACAGCCCAGGCCCGGGG - Intergenic
938467743 2:131534257-131534279 GAAAGGACAGCCCAGGCCCGGGG + Intergenic
940398714 2:153222461-153222483 GAGCTGACAGCCCAGCCCCCAGG + Intergenic
940566171 2:155363724-155363746 ATGTGGACAGCCCACCCCAAGGG + Intergenic
941978570 2:171431726-171431748 GGGGGGCCAGGCCAGCCCCAGGG + Intronic
943903045 2:193465668-193465690 ATGTGGACAGCCCACCCCAAGGG - Intergenic
943905131 2:193489840-193489862 ATGTGGACAGCCCACCCCAAGGG + Intergenic
944914489 2:204344196-204344218 ATGTGGACAGCCCACCCCAAGGG + Intergenic
945838254 2:214857863-214857885 ATGTGGACAGCCCACCCCAAGGG + Intergenic
946120671 2:217511134-217511156 CACAGGCCAGCCCAGCCCCATGG + Intronic
946166404 2:217866774-217866796 GAGGGGAGAGGCCAGCCCAAGGG - Intronic
946191821 2:218011522-218011544 GCTAGGGCAGCCCAGCCCCAGGG - Intergenic
946401166 2:219469087-219469109 GAGGGGCCAGCCCAGCCCTGGGG + Intronic
947909564 2:233792186-233792208 GAGAGGACAGAGGAGCCCCAGGG - Intronic
948708510 2:239810699-239810721 GAGGGGTCAGCCTGGCCCCAGGG - Intergenic
1169073821 20:2749784-2749806 GAGGGGAGGGCCCAGCCCCTAGG - Intronic
1169084456 20:2818141-2818163 GTGGGGACAGCACAGCCCCAGGG + Intronic
1171177044 20:23060010-23060032 ATGTGGACAGCCCATCCCAAGGG + Intergenic
1171520409 20:25771062-25771084 AAGTGGACACCCAGGCCCCATGG + Intronic
1171556510 20:26085431-26085453 AAGTGGACACCCAGGCCCCATGG - Intergenic
1172153206 20:32805134-32805156 GAGGGGACAGCCCAGCATCCAGG - Intronic
1172530844 20:35630399-35630421 GTGTGGACAGACCTGCCTCAGGG + Intronic
1172626380 20:36349900-36349922 GGGAGGACAGCCCATCCCCTGGG - Intronic
1172895316 20:38295969-38295991 GTGTGGGCACCCCAGGCCCAGGG + Intronic
1173476488 20:43363567-43363589 GAGTGGAGAGCCCGGCTCCCAGG + Intergenic
1173550740 20:43931550-43931572 CATTGGGCAGCCCAGCCCCAGGG - Intronic
1173872247 20:46349358-46349380 GAGTGGAAAGCCCAAGCCCCAGG + Intronic
1175217298 20:57398356-57398378 GAGCGAGCAGCCCAGGCCCAGGG + Intronic
1175443822 20:59007308-59007330 GATGGGACAGCCCCGCCCCGGGG - Intergenic
1175487226 20:59355052-59355074 GAGTGCTCACCTCAGCCCCACGG - Intergenic
1176291263 21:5046111-5046133 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1176413503 21:6461511-6461533 AGGTGGAAAGCCAAGCCCCAGGG + Intergenic
1176426659 21:6552686-6552708 CAGGGGCCAGCCCTGCCCCATGG + Intergenic
1177437956 21:21081075-21081097 ACGTGGACAGCCCACCCCAATGG - Intronic
1177624860 21:23646574-23646596 GAGCTGGCAGCCCAGCCCCCAGG + Intergenic
1178402060 21:32295362-32295384 ATGTGGACAGCCCACCCCCAGGG - Intronic
1178422465 21:32453207-32453229 GATTGAACAGCCCTTCCCCAGGG + Intronic
1178755675 21:35347217-35347239 GAGGGGACACCCCAGCACCCAGG - Intronic
1179235052 21:39538480-39538502 AGGTGGACAGCCCACCCCAAGGG - Intergenic
1179613443 21:42566729-42566751 CAGGGGTCAGCCCAGGCCCAGGG + Intronic
1179689000 21:43069834-43069856 AGGTGGAAAGCCAAGCCCCAGGG + Intronic
1179702150 21:43161008-43161030 CAGGGGCCAGCCCTGCCCCATGG + Intronic
1179865992 21:44217530-44217552 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1180617992 22:17141132-17141154 GTGTTGCCAGGCCAGCCCCAGGG + Exonic
1180643673 22:17319779-17319801 GGGTGGAGAGCCCAGCCCTGAGG + Intergenic
1181045960 22:20214356-20214378 GAGAGGACACCCCGCCCCCATGG - Intergenic
1181047301 22:20221558-20221580 GAGTGGACATCCCAGCTCCATGG - Intergenic
1181055305 22:20258105-20258127 GAGGAGAAAGCCCAGCTCCAAGG + Intronic
1181359141 22:22321886-22321908 GAGAGCACTGACCAGCCCCATGG - Intergenic
1181467503 22:23118045-23118067 GAGCTGACAGCCCATCCCTAAGG - Intronic
1183254595 22:36754201-36754223 GAATGGCCAGCCCAGAGCCATGG + Intergenic
1183587558 22:38761537-38761559 GAGGGGACAGCCCTGGTCCATGG - Intronic
1184257179 22:43294006-43294028 GAGTAAACAGCCCTGTCCCAAGG - Intronic
1184391226 22:44204729-44204751 GGGTGGACATCCCAGCCCGGGGG - Intronic
1184738186 22:46411375-46411397 GAGTGGCCAGGCCGACCCCAGGG - Intronic
1184828554 22:46969673-46969695 GAGTGCACAGGCTAACCCCAAGG - Intronic
1185109666 22:48894001-48894023 GATGGGGCAGCCCAGACCCAAGG + Intergenic
1185173208 22:49305286-49305308 GAGTGGCCGGACCAGCTCCATGG - Intergenic
1185192036 22:49444706-49444728 GAGTGGACAGGTAAGCCCCAAGG + Intronic
949598610 3:5574702-5574724 AGATGGACATCCCAGCCCCAGGG - Intergenic
949877441 3:8635403-8635425 GGCTGGACAGCCCAGGCCAAAGG + Intronic
950534923 3:13573110-13573132 GAGGGGACAGCCCCGCACCTGGG + Intronic
950573570 3:13817085-13817107 GAGACCACAGCACAGCCCCATGG - Exonic
950798576 3:15531288-15531310 GAGTGAACTGCCCCACCCCAGGG + Intergenic
952675841 3:36029400-36029422 ATGTGGACAGCCCACCCCAAGGG - Intergenic
953194516 3:40720010-40720032 ATGTGGCCAGCCCACCCCCAGGG + Intergenic
953318014 3:41946652-41946674 GGGTGGATAGCACAACCCCAGGG - Intronic
953851257 3:46467071-46467093 GTTGGAACAGCCCAGCCCCAGGG + Intronic
954194743 3:48990012-48990034 GAGTGTACAGCTCTGCCCGACGG + Exonic
954300972 3:49700593-49700615 GAGTGGACAGGCGAGTCCCAGGG - Intronic
954684889 3:52365093-52365115 GACAGGACAGTCCAACCCCAGGG + Intronic
955534244 3:59906197-59906219 GAATGGACACCATAGCCCCAAGG + Intronic
956164929 3:66390480-66390502 GGGTGGACAGCCCATCTTCATGG + Intronic
956731126 3:72197691-72197713 GAGTGGACAACACAGCCCCTGGG - Intergenic
958678245 3:97293702-97293724 GAATGGGCAGCCCAGGCCCCAGG + Intronic
959260759 3:104076929-104076951 AGGTGGACAGCCCAACCCGAGGG + Intergenic
960708674 3:120505881-120505903 ATGTGGACAGCCCATCCCAAGGG + Intergenic
961326600 3:126112764-126112786 GAGTGGTAAGTCCTGCCCCAGGG - Exonic
961336941 3:126186332-126186354 TAGTGGCCAGCCCAGGCCCAGGG - Intronic
961452928 3:127010564-127010586 GAGGGGACAGGCCAGCTTCAGGG + Intronic
961602146 3:128070685-128070707 GAGAGGACAGCACAGGCTCAAGG + Exonic
961640929 3:128364481-128364503 CAGTGGTCAGTCCAGCCTCATGG + Intronic
961756120 3:129128318-129128340 GATTGGCCAGCCCAGCCCTCAGG + Intronic
962932488 3:140051061-140051083 GAGTGGGCAGGCCAGCCCCCGGG - Intronic
963432055 3:145220022-145220044 GAAAGGCCAGCCCAGCCTCATGG - Intergenic
964400974 3:156298022-156298044 GAGAGGAAAGCCCATACCCATGG - Intronic
965061331 3:163788615-163788637 GAACTGACAGCCCAGCCCCCAGG + Intergenic
965422033 3:168472451-168472473 GAGAGGACAGGCCAGGCACAGGG - Intergenic
966254353 3:177900020-177900042 GAGTGGACAGAACAAGCCCAGGG + Intergenic
967863664 3:194172721-194172743 ATGTGGACAGCCCACCCCAAGGG - Intergenic
967971050 3:194999715-194999737 GTGTGTCCAGCCCAGCCCCTTGG - Intergenic
968477873 4:820881-820903 GAACTCACAGCCCAGCCCCACGG + Intronic
968511479 4:997662-997684 GAGCGCGCAGCCCACCCCCAGGG - Intronic
968658175 4:1787492-1787514 GATCTGACAGCCCTGCCCCAGGG - Intergenic
968798028 4:2722113-2722135 GAGAGGACAGCACGGCGCCACGG + Intronic
968873855 4:3255006-3255028 GGGTGGAGAGACCACCCCCAGGG - Intronic
968916156 4:3497866-3497888 GTGGGGCCAGCCCTGCCCCAAGG + Intronic
968980771 4:3848362-3848384 GAACTGACAGCCCAGCCCCCAGG + Intergenic
969247969 4:5947874-5947896 GAGCTGTCAGCCCAGCCCCCAGG + Intronic
969491081 4:7499602-7499624 GAGAACAGAGCCCAGCCCCATGG - Intronic
969531361 4:7732889-7732911 AGGTGGCCTGCCCAGCCCCATGG + Intronic
969875086 4:10130508-10130530 GGGTGAACAGTCCACCCCCATGG - Intergenic
970229485 4:13893964-13893986 GGGTGGCCAGACCAGGCCCAGGG - Intergenic
971851339 4:31989439-31989461 ATGTGGGCAGCCCAGCCCAAGGG + Intergenic
972347322 4:38203481-38203503 GAGTGTACAGCCCATCCCACTGG - Intergenic
976380123 4:84389516-84389538 GAGGGGACAGCACAGCCCTAAGG - Intergenic
979803264 4:124938202-124938224 GTGAGGACAGCCCACCCCCAGGG + Intergenic
980810741 4:137875915-137875937 ATGTGGACAGCCCATCCCAAGGG - Intergenic
981080402 4:140634296-140634318 GAGGCCACAGCCCTGCCCCAGGG - Intronic
981655207 4:147105049-147105071 GAGTGCACAGCCTAGGCCAAGGG - Intergenic
983262291 4:165470315-165470337 ATGTGGACAGCCCACCCCAAGGG - Intronic
983781325 4:171674017-171674039 ATGTGGACAGCCCAACCCAAGGG - Intergenic
984857075 4:184204574-184204596 CAGTGGTCAGCACAGCCCAAGGG - Intronic
985278958 4:188268658-188268680 GTGTGGAGAGCCCAGGCCCCTGG + Intergenic
985520781 5:373220-373242 GAGAGGGCAGCCCTGCCCCGCGG + Intronic
985866341 5:2517295-2517317 GAAGGGGCAACCCAGCCCCATGG + Intergenic
986066586 5:4240382-4240404 ATGTGGACAGCCCAACCCGAGGG + Intergenic
987654986 5:20795988-20796010 ATGTGGACAGCCCACCCCAAAGG + Intergenic
988629644 5:32915086-32915108 ATGTGGACAGCCCACCCCAAGGG + Intergenic
988641067 5:33041315-33041337 GAATTGGCAGCCCAGCCCCCAGG + Intergenic
988768577 5:34407914-34407936 ATGTGGACAGCCCACCCCAAAGG - Intergenic
991605427 5:68396103-68396125 GAGAAGCCAGCCCAGCTCCAGGG + Intergenic
994023900 5:95059984-95060006 AAGTAGGCAGCTCAGCCCCAAGG + Intronic
996906783 5:128610108-128610130 ATGTGGACAGCCCACCCCAAGGG - Intronic
997374906 5:133390921-133390943 GAGGGAACAGCCGAGCCCCCAGG + Intronic
998296522 5:140974961-140974983 GAGCGGACAACTCAGCCACATGG - Intronic
998453000 5:142249327-142249349 GACTGGGCAGCCCAAACCCAGGG - Intergenic
998564509 5:143204883-143204905 AAGAGAACAGCCCAGACCCAGGG - Intronic
999282832 5:150376167-150376189 GAGTGGGCACCCAAGCCCCCCGG + Exonic
1000295442 5:159909337-159909359 GAGAGGACAGACCAGGCCCCAGG - Intergenic
1001512572 5:172334212-172334234 GACTGGACTGCCCAGCTCCGTGG - Exonic
1001594741 5:172890934-172890956 GAAGGGACAGCACAGCCCCGTGG + Intronic
1002065510 5:176649779-176649801 GGGCGGACAGCCCGGCCCCGCGG - Intronic
1003212426 6:4079356-4079378 GAGTGGGCTGCGCAGCCCCGCGG - Exonic
1004228351 6:13808815-13808837 GAATGGAGAGCCCAGACACAAGG - Intronic
1004562005 6:16760666-16760688 GAGGGGAGACCCCCGCCCCAGGG + Intronic
1005812187 6:29526143-29526165 ACGTGGACAGCCCACCCCAAGGG - Intergenic
1006017914 6:31097205-31097227 ATATGGACAGCCCAGCCCAAGGG + Intergenic
1007177757 6:39908396-39908418 CAGTGACCAGCCCAGCCCCCAGG + Intronic
1007717788 6:43867362-43867384 CAGTGGACTGGCCTGCCCCAGGG + Intergenic
1008540411 6:52541855-52541877 GTGTGGGCAGACCAGCCCCCGGG + Intronic
1010116401 6:72316936-72316958 GAGTGGAGAGACCAGGCCCTAGG + Intronic
1010685284 6:78847200-78847222 GATTGTACTTCCCAGCCCCAGGG - Intergenic
1011478195 6:87768140-87768162 GAGTGGAGAGCAGGGCCCCAAGG + Intergenic
1015803078 6:137080375-137080397 GAATGGCCATCCCAGCTCCAGGG - Intergenic
1018996851 6:168716753-168716775 CACTGGGCTGCCCAGCCCCATGG - Intergenic
1019294173 7:265259-265281 GAGGGGTCAGCCCAGCCCCACGG + Intergenic
1019346752 7:534771-534793 GAGTGGGCATCTCAGCCCCCTGG - Intergenic
1020139877 7:5606375-5606397 GTGTCGGCAGCCCAGGCCCAGGG - Exonic
1021508521 7:21410766-21410788 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1022496954 7:30859348-30859370 GACAGACCAGCCCAGCCCCAGGG - Intronic
1024311555 7:47974339-47974361 CACTGGACAGCTCAGCTCCATGG + Intronic
1024794815 7:53008056-53008078 GACTTGGCAGCCCAGCCCCCAGG - Intergenic
1025280904 7:57626026-57626048 AAGTGGACACCCAGGCCCCATGG + Intergenic
1025303826 7:57839481-57839503 AAGTGGACACCCAGGCCCCATGG - Intergenic
1026258277 7:68731873-68731895 AAGTGGACAGCCCACCCCAAGGG + Intergenic
1026274497 7:68864782-68864804 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1026626865 7:72001495-72001517 ATGTGGACAGCCCACCCCAAGGG + Intronic
1026828041 7:73596152-73596174 CAGTGCCCAGCCCAGCCTCAAGG - Exonic
1030558235 7:111053276-111053298 ATGTGGACAGCCCACCCCAAGGG - Intronic
1030905351 7:115174457-115174479 GAGGGGACTGCCCAGCTCCATGG + Intergenic
1031859092 7:126957855-126957877 GAATGGGCAGCCCTGCCCCCGGG - Intronic
1032679060 7:134162852-134162874 GAGTGGACAGAACTGCCCAAGGG + Intronic
1035071453 7:156148136-156148158 GTGTCCACAGCCCAGGCCCACGG - Intergenic
1035071470 7:156148189-156148211 GTGTCCACAGCCCAGGCCCATGG - Intergenic
1035071487 7:156148242-156148264 GTGTCCACAGCCCAGGCCCACGG - Intergenic
1035071503 7:156148295-156148317 GTGTCCACAGCCCAGGCCCACGG - Intergenic
1035089343 7:156293889-156293911 GGGTGGACAGGACAACCCCAGGG + Intergenic
1035618771 8:1022378-1022400 GAGTGGACAGTCCCGTGCCAAGG + Intergenic
1035684516 8:1513398-1513420 GAGGCCACAGGCCAGCCCCACGG + Intronic
1036625995 8:10472009-10472031 GTGTGGAGAGCCCACCCCAAGGG - Intergenic
1036984666 8:13514958-13514980 GAGGGGAGAGCCCAGCCGCCTGG + Intronic
1037135406 8:15454110-15454132 ATGTGGACAGCCCACCCCAAGGG + Intronic
1038465511 8:27759205-27759227 CGTTGGACAGCCCAGCTCCAGGG - Intronic
1039557672 8:38488325-38488347 GAGAGGAAAGCTCAGCCCTATGG + Intergenic
1039890283 8:41681379-41681401 GAGAGGACGGCCCAGGCCCTGGG - Intronic
1040300038 8:46183237-46183259 GGGTGGACTGGCGAGCCCCAGGG - Intergenic
1043239866 8:77919050-77919072 ATGTGGACAGCCCATCCCTAGGG + Intergenic
1045507519 8:102789125-102789147 GACTGCACAGCCCAGCCTGAAGG + Intergenic
1046387935 8:113527230-113527252 CTTTGGACAGCCCAGCCCAAGGG + Intergenic
1048995824 8:139793197-139793219 GAGGGGACAGCCGAGTCCCCTGG - Intronic
1049063807 8:140296985-140297007 GGGTGGCCTGCCCATCCCCACGG + Intronic
1049106811 8:140619139-140619161 GTGTGGGCAGCCCAGGGCCAGGG - Intronic
1049181747 8:141226495-141226517 GAGGGGACAGGCCAGCACCTGGG - Intronic
1049572659 8:143376486-143376508 CAGTTGAAAGCCCAGCCCCAAGG - Intronic
1049658643 8:143809924-143809946 GGTTCCACAGCCCAGCCCCAAGG + Intronic
1049710873 8:144062788-144062810 GAGTGGATAGCACAGGCCCCTGG - Intronic
1049763137 8:144339753-144339775 AAGTGGACAGCCCAGATCCGAGG + Intergenic
1049849898 8:144825376-144825398 GAGTGGACAGCCCAGAGCAATGG - Intergenic
1049874634 8:145008337-145008359 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1052160733 9:25255481-25255503 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1052459740 9:28747278-28747300 TACTGGACAGCCCAACTCCAGGG + Intergenic
1054336685 9:63815066-63815088 GAACGGCCGGCCCAGCCCCACGG - Intergenic
1056091079 9:83206871-83206893 GAGGGGAGCGCCCATCCCCAAGG - Intergenic
1056092013 9:83215129-83215151 CACTGGACAGCCCAACTCCAGGG + Intergenic
1056739690 9:89243697-89243719 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1056756410 9:89384857-89384879 GGGTGGAAGGCCCAGCTCCATGG - Intronic
1057183176 9:93040644-93040666 GCTTGGGCCGCCCAGCCCCAGGG + Intergenic
1057825083 9:98366687-98366709 GACAGGAGAGCTCAGCCCCAGGG - Intronic
1059332690 9:113545927-113545949 ACTTGGACAGCCCAGCTCCAGGG + Intronic
1060593700 9:124835193-124835215 GAGTGGTCAGCACGGCACCAGGG - Intergenic
1060880778 9:127116617-127116639 GGGTGGACAGCACTGCCCCAGGG + Intronic
1061583720 9:131553713-131553735 AAGTGGGCAGCCCAGAGCCAGGG - Intergenic
1061797945 9:133099139-133099161 GAAAGGACAGGCCTGCCCCAGGG + Intronic
1185805214 X:3050716-3050738 ATGTGGACAGCCCAACCCCAAGG - Intronic
1186057422 X:5664846-5664868 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1186445054 X:9620246-9620268 TAGTGGACAGCACAACCCCACGG - Intronic
1186510102 X:10124365-10124387 CAGTCTCCAGCCCAGCCCCAGGG - Intronic
1189780387 X:44508301-44508323 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1190253975 X:48748626-48748648 GACTTTACAGCCCAGCCCCCAGG + Intergenic
1192142576 X:68658571-68658593 GAGTGGGGAGCCCAGGCTCAGGG + Intronic
1193509481 X:82382394-82382416 GCCTGGGCAGGCCAGCCCCAGGG + Intergenic
1194111484 X:89839581-89839603 ATGTGGACAGCCCACCCCAAGGG + Intergenic
1195325790 X:103757327-103757349 ATGTGGACAGCCCACCCCAAGGG - Intergenic
1197749592 X:129955399-129955421 AAGTGCAAAGCCCAGCACCAAGG + Intergenic
1198218116 X:134575097-134575119 GAGTGAAAAGCCCAGCCCAGAGG - Intronic
1199922393 X:152421591-152421613 GAGTGAAAAGGCAAGCCCCATGG + Intronic
1200464154 Y:3494398-3494420 ATGTGGACAGCCCACCCCAAGGG + Intergenic