ID: 1091699687

View in Genome Browser
Species Human (GRCh38)
Location 12:2651465-2651487
Sequence TGTCCACTCATTAAAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091699678_1091699687 18 Left 1091699678 12:2651424-2651446 CCTGGGCACAGTCTAGCTCTGCA 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93
1091699684_1091699687 -9 Left 1091699684 12:2651451-2651473 CCATGGGGCTGGGCTGTCCACTC 0: 1
1: 0
2: 4
3: 40
4: 387
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93
1091699676_1091699687 26 Left 1091699676 12:2651416-2651438 CCCAGCGGCCTGGGCACAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93
1091699677_1091699687 25 Left 1091699677 12:2651417-2651439 CCAGCGGCCTGGGCACAGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091699687 Original CRISPR TGTCCACTCATTAAAGTGGG CGG Intronic
900874728 1:5333679-5333701 CCTCCACTCTTTAAAGTGGTTGG - Intergenic
901013291 1:6212940-6212962 TGACCTCTAATTAAAGAGGGAGG - Intronic
903970383 1:27115028-27115050 TGCCCCATCTTTAAAGTGGGTGG - Intronic
904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG + Intronic
904099521 1:28012381-28012403 TGTCCACTTATTAGACTGGTAGG + Intronic
905976768 1:42181195-42181217 TGGCCACTCACTAAACTGGGTGG + Intronic
918264886 1:182832565-182832587 TGTCCACTCATTCAAGCTGAGGG - Intergenic
918870805 1:189971540-189971562 TGTCATCTCATTAAAATTGGGGG - Intergenic
921375101 1:214465304-214465326 TGTCCACTCAAGAAAGTGTTAGG + Intronic
1063183825 10:3632264-3632286 TGTGCATTTATTAAAGTGGCGGG + Intergenic
1063853683 10:10222544-10222566 TGAGCTCTCATTAAAGTGTGTGG - Intergenic
1069809619 10:71148743-71148765 TCTCCATTCCTTAAAGGGGGAGG - Intergenic
1074607471 10:114988132-114988154 TGTCCAGTCATTAGTGTGGAGGG + Intergenic
1081365576 11:42231039-42231061 TGGCAATTCATTAAAGTGGCTGG + Intergenic
1086722901 11:90144187-90144209 TCTTCATTCATTAAAGTTGGGGG - Intronic
1089693536 11:120201501-120201523 TATCCCCTCTTTAACGTGGGAGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1101349433 12:103915083-103915105 TTTTCAATCATTAAAGTGGCTGG + Intergenic
1101812019 12:108115532-108115554 TGCCCACTCATGACAGAGGGAGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1108332369 13:49401729-49401751 TGTCAACTGATTAAACTGGCTGG + Intronic
1108891587 13:55267276-55267298 TGTTACCTAATTAAAGTGGGTGG + Intergenic
1109811746 13:67521409-67521431 TGTCCCCTTATTAAAGTGTAAGG - Intergenic
1117489413 14:56231138-56231160 CTTCCACACAGTAAAGTGGGGGG + Intronic
1119246718 14:73115974-73115996 AGAGCACTCATTTAAGTGGGGGG + Intronic
1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG + Intronic
1120342623 14:83241633-83241655 TGTCCAGTCTATAAAGTGGTGGG - Intergenic
1120454128 14:84710059-84710081 TGTACAATTATTATAGTGGGAGG - Intergenic
1121245567 14:92458982-92459004 TCTCCACCCCTTGAAGTGGGTGG + Intronic
1126330097 15:47522648-47522670 TATCCTCTCAGTATAGTGGGCGG - Intronic
1128946596 15:71827121-71827143 TGTTCACACATGAAATTGGGTGG + Intronic
1129454847 15:75671098-75671120 TGTCCCCTAATTAAAGGGTGAGG + Intergenic
1130179936 15:81615464-81615486 TGTCCTTTTATTAAAGAGGGAGG + Intergenic
1131670668 15:94616367-94616389 TTTCCTCTCATTAAAATGTGGGG - Intergenic
1131803456 15:96096737-96096759 TGTTTACTTCTTAAAGTGGGTGG + Intergenic
1135256799 16:20947612-20947634 TGTCCACTGCTTAATGTGTGGGG + Intronic
1135433284 16:22405666-22405688 TGTCCACTGATGAAAGTGCTGGG - Intronic
1137917103 16:52443943-52443965 TGTCCTCTGTTTAAACTGGGAGG - Intronic
1141301030 16:82815754-82815776 TGTCCACCCATTATACTGTGAGG + Intronic
1141797581 16:86285572-86285594 TGTCCACCCAGGAAGGTGGGTGG - Intergenic
1143051273 17:4127977-4127999 TGTCCACTCATTAAGGAATGGGG - Intronic
1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG + Intergenic
1146402531 17:32511122-32511144 TGTCCTCTGATTGATGTGGGAGG - Intronic
1148617314 17:49010811-49010833 AGTCCACGCACTAAAATGGGAGG + Intronic
1153380844 18:4437791-4437813 TGTCCACTTAATACAGTTGGAGG + Intronic
1153380855 18:4437963-4437985 TGTCCACTTAATATAGTTGGAGG + Intronic
1156710650 18:39940754-39940776 TTACTACTCATTAAAGTGGTAGG - Intergenic
1159251900 18:65890255-65890277 TGTGCACTCATCAAAATGTGTGG + Exonic
1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG + Intergenic
927462981 2:23315258-23315280 TGTCCCATCATGGAAGTGGGAGG - Intergenic
928973421 2:37056848-37056870 TGTTCACGCAATAAGGTGGGTGG - Intronic
930258656 2:49119964-49119986 TGACGGCTCTTTAAAGTGGGAGG + Intronic
931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG + Intergenic
933106314 2:78330385-78330407 TGACCACCCATCAAAGTGGGTGG - Intergenic
936036996 2:109120898-109120920 TGTCTACACAGTAAAGAGGGTGG + Intergenic
939202021 2:139048240-139048262 TGTCCACACATGATAGAGGGAGG + Intergenic
940179901 2:150920218-150920240 TCTCCACTGATTTCAGTGGGGGG + Intergenic
940498901 2:154469797-154469819 TGTCCAGTCGTTAAAGTCAGTGG + Intergenic
947993106 2:234502583-234502605 TGACCACACATTAGAGAGGGTGG - Intergenic
1171370655 20:24660249-24660271 TGTCCACTCATTTACGGGAGTGG + Intronic
1178709862 21:34906999-34907021 TGTACACTCACTAAAGTCAGAGG - Intronic
1179097267 21:38327064-38327086 GGACCACTGATTAAAGTGTGAGG - Intergenic
1184895073 22:47401903-47401925 TGTCCAATCTTTATAGTGAGTGG - Intergenic
954197345 3:49004608-49004630 TTTCCACTAAATAAAGGGGGCGG - Intronic
957824836 3:85427291-85427313 AGTCCAATAATTAAACTGGGTGG + Intronic
959798593 3:110462949-110462971 TGGCCACTCAATTTAGTGGGAGG - Intergenic
962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG + Intergenic
966736962 3:183194522-183194544 TGCCCACTCAGTAAAGTAGGAGG + Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG + Intronic
979904459 4:126269087-126269109 TTTCCACTCTTTAGAGTGTGAGG + Intergenic
984487284 4:180387011-180387033 TGTACACTTTTTAAAGTGGGAGG + Intergenic
986608120 5:9543674-9543696 TGTATACTCATTGAAGTGTGGGG - Intronic
986874261 5:12087889-12087911 TATTCATTCATTAAACTGGGTGG + Intergenic
988549966 5:32191508-32191530 TGTCCACTCATTGAATCTGGGGG - Intergenic
989115411 5:37948045-37948067 TGTCCACTTGTTCAAGTGTGGGG + Intergenic
992160783 5:73999140-73999162 TCGCCACACATTAATGTGGGAGG - Intergenic
994263705 5:97689462-97689484 GGTCCACTCAAAAAAGGGGGTGG + Intergenic
995997664 5:118321031-118321053 TGTCTTCTCATTAAAGTAGAAGG + Intergenic
999859819 5:155633461-155633483 TGCCCACTCCACAAAGTGGGAGG - Intergenic
1008988417 6:57574374-57574396 TGTAGACTTATTGAAGTGGGAGG - Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1012485009 6:99711393-99711415 TGTACAGCCATTAGAGTGGGTGG + Intergenic
1015762355 6:136677941-136677963 TGACAACTCTTTAAAGTAGGGGG + Intronic
1016503570 6:144750535-144750557 TGTCCACTCTTTAAGTGGGGAGG - Intronic
1022267211 7:28768794-28768816 TGTTAACTCATTTGAGTGGGAGG - Intronic
1023320933 7:38996867-38996889 TGTCCATTCATTAAAGGTGGGGG - Intronic
1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG + Intergenic
1024829372 7:53431040-53431062 TGTTCTCACATAAAAGTGGGAGG + Intergenic
1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG + Intronic
1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG + Intronic
1041663101 8:60417768-60417790 TGTCCACTGATTATAGTGCTAGG - Intergenic
1042346031 8:67728945-67728967 TGTCCAAGAATTAAATTGGGTGG - Intronic
1044444807 8:92263372-92263394 TGTCTACTGATTATATTGGGTGG - Intergenic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1055795155 9:79967932-79967954 CATCCACTGATTAAATTGGGAGG - Intergenic
1061386365 9:130292411-130292433 TGCCCACTCATAAATGTGGGAGG - Intronic
1193311890 X:80020388-80020410 TTCGCACCCATTAAAGTGGGGGG - Intronic
1197251244 X:124218272-124218294 TGTTCATTAATTAAAGGGGGGGG + Intronic