ID: 1091699975

View in Genome Browser
Species Human (GRCh38)
Location 12:2652814-2652836
Sequence AGCGGCAGTCCTGCTTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091699975_1091699979 1 Left 1091699975 12:2652814-2652836 CCAGCGGAAGCAGGACTGCCGCT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1091699979 12:2652838-2652860 ACTCTGTACTTGGGTGCACGCGG 0: 1
1: 0
2: 0
3: 1
4: 70
1091699975_1091699976 -9 Left 1091699975 12:2652814-2652836 CCAGCGGAAGCAGGACTGCCGCT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1091699976 12:2652828-2652850 ACTGCCGCTGACTCTGTACTTGG 0: 1
1: 0
2: 0
3: 3
4: 117
1091699975_1091699977 -8 Left 1091699975 12:2652814-2652836 CCAGCGGAAGCAGGACTGCCGCT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1091699977 12:2652829-2652851 CTGCCGCTGACTCTGTACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 134
1091699975_1091699980 10 Left 1091699975 12:2652814-2652836 CCAGCGGAAGCAGGACTGCCGCT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1091699980 12:2652847-2652869 TTGGGTGCACGCGGAACCCACGG 0: 1
1: 0
2: 0
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091699975 Original CRISPR AGCGGCAGTCCTGCTTCCGC TGG (reversed) Intronic
901490619 1:9594650-9594672 AGCGGGAGCCCTGCTTCCCAGGG + Intronic
924392705 1:243580630-243580652 AGCGGCTCTCCTGCTGCCCCAGG - Intronic
1065102027 10:22340780-22340802 AGCGGCAGTGCGGCTCCAGCTGG + Intergenic
1065200120 10:23304554-23304576 AGGAGCAGTCCTGCTTGCCCAGG + Intronic
1065778237 10:29142659-29142681 ACAGGCACTCCTGCTTTCGCCGG + Intergenic
1069955077 10:72044956-72044978 GGGCCCAGTCCTGCTTCCGCAGG + Intergenic
1076875973 10:133215693-133215715 AGGGGCAGTCCTCCACCCGCTGG - Intronic
1079651575 11:22935966-22935988 AGGGGCAGGCATGCTTCAGCTGG + Intergenic
1090635950 11:128690566-128690588 TGCGGAAGTCCTGCTTCCCCCGG - Intronic
1091684969 12:2555161-2555183 AGCGCCAATCCTGCTTCCCAGGG + Intronic
1091699975 12:2652814-2652836 AGCGGCAGTCCTGCTTCCGCTGG - Intronic
1091758403 12:3071424-3071446 AGCAGCAGTCCGGGTGCCGCAGG - Intergenic
1096217110 12:49803856-49803878 AGGGGCAGCCCTGCCTCCCCAGG + Intronic
1096844720 12:54399877-54399899 AGCCGCAGCTCTGCTTCCTCGGG - Exonic
1099285257 12:80708431-80708453 GGCGGCTTTCCTGCTTCCTCGGG - Intronic
1099899092 12:88684854-88684876 AGCAGCAGTCATGCTACCTCAGG - Intergenic
1122799028 14:104220735-104220757 CGGGGCTGTCCTGCTTCCGAGGG - Intergenic
1128544988 15:68560856-68560878 AGCTGCGGTTCTGCTTCCTCTGG - Intergenic
1129245691 15:74277442-74277464 GGAGGCAGACCTGCTTCCCCTGG - Intronic
1132511729 16:346030-346052 ACCGGATGTCCTGCTGCCGCTGG - Intronic
1133013445 16:2927734-2927756 AGCGGCAGGCCTCCTTCACCTGG - Intronic
1139079074 16:63492111-63492133 AGCTGGAGTCATGCTTGCGCTGG + Intergenic
1141446644 16:84063025-84063047 CGCGGGAGTCCCGCCTCCGCTGG + Intronic
1141973629 16:87499127-87499149 AAAGGCAGTCCTGCTTACCCTGG + Intergenic
1142346273 16:89555977-89555999 ACAGGCAGGCCTGCTTCAGCCGG - Intronic
1142616668 17:1140433-1140455 AGTGGCAGCCTCGCTTCCGCTGG - Intronic
1143112355 17:4559699-4559721 AGTGGCAGCCCTGCTGCTGCTGG - Exonic
1149784535 17:59423949-59423971 AGGGGCAGTCCTGTTTCTCCGGG - Intergenic
1149994183 17:61398307-61398329 AGAGGCCATACTGCTTCCGCCGG + Intergenic
1150188671 17:63214629-63214651 AGAGGCAGACATGCTTCCTCAGG + Intronic
1152204835 17:78969033-78969055 AGCGGCAGCCCTGTTCCCCCGGG - Intergenic
1152643130 17:81457463-81457485 AGCAGCAGCCCTGCTTCCCTGGG - Exonic
1154991225 18:21600222-21600244 AGCGCCAGTGCTGGTCCCGCAGG - Intronic
1155865798 18:30963421-30963443 AGTGGCCTTCCTGCTTCTGCTGG + Intergenic
1157281145 18:46347104-46347126 AGCTCCAGTCCTGCCTCCTCCGG - Intronic
1160151147 18:76395207-76395229 ACAGGCACTCCTGCTGCCGCAGG + Intronic
931196667 2:60058408-60058430 AGCCCCAGTCCTGCTTACCCTGG + Intergenic
939998841 2:148947417-148947439 TGTGGCAGTCCTGCCTCTGCAGG + Intronic
1168902354 20:1375854-1375876 AGCGGCAGTCCACCTTCTTCTGG + Intronic
1172957548 20:38771726-38771748 AGCGGGAGGCCTGCTTCGGCAGG - Exonic
1175765193 20:61587514-61587536 AACTGCAGTCCTGCTTCCTGAGG + Intronic
1175916425 20:62428118-62428140 AGCAGAAGGCCTGCTTCCCCAGG - Intergenic
1176023837 20:62975938-62975960 AGAGGCAGTCCTGCGCCTGCTGG - Intergenic
1178974240 21:37208262-37208284 AGCCGGAGTCCTGCTGGCGCTGG - Intergenic
1180067097 21:45417990-45418012 ATGGCCAGTCCTGCTGCCGCAGG + Intronic
1181382763 22:22520214-22520236 ACCGGCAGCACTGCTTCCGCAGG + Exonic
1183675077 22:39294681-39294703 AGCGCCAGGCCTGCTTCCTCCGG - Intergenic
955202272 3:56861917-56861939 AGCAGCAGCTCTGCTTCCACTGG + Intronic
957573261 3:81976383-81976405 AACGGCAGTTCTGTTTCAGCAGG - Intergenic
959090624 3:101899043-101899065 AACAGCAGTTCTGCTTCCGGGGG - Intergenic
960946442 3:122970037-122970059 AGTAGCAGTTCTGCTTCAGCTGG - Intronic
960949995 3:122993042-122993064 AGCAGCAGTCCTGGCTCCCCTGG - Intronic
961338341 3:126199421-126199443 AGCGGCAGTCCTCCTTCCTCTGG + Intergenic
966807652 3:183819345-183819367 AGGGGAGGACCTGCTTCCGCAGG - Intronic
968731493 4:2271322-2271344 TGCGGCAGTGGTGCTTCCGGCGG + Exonic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
992392556 5:76342362-76342384 AGAAGGAGTCCTGCTTCCTCAGG + Intronic
995690592 5:114822181-114822203 AACTGCAGTCCTGCTTCATCTGG + Intergenic
1003598561 6:7496742-7496764 CGCGGCAGCCCAGCTTCCCCTGG - Intergenic
1005340599 6:24840302-24840324 AGAAGCAGCCCTGCTTCCTCTGG + Intronic
1012788748 6:103664315-103664337 AGCAGCTCTCCTGCTTCCTCAGG - Intergenic
1017665952 6:156720219-156720241 AGCGGGAGGCCTGCAGCCGCTGG - Intergenic
1024023504 7:45391695-45391717 AGGGGCACTGCTGCTTCTGCAGG + Intergenic
1029267544 7:99354175-99354197 AAGGGCAGTCCTGGTTCAGCTGG - Intronic
1034044961 7:147917997-147918019 AGCGCCAGTGCTGCTTCCCAAGG + Intronic
1039732949 8:40299602-40299624 AGCAGCAGGCCTTCTTCCTCTGG + Intergenic
1056808753 9:89747969-89747991 AGCAGCTGACCTGCTTCTGCTGG + Intergenic
1062430799 9:136526109-136526131 AGCGACAGACCTGCCTCTGCGGG + Intronic