ID: 1091700334

View in Genome Browser
Species Human (GRCh38)
Location 12:2654844-2654866
Sequence ACCGGGATCCTGCTTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091700334_1091700342 15 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG 0: 1
1: 0
2: 2
3: 40
4: 422
1091700334_1091700347 23 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1091700334_1091700345 22 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471
1091700334_1091700341 14 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG 0: 1
1: 0
2: 5
3: 61
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091700334 Original CRISPR ACCGGGATCCTGCTTCTGAC AGG (reversed) Intronic
900086354 1:899640-899662 ACCAGGATGCTGATTCTGAAAGG + Intergenic
904824228 1:33264246-33264268 ACAGGGACCATTCTTCTGACTGG - Intronic
919220189 1:194618059-194618081 AGCGGGTTGCTGCTGCTGACTGG - Intergenic
922480428 1:225936896-225936918 ACCTGGATTCTGGTTCTGACAGG - Exonic
1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG + Intergenic
1071953291 10:90729088-90729110 ACTGGGATTCTGTTTCTTACAGG - Intergenic
1079238954 11:18708995-18709017 CCAGGGAGCCTGCTTCTGACTGG - Intronic
1081213034 11:40359193-40359215 ACTGGTATCCTGCTTTTGAGAGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1097266370 12:57747674-57747696 AACTGGATCCTGCTTATTACAGG - Exonic
1098088152 12:66870678-66870700 ACTGGGTTCATGCTTCTGACAGG + Intergenic
1103969929 12:124664102-124664124 CCCGGGAGCCTGGTTCAGACAGG + Intergenic
1114696120 14:24629392-24629414 ACAGGGATTATGCTTCTGAGTGG + Intergenic
1116932283 14:50702449-50702471 GCCGGGGTACTGCTTCTGCCTGG + Intergenic
1119535688 14:75400877-75400899 ACTGAGATCCTTCTTCTGAAAGG - Intergenic
1132344714 15:101101249-101101271 AGCGGGATCCTGCTTCCCCCGGG - Intergenic
1138401533 16:56748923-56748945 CCCGGGAGGCTGCTTCTGAAAGG + Intronic
1143583498 17:7839634-7839656 CCCGTGATCCCTCTTCTGACAGG - Intergenic
1146512008 17:33458020-33458042 AAGGGGATTCTGATTCTGACAGG + Intronic
1149992787 17:61392128-61392150 ACCAGCAACCTGCTTCTGACTGG + Exonic
1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG + Intronic
1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG + Intronic
1160233562 18:77067670-77067692 ACCGGGAGGCTGCTTCTCTCGGG + Intronic
926957978 2:18322577-18322599 ACCTGGATCCCTCATCTGACTGG - Intronic
928706931 2:33959989-33960011 ACAGGCAGCCTGCTTATGACTGG + Intergenic
930218541 2:48722168-48722190 CCCAGGATGCTGCTTCTGAATGG + Intronic
931392320 2:61854601-61854623 ACTGGGAGCCTCCTTCTGATTGG - Intergenic
932266206 2:70369026-70369048 ACCCGGATCCTGTCTCTGACAGG + Intergenic
938794598 2:134707012-134707034 ACCCGGAGGCTGCTTCTGAGAGG - Intronic
948500443 2:238389173-238389195 CCCTGGATCCTGCTTCCGAGAGG + Intronic
1170495792 20:16923861-16923883 TCATGGATCCTGCTTCTGAGAGG - Intergenic
1173045155 20:39502729-39502751 ACCAGGATCCTGGTTCAGCCAGG + Intergenic
1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG + Intronic
1174801865 20:53570846-53570868 ACCAGGCTCCTGCCTCTCACAGG + Intronic
1175163239 20:57024202-57024224 CCAGAGATCCTGCTTCTGATTGG - Intergenic
1175730561 20:61350956-61350978 GCCTGGTTCCTGCTTCAGACCGG - Intronic
1181046710 22:20218069-20218091 ACCGGGGTCCAGCTGGTGACAGG - Intergenic
1184191088 22:42895001-42895023 ACCAGGATTCTGGTTCTCACAGG - Intronic
1184865012 22:47197426-47197448 TCCGGGATCCTGCTCCTGCCTGG + Intergenic
954816949 3:53290056-53290078 AATGGGAACCAGCTTCTGACTGG - Intronic
955958400 3:64313825-64313847 ACTGGGTTCCTGGTGCTGACTGG - Intronic
961048414 3:123725775-123725797 ACTGGGATCCTGCTCCCGACTGG - Intronic
961416854 3:126765546-126765568 ACCTGGATCCTGCGTCGCACAGG - Intronic
965272579 3:166638202-166638224 ACGGGGATCCTGCTTGTCCCTGG - Intergenic
966774583 3:183532748-183532770 ACCTGGATCCTGCTTGTGGAGGG + Intronic
970840123 4:20458677-20458699 ACTGCTATCCTGCTTCTTACAGG - Intronic
972373973 4:38453078-38453100 ACCTGGACCCTGCTACTAACTGG + Intergenic
972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG + Intergenic
975521628 4:75307714-75307736 ACCGTGAACCTGCTTCAGAGGGG + Intergenic
978446736 4:108787474-108787496 ACCTGGATCCTGCCTCTCACGGG - Intergenic
1001055573 5:168446991-168447013 TCTGGGATCCTGTTTCTGACCGG + Intronic
1001102451 5:168825336-168825358 ACTGGAATCCTGCTTTGGACTGG - Intronic
1002898164 6:1390875-1390897 ACCGGGCTGCTGCTGCTGTCCGG - Exonic
1007227181 6:40323167-40323189 ACCCTGATCCTGCTTCTTCCTGG - Intergenic
1007406034 6:41637042-41637064 GCCGGGATCCGGCTGCTGTCCGG - Intronic
1008040384 6:46791353-46791375 ACTGGGGGCCTGCTTCTGATGGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1012868175 6:104642750-104642772 ACCTGGATCCTCCTTCTCACAGG + Intergenic
1014344130 6:120246008-120246030 ACAGGGATCCTGGTTTTGATGGG - Intergenic
1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG + Intronic
1028504110 7:91552751-91552773 ACAGGGAACCTGCCTCTGAATGG - Intergenic
1036924945 8:12895414-12895436 ACCGGCACCCTGCTTGTTACTGG - Intergenic
1040912327 8:52531653-52531675 ACTGGGATCCCTCTTCTGTCTGG - Intergenic
1049672313 8:143875386-143875408 CCAGGCATCCTGCTGCTGACAGG + Intronic
1057763109 9:97892105-97892127 CCCCAGATCCTGCTGCTGACGGG - Intergenic
1062396087 9:136353451-136353473 CCCAGGGTCCTGCTTCTGAGGGG + Intronic
1062623928 9:137434560-137434582 ACAGGGGTCCTGCTCCTGATGGG - Exonic