ID: 1091700341

View in Genome Browser
Species Human (GRCh38)
Location 12:2654881-2654903
Sequence CTCTCAGCCCCAGCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 492}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091700337_1091700341 -9 Left 1091700337 12:2654867-2654889 CCCAGCATCCACCGCTCTCAGCC 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG 0: 1
1: 0
2: 5
3: 61
4: 492
1091700334_1091700341 14 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG 0: 1
1: 0
2: 5
3: 61
4: 492
1091700336_1091700341 -4 Left 1091700336 12:2654862-2654884 CCGGTCCCAGCATCCACCGCTCT 0: 1
1: 0
2: 0
3: 24
4: 223
Right 1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG 0: 1
1: 0
2: 5
3: 61
4: 492
1091700332_1091700341 21 Left 1091700332 12:2654837-2654859 CCTGTGTCCTGTCAGAAGCAGGA 0: 1
1: 0
2: 0
3: 35
4: 280
Right 1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG 0: 1
1: 0
2: 5
3: 61
4: 492
1091700338_1091700341 -10 Left 1091700338 12:2654868-2654890 CCAGCATCCACCGCTCTCAGCCC 0: 1
1: 0
2: 0
3: 33
4: 402
Right 1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG 0: 1
1: 0
2: 5
3: 61
4: 492
1091700335_1091700341 -3 Left 1091700335 12:2654861-2654883 CCCGGTCCCAGCATCCACCGCTC 0: 1
1: 0
2: 5
3: 19
4: 239
Right 1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG 0: 1
1: 0
2: 5
3: 61
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091700341 Original CRISPR CTCTCAGCCCCAGCTCCCAC TGG Intronic
900164294 1:1238573-1238595 CCCCCAGCTCCAGCTCCCAGCGG + Intergenic
900497773 1:2984019-2984041 CTCTGAGCCCCAGTTTCCTCAGG + Intergenic
900978955 1:6035452-6035474 CTCTCCTGCCCAGCTGCCACCGG - Intronic
901689193 1:10961386-10961408 CGCTCAGCCCCTGCTCCTTCAGG + Intronic
902636687 1:17739434-17739456 TTCTCAGCCCCAGCTGCACCCGG + Intergenic
903967659 1:27100385-27100407 GTGACAGCCCCAGCTCCCAGAGG - Exonic
904610702 1:31724782-31724804 CCCTCAGTCCCTGCTCCCCCAGG - Intergenic
905672353 1:39799917-39799939 CTCTGAGCCCCAGTTCCCACCGG + Intergenic
905915508 1:41681734-41681756 CTCCCAGCCCCTCCTCCCTCAGG - Intronic
907627446 1:56043916-56043938 CTTCCAGACCCAGCTGCCACAGG + Intergenic
908050621 1:60225775-60225797 CTCTCGGCCCCTGCCCTCACAGG + Intergenic
908161412 1:61412006-61412028 CTCTCTGCCCCATCTCACTCAGG - Intronic
908754760 1:67459190-67459212 CTCGCAGCCCTGGCTCCCCCAGG - Intergenic
910325203 1:85998852-85998874 CACTGAGCCCCACTTCCCACAGG - Intronic
910489119 1:87748451-87748473 ATCTCTGCCCCAACTCCCAATGG - Intergenic
912069840 1:105795918-105795940 CGCGCAGCCCCGGCTCCCGCTGG - Intergenic
912562944 1:110563355-110563377 CTCCCAGCCACAGCTCCAAGTGG - Intergenic
913257933 1:116972167-116972189 CTCTCAGCCCTGGCTCCCTCGGG - Intronic
913480187 1:119280583-119280605 CTCACATCCCCAACTCCCAGGGG + Intergenic
914963111 1:152224395-152224417 CTCTCAGCCCCACCTGCCAAAGG + Intergenic
915369573 1:155337309-155337331 CTGTCATCCTCAGATCCCACAGG - Exonic
916192722 1:162194739-162194761 CTCTCAGCCCCAACCCCCCGAGG - Intronic
918696405 1:187551248-187551270 TACGCAGCCCCAGCTGCCACAGG + Intergenic
919974735 1:202603118-202603140 CTCTCTCCCCCAGCTCCCACAGG - Exonic
920022234 1:202965193-202965215 TTCTCAGCCCCATTTGCCACAGG - Intronic
922239323 1:223745232-223745254 CTCTGAGCCTCAGCTGCCTCTGG - Intronic
922991834 1:229920846-229920868 CTCACAGGCCCAGGGCCCACAGG + Intergenic
923161354 1:231317469-231317491 CGTGCAGCCCCAGCTCCCGCAGG - Intergenic
923410218 1:233700712-233700734 CTCTTAACCCCTTCTCCCACAGG + Intergenic
923724150 1:236491868-236491890 CTCACAGCCCCCGCAGCCACAGG - Intergenic
923822198 1:237457538-237457560 CTCTGAGCCCCAGTTCTCAAAGG + Intronic
924776190 1:247115599-247115621 CTCACAGCCCAAGCTCACATGGG - Intergenic
1062834865 10:628933-628955 GTCCCAGCCCCACTTCCCACAGG - Intronic
1065895865 10:30162863-30162885 CACGCAGCCCCAGTTCCCGCCGG - Intergenic
1067044420 10:42976283-42976305 CCCTCAGCCCCAGCTCCTCTGGG + Intergenic
1067476900 10:46573286-46573308 CTCTCAGCCCTTCCTCTCACTGG + Intergenic
1067617837 10:47768494-47768516 CTCTCAGCCCTTCCTCTCACTGG - Intergenic
1068543799 10:58325291-58325313 CTCTCATCCCCAGCTGTAACTGG - Intergenic
1069832628 10:71290562-71290584 GTTTCAGCCCCAGCACTCACAGG + Intronic
1069892275 10:71659348-71659370 CTCTCAGGCCTAGTTCCCAGTGG - Intronic
1070739885 10:78895791-78895813 CTCTCAGCTCCGTCTCACACGGG - Intergenic
1070824076 10:79380793-79380815 CTCCAAGCCCCAGCTCTCCCCGG - Intergenic
1071289572 10:84179128-84179150 ATCTCAGCTCCACCACCCACTGG + Intronic
1071492859 10:86147897-86147919 CTCTATGCCCCAGAGCCCACTGG + Intronic
1072578907 10:96723081-96723103 CTCTGATCCCCAGGTCCGACAGG - Intergenic
1073121365 10:101124325-101124347 CTCCCCGCCCCAACTACCACCGG + Intronic
1073290347 10:102410392-102410414 CTCTCAGGCCCCTCTCCCTCCGG + Intronic
1073457500 10:103646538-103646560 CTCCCACCCCCAGCACCCACAGG + Intronic
1074455038 10:113589130-113589152 CTCCCGGCCCCGGTTCCCACAGG + Exonic
1075032787 10:119037376-119037398 CTCTAAGCCCCAGCTTGGACTGG - Intronic
1075081046 10:119384143-119384165 CTCTTGGCCCTAGCTCCCTCAGG + Intronic
1075659509 10:124183616-124183638 CTCTCAGCTCCACCACCTACCGG + Intergenic
1075721101 10:124587949-124587971 CCTTCAGCCCCAGCTCCACCGGG - Intronic
1075894949 10:125986957-125986979 CACTCACTCCCAGCCCCCACTGG - Intronic
1075926449 10:126255147-126255169 CTAGCAGTCCCAGCTCCCAGTGG + Intronic
1076802369 10:132836495-132836517 CTGTCCTCTCCAGCTCCCACTGG - Intronic
1076891888 10:133288764-133288786 ATCTCAGCCCCACGTCCCACAGG + Intronic
1076905399 10:133358406-133358428 CTCCCACCCCGAGCTCCCTCAGG + Intergenic
1077235526 11:1480320-1480342 CTCTGAGCCCCCGCTGCCCCAGG - Intronic
1077633229 11:3824938-3824960 CTCTCAGCCCTAACTCCTAAGGG - Intronic
1078025563 11:7691870-7691892 CTCTGAGCCTCAGCTCGCTCTGG - Intronic
1078272717 11:9811516-9811538 CTATGAGCCCCAGCTCCAAACGG - Intronic
1078586925 11:12599684-12599706 CTCTCGGCCCAGGCTCCCCCTGG - Intergenic
1079138943 11:17794942-17794964 GCCTCAGCCCCAGCGCTCACAGG - Intronic
1079284473 11:19116925-19116947 CTCCCTGCCCCAGGTGCCACGGG - Intergenic
1079664343 11:23084543-23084565 CTCTCACCTCAAGCTCCCAAAGG - Intergenic
1081998432 11:47378710-47378732 CTCTCAGTCCCAGCTTCCTCTGG - Intergenic
1083267267 11:61552405-61552427 CTCCCAGCCCATTCTCCCACTGG + Intronic
1083304929 11:61757185-61757207 CCTTCAGCCCCGGCTGCCACGGG + Intronic
1083742860 11:64720375-64720397 CTCCCAAGCCCAGCCCCCACGGG - Intronic
1083783285 11:64929275-64929297 CACTGAGCACCAGCACCCACTGG + Intronic
1083970466 11:66070903-66070925 CTCCCCGCCCCAGCGCCCATGGG + Intronic
1084645194 11:70452734-70452756 TCCTCAGCCCCAGAACCCACAGG - Intergenic
1084650917 11:70488702-70488724 CTCTCAGCCCCTGCTCCAAAGGG - Intronic
1085187993 11:74592596-74592618 ATCACAGCCACAGCTCCCGCCGG - Exonic
1085735377 11:79034326-79034348 CTCTCAGCCCCAGCATGCAGTGG - Intronic
1085739248 11:79064972-79064994 CTTCCAGCCCCAGCTCCCGCAGG + Exonic
1085823103 11:79814164-79814186 CTCTCAGCCCCATGTTCCACTGG + Intergenic
1085863094 11:80257571-80257593 CTTGCAGCCCCAGTTCCCTCCGG - Intergenic
1088808093 11:113370039-113370061 CTCTCAGGCCCTGCTGCCATGGG - Intronic
1088876507 11:113940853-113940875 CCTTCATCCCCATCTCCCACTGG - Intronic
1089123918 11:116162696-116162718 CTCCCAGCCCCACCTGCCTCAGG - Intergenic
1089573135 11:119423077-119423099 CCCCGAGCCCCAGGTCCCACCGG + Intronic
1089589434 11:119531152-119531174 CTCCCAGCCTCAGCACCCAGGGG + Intergenic
1090449967 11:126797599-126797621 CACACAGCCCCAGCTGTCACAGG - Intronic
1090558177 11:127898919-127898941 CTCTCAGCCCCAGTTCCTGCAGG + Intergenic
1091302747 11:134518021-134518043 CTCCCACCCCAAGCTCCCAGAGG + Intergenic
1091700341 12:2654881-2654903 CTCTCAGCCCCAGCTCCCACTGG + Intronic
1091744299 12:2981448-2981470 CCCTGAGCCCCAGTTCCCAGAGG - Intronic
1092200924 12:6582222-6582244 GTCTCAGCCCCATCTGCCCCCGG + Exonic
1092915128 12:13182563-13182585 CTCTCAACCCCATGTCCCCCTGG - Intergenic
1094494458 12:30980683-30980705 GACTCAGGCCCAGCTCCCAGTGG + Intronic
1095420199 12:42017428-42017450 CTGTCAGCCACAGCTCCATCTGG - Intergenic
1096674097 12:53217270-53217292 CTCTCAGCACCAGCCCCTCCTGG - Intronic
1102197531 12:111035352-111035374 CTCCCAGCCCCGGCTCCTACGGG - Intronic
1102532747 12:113558768-113558790 CTCACATCCCCAGCTCCTGCTGG - Intergenic
1102532983 12:113560327-113560349 CTCACATCCCCAGCTCCTGCTGG + Intergenic
1102864965 12:116367213-116367235 CTCTCACTCACAGCTCCCAAGGG - Intergenic
1103191225 12:119003686-119003708 TTGTCACCCCCAGCTCCCCCAGG + Intronic
1103946693 12:124531273-124531295 GGCTCTGCACCAGCTCCCACAGG + Intronic
1104329263 12:127828916-127828938 CTCTCAGCCACCGCTGACACCGG + Intergenic
1104987231 12:132603942-132603964 CGTCCAACCCCAGCTCCCACGGG + Intronic
1105409186 13:20156940-20156962 CTCCCAGCTCCATCTCCCAGTGG + Intronic
1105606928 13:21933662-21933684 CTCTCAGCTCCAGCATTCACTGG - Intergenic
1106931502 13:34670676-34670698 CTCACAGGCTCAGCTCCCCCAGG + Intergenic
1107684207 13:42880331-42880353 CTCTAAGCCTCAGCTCACTCTGG + Intergenic
1108516947 13:51212323-51212345 GTCTCAGCCACAGCCCACACAGG - Intergenic
1108705638 13:52983238-52983260 CTCTCAGTCCCACCTCACAGAGG + Intergenic
1110428753 13:75399305-75399327 TTCTCAGCCTCAGCTCTCATTGG - Intronic
1110519839 13:76462567-76462589 CTCCCACCCTCAGCTCCCAGGGG + Intergenic
1111200573 13:84929915-84929937 CCCTCAGCCCCAGCCCCAACAGG - Intergenic
1112234802 13:97625541-97625563 ATCTCAGCCCTGGCTCCAACTGG - Intergenic
1112486137 13:99821589-99821611 CTCTTCTCCCCAGCTCTCACAGG + Intronic
1113376635 13:109770168-109770190 CTGCCAGCCACAGCCCCCACCGG - Intronic
1113823843 13:113234756-113234778 CTCCCATCCCCAGGGCCCACAGG - Intronic
1115400483 14:32953723-32953745 ATCTGAGCCCCAGTTCCCACAGG + Intronic
1117701673 14:58420032-58420054 CTCCCATCTCCACCTCCCACAGG + Intronic
1118765082 14:68904218-68904240 CTCTATGCCCCAGCTCTGACTGG - Intronic
1119762424 14:77161047-77161069 CTCTCAGCTCAACCTCCCAGAGG + Intronic
1120057780 14:79945934-79945956 ATCTCCACCCCATCTCCCACAGG + Intergenic
1121233018 14:92372234-92372256 CTCTGAGACCCAGGTCCCAGGGG - Intronic
1121315558 14:92959167-92959189 CTCTCAGCCCCGGCCAGCACGGG + Intronic
1121339184 14:93094802-93094824 CTCTCAGCCCAGGCTTCCAGGGG + Intronic
1122018586 14:98818089-98818111 TGCTCAACACCAGCTCCCACTGG + Intergenic
1122487709 14:102092595-102092617 CTGTCTGCCCCACCTCCTACAGG - Intronic
1122736729 14:103847668-103847690 CTCCCCGCCCCCGCTCCCACCGG - Intergenic
1123432181 15:20227462-20227484 TTTTCAACCCCAACTCCCACTGG - Intergenic
1124349848 15:28947275-28947297 CCCTCAGTGCCAGCTCCAACAGG - Intronic
1124823664 15:33072341-33072363 CTCTCATACCCAAGTCCCACAGG - Intronic
1125296894 15:38212815-38212837 CTCTCAGCCACAGCTCTTCCTGG - Intergenic
1126229195 15:46305875-46305897 ATCTCAGCTCCAGCTCCAGCTGG + Intergenic
1127768083 15:62207546-62207568 CGCGCAGCCCCGGCTCCCGCTGG - Intergenic
1128482873 15:68054692-68054714 CCCCCAGCCCCAGCTCCCCATGG - Intronic
1128637339 15:69311620-69311642 CTCTACGCCCCAGTGCCCACAGG + Intronic
1129250915 15:74308532-74308554 GTCTCAGCCCCTTCCCCCACAGG - Intronic
1129266921 15:74398115-74398137 CACTCAGCACCAGCCACCACTGG + Intergenic
1129322009 15:74780720-74780742 CTCCCAGCTCCGTCTCCCACAGG + Intergenic
1129393552 15:75232588-75232610 CACCCAGCCCCAGCTCCCCAAGG - Intergenic
1129461049 15:75700276-75700298 CTCTCACACCCTCCTCCCACTGG - Intronic
1129723771 15:77891449-77891471 CTCTCACACCCTCCTCCCACTGG + Intergenic
1129742171 15:77994572-77994594 AGCTCAGGCCCAGCTGCCACTGG - Intronic
1129843310 15:78756908-78756930 AGCTCAGGCCCAGCTGCCACTGG + Intergenic
1129891638 15:79075507-79075529 CCCCCAGCCCCAGCTTCCAGAGG - Intronic
1130159063 15:81380883-81380905 CGCACAACCTCAGCTCCCACTGG + Intergenic
1132128403 15:99251368-99251390 CCCTCTTCCCCAGCTCCCTCTGG + Exonic
1132175748 15:99712570-99712592 CCCGCAGCCCCAGCCCCGACAGG + Exonic
1132378298 15:101347616-101347638 CTCTCAGCTCCCGCCCCCAGAGG - Intronic
1132395980 15:101474758-101474780 TACTCAGCTCCAGCTCCCACAGG + Intronic
1132633705 16:932315-932337 CTCGCAGGCCCATCTCTCACAGG + Intronic
1132652516 16:1028030-1028052 CTGTGGGCCCCACCTCCCACAGG + Intergenic
1132686241 16:1163302-1163324 CTCCCAGGCCCTGCTCCAACTGG - Intronic
1132758457 16:1497234-1497256 AGCTGAGCCCCAGATCCCACGGG - Intronic
1133008720 16:2898428-2898450 CTCTGAGCCCTGCCTCCCACAGG - Intronic
1133019813 16:2962501-2962523 CTCTCACCCCCTGCCCCCTCTGG + Intergenic
1133259154 16:4537602-4537624 TTCTCAGCCCCAGCTGCGCCCGG + Intronic
1133673124 16:8043910-8043932 CTCTCAGCCTCACCTTCCTCAGG + Intergenic
1134331151 16:13252197-13252219 CACTCTGCTCCAGCCCCCACTGG + Intergenic
1134405794 16:13957566-13957588 CTCTCAGCCCAAGCCCACACTGG - Intergenic
1135494132 16:22936883-22936905 CTCTCAGGCCCAGAACCCAATGG + Intergenic
1136218175 16:28809687-28809709 AGCTCAGCCCCAGCTCACAGAGG + Intergenic
1136226827 16:28865459-28865481 CTCACCGCCCCAGCTCGCAGGGG - Intronic
1136500819 16:30669012-30669034 CCCTCAGCCCCTGCTGCCCCTGG + Intronic
1136592239 16:31224458-31224480 CGCGCAGCCCCAGCAGCCACAGG - Exonic
1136852457 16:33623677-33623699 TTTTCAACCCCAACTCCCACTGG + Intergenic
1137359914 16:47804847-47804869 CACTCACCCCCATCTCCCAAAGG - Intergenic
1137792294 16:51185336-51185358 GGCTCAGCCTCAGCTTCCACGGG + Intergenic
1138163405 16:54777217-54777239 AACACAGCCCCATCTCCCACGGG + Intergenic
1138286798 16:55816446-55816468 CTCCCACCCCCACCTCCCAGTGG - Intronic
1138312572 16:56040534-56040556 CTCTGAGCCCCAGCTTACCCTGG + Intergenic
1138334480 16:56241853-56241875 TGCTCATGCCCAGCTCCCACAGG - Intronic
1139657773 16:68399411-68399433 ATGTCAGCCCCTGGTCCCACAGG + Intronic
1140912756 16:79468602-79468624 TGCTCAGCCCCAGCTCACCCTGG + Intergenic
1141424089 16:83934402-83934424 CTCCCAGCCCCAGCCCCCCTCGG + Intronic
1203114057 16_KI270728v1_random:1472145-1472167 TTTTCAACCCCAACTCCCACTGG + Intergenic
1142476925 17:194197-194219 CTCACAGCCCCACCTACCTCGGG + Intergenic
1142483647 17:233436-233458 CTTACAGGCCCAGCCCCCACAGG - Intronic
1142505633 17:361602-361624 CACACAGCCCCGGTTCCCACTGG - Intronic
1142577590 17:919936-919958 CTCTCTGCCTCAGCCCCCACCGG + Intronic
1142709394 17:1715299-1715321 CTGTCACCCCCACCTCCCTCCGG - Intergenic
1143028239 17:3953400-3953422 GTTCCAGCACCAGCTCCCACAGG + Exonic
1143891833 17:10107947-10107969 TTCTCCTGCCCAGCTCCCACTGG - Intronic
1144029256 17:11304797-11304819 CCCTCATCCCCAGCTCCTACCGG - Intronic
1144038884 17:11391020-11391042 CTCTCAACCCCGTCTCCCATAGG - Intronic
1144495667 17:15743278-15743300 CTACCAGGCCCACCTCCCACTGG - Intronic
1144632830 17:16882664-16882686 CTACCAGGCCCACCTCCCACTGG + Intergenic
1144726182 17:17503850-17503872 CCATCAGTCCCAGCCCCCACTGG - Intergenic
1145003198 17:19320016-19320038 CTCCGAGCCCCAGGTCCCTCAGG - Intronic
1146128466 17:30249018-30249040 CACTCAGCCAAAGCTCCCATGGG + Exonic
1146225290 17:31060700-31060722 CTCTTACCCCCAGCTCCTCCTGG - Intergenic
1146931323 17:36780187-36780209 TTCTTAGCCACAGCTCCCCCAGG + Intergenic
1147327368 17:39675923-39675945 TTCTCAGCCCAAGCTTCCCCCGG + Intronic
1147340580 17:39751251-39751273 CTCTCAGGGCCAGCTCACAGTGG + Intergenic
1147537187 17:41328509-41328531 CTCCCTGCCTCAGCTCCCAATGG + Intergenic
1149430701 17:56594042-56594064 CGCGCAGCGCCGGCTCCCACCGG - Exonic
1149628077 17:58094182-58094204 ATCTCAGCTCCAACACCCACTGG + Exonic
1149867271 17:60157811-60157833 CTCTCAGCCCCGGGTTCCCCGGG - Intronic
1150229231 17:63540972-63540994 CTCTCTGCCCCAGCCACCCCTGG + Intronic
1150238249 17:63610737-63610759 CCCTCAGCCCCAGTGGCCACTGG + Intergenic
1150716155 17:67574187-67574209 TTCTCAGCCCCAGTTGCCCCAGG - Intronic
1151678127 17:75610345-75610367 CTCTCAGCCCGGCCTCGCACGGG + Intergenic
1151680434 17:75620093-75620115 CTCCCAGCCCCTGCCCCCACAGG - Intergenic
1151825762 17:76523356-76523378 CTCACAGCCCCAGCTCGCCCGGG + Intergenic
1151903552 17:77033553-77033575 CTCTCACCCCAACCCCCCACTGG + Intergenic
1152007584 17:77692068-77692090 GTCCCTGCCTCAGCTCCCACTGG - Intergenic
1152109776 17:78351608-78351630 CTCCCGGCACCAGCTTCCACAGG + Intergenic
1152680248 17:81664189-81664211 CCTTCAGCCGCAGCTCCCAGGGG - Intergenic
1152700110 17:81814443-81814465 ATCTCAGCTCCAGCCCCCTCGGG + Intergenic
1152906414 17:82972941-82972963 CTCACAGCCCCAGGTCCTTCTGG - Intronic
1153544655 18:6193439-6193461 CTCTCACCTCCAGCCCCCAAAGG + Intronic
1154137367 18:11791882-11791904 CTGTCAGCCTCACCTCTCACAGG + Intronic
1154301228 18:13194400-13194422 ACCTGAGCCCCAGTTCCCACAGG - Intergenic
1155444793 18:25899814-25899836 CCCTCAGCTCCACCTCCCAGAGG + Intergenic
1155623421 18:27807517-27807539 CTCTCTGCTCCATCTTCCACTGG + Intergenic
1155772838 18:29723526-29723548 CACACAGCCCCGGTTCCCACTGG - Intergenic
1156463139 18:37332830-37332852 CTCTCAGCCAGAGCTCCCTGAGG + Intronic
1156493620 18:37511433-37511455 CTCTCAGGCCCAGCTCAGCCTGG + Intronic
1157135178 18:45047171-45047193 CTCACAGCCAAACCTCCCACTGG - Intronic
1157312971 18:46566198-46566220 CCCTCAGCCCCATCCCCCATGGG + Intronic
1157621740 18:49020940-49020962 CTCTGGGCCCCAGCTCACACAGG - Intergenic
1157959711 18:52139440-52139462 CTCTGAGCCCCAGTTCCCACAGG + Intergenic
1160375113 18:78405839-78405861 CTCTATGCCCCAGGTCCCACAGG + Intergenic
1160873536 19:1287266-1287288 CCCAAAGCCCCGGCTCCCACGGG - Intronic
1161407024 19:4096367-4096389 TTCTCTGCCCCAGCTCCAAAGGG + Intronic
1161703017 19:5805223-5805245 CCCCCAGCCCCAGCCCCCGCCGG + Intergenic
1162217784 19:9150551-9150573 CCCTCTCCCCCATCTCCCACAGG - Intronic
1162399038 19:10433579-10433601 CACCCAGCCCCTGCTCACACAGG + Intronic
1162572999 19:11483288-11483310 CGCACAGCCCCTGCTCCCACAGG - Intronic
1162582904 19:11541096-11541118 CTCTCAGCTCCTGCTCCCGCTGG - Exonic
1162792978 19:13072524-13072546 CACCCAGCTCCAGCTCCCAGAGG - Intronic
1162833699 19:13302776-13302798 TTCCCGGCCCCAGCTCCCAGTGG - Intronic
1163324243 19:16592959-16592981 CTCACAGCCAAACCTCCCACAGG + Intronic
1163343895 19:16727569-16727591 CTCTCAGCCCGAGTACCCGCCGG + Intronic
1163350048 19:16770946-16770968 GCCATAGCCCCAGCTCCCACAGG + Intronic
1163406888 19:17128455-17128477 AGCACAGCCCCAGCTCCCAGTGG + Intronic
1163442843 19:17330236-17330258 CGCTCAGCACCAGCTCCTGCGGG + Exonic
1163501667 19:17680027-17680049 CTCTGAGACCCCTCTCCCACTGG - Intronic
1163681376 19:18684292-18684314 CCCTCACCCCCAGCTACCAATGG - Intronic
1163790066 19:19301367-19301389 CCCTCAGTCCCACCTCCCAATGG + Intronic
1165068002 19:33240251-33240273 CCCTCAGCCCCAGTGCCCATCGG - Intergenic
1165472134 19:36009820-36009842 ATCCCAGCTGCAGCTCCCACCGG - Intronic
1165933144 19:39373170-39373192 CCCTTTGCCCCAGTTCCCACGGG - Intronic
1166003064 19:39889734-39889756 CACGCAGCCCAAGCTGCCACCGG + Exonic
1166005851 19:39905986-39906008 CACGCAGCCCAAGCTGCCACCGG + Exonic
1166332537 19:42087478-42087500 ATCTCAGCCCCAACTCCTACTGG + Intronic
1166746911 19:45145907-45145929 CTCTGAGCCTCAGCCACCACCGG + Exonic
1166762924 19:45235788-45235810 ATTTCAGCCCCAGCTCCCTGGGG - Intronic
1167536606 19:50057238-50057260 CTGTAAGCCCCACCTCCCAAGGG - Intergenic
1167765925 19:51482452-51482474 CCCTCAACCCCACCTTCCACAGG - Intronic
1168299074 19:55393110-55393132 CCAGCGGCCCCAGCTCCCACCGG + Intronic
1168386418 19:55966876-55966898 ATCTGAGCCCCAGCTCCTACTGG + Intronic
924962563 2:46869-46891 CGCTCAGCCCCAGATCCCCGAGG + Intronic
925572453 2:5326270-5326292 CTCTCTTCCCCAGCTTACACAGG - Intergenic
925755157 2:7126762-7126784 CTTCTAGCCCCAGCTGCCACAGG - Intergenic
926056567 2:9777328-9777350 CTCTCAGCACCAGCTCCCGGGGG - Intergenic
926166747 2:10525884-10525906 CTCACAGCCACAGCTTTCACTGG - Intergenic
926736042 2:16074000-16074022 CTCTCTGCCCCACCACACACAGG + Intergenic
927847313 2:26478201-26478223 CTGTGAGACCCAGGTCCCACAGG + Intronic
930922474 2:56773768-56773790 CTCACAGCCCCATCTCCACCAGG - Intergenic
931702192 2:64918223-64918245 CTCACACCCACACCTCCCACAGG - Intergenic
932112253 2:69012305-69012327 CTCTGAGCCCCAGTTCCGAGTGG - Intergenic
932803603 2:74764399-74764421 CTCTGTGCCTCATCTCCCACTGG - Intergenic
934127854 2:88915837-88915859 TTGTTAGCCCCAACTCCCACTGG - Intergenic
934808885 2:97265123-97265145 CTCTCAGCCCCAGACACCAGTGG - Intergenic
934828620 2:97492046-97492068 CTCTCAGCCCCAGACACCAGTGG + Intergenic
935653007 2:105398632-105398654 CTCTGAGCTCCAGCGCCCCCAGG + Intronic
936089261 2:109490396-109490418 CCCTGAACCCCAGTTCCCACGGG - Intronic
936665874 2:114594933-114594955 CTGTCTCCCCCAGCCCCCACTGG + Intronic
937043104 2:118836068-118836090 CTCCCATCTCCAGCCCCCACTGG + Intergenic
937339186 2:121080045-121080067 CTCTCAGAACCAGATCCCCCAGG - Intergenic
938179000 2:129162859-129162881 CACACACCCCCAGCCCCCACTGG - Intergenic
938496585 2:131801266-131801288 CTCCCAGCCCCACGACCCACAGG + Intronic
938741987 2:134241169-134241191 CTCTCTGTTCCTGCTCCCACGGG - Intronic
939765473 2:146243453-146243475 CTCTCAGCAGCACCTCCCACTGG + Intergenic
941438469 2:165502714-165502736 CTCTCTCCCCCACCTGCCACCGG + Intronic
944647609 2:201795418-201795440 CTCTCAGTCCCAGCACCCATGGG + Intronic
945724069 2:213453625-213453647 CTTTCACAGCCAGCTCCCACTGG - Intronic
946668001 2:222071381-222071403 TCCTCAGCCCCAGTTCCCAAAGG + Intergenic
947501551 2:230674808-230674830 CACTGCACCCCAGCTCCCACTGG - Intergenic
947634401 2:231672849-231672871 CCCTCAGGCCCAGCTCCCCCAGG + Intergenic
948437202 2:237961754-237961776 CTCTCTGCCCCAGCACACAGAGG + Intergenic
948638735 2:239359753-239359775 CTCTAAATCGCAGCTCCCACTGG - Intronic
948902736 2:240964562-240964584 CTGCCTGCTCCAGCTCCCACAGG - Intronic
1168758106 20:329772-329794 CACTCAGCCCTGGCTCCTACTGG - Exonic
1169806391 20:9563858-9563880 CACACATCTCCAGCTCCCACGGG - Intronic
1169811165 20:9610804-9610826 CTGACAGCCCCACCTCACACTGG - Intronic
1170272163 20:14539397-14539419 CTCCCAGCTCCATCTCCCACTGG - Intronic
1171424808 20:25042754-25042776 CTCTCGGCCCCAGCAGCCATGGG + Intronic
1171493465 20:25538254-25538276 CTCTCAGCCCCTGCTTTCAGAGG - Intronic
1172522346 20:35576220-35576242 CTCTGAGCCCCAGATCTCCCGGG - Intergenic
1172595704 20:36149704-36149726 CCCTCTGGCCCAGCTCCCAGTGG + Intronic
1172777404 20:37415540-37415562 CTCCCTGACCCAGCACCCACAGG + Intergenic
1172838386 20:37887407-37887429 CTCTCAGCCTCAGTTTCCCCAGG - Intergenic
1172843070 20:37913687-37913709 CTCTCAGCCCCAGCAGTCCCTGG - Intronic
1173857731 20:46261624-46261646 CTGTCAGGCACCGCTCCCACTGG - Intronic
1174291766 20:49513878-49513900 CTCTCAGCCCTGTTTCCCACTGG - Intronic
1175219297 20:57407769-57407791 CTCTCAGCCGCAGCACCCGCGGG + Exonic
1175281696 20:57808123-57808145 CTCTCAGCCCCAGCCAGCCCAGG - Intergenic
1175521528 20:59605172-59605194 CTCTCAGCGCCACCTGCCTCGGG - Intronic
1175737044 20:61394337-61394359 CTCTCAGCCCCAGCGACCAGCGG + Intronic
1175789672 20:61733344-61733366 CTCACAGCCGCCGCTCCCAGTGG + Intronic
1176122460 20:63460272-63460294 CTCTCCACCCCAGCTCCCCTGGG - Intronic
1176412256 21:6455378-6455400 CACCCAGCCCCAGCTCCTTCGGG + Intergenic
1177690288 21:24497591-24497613 CTGTGAGCCTCAGTTCCCACAGG - Intergenic
1178551388 21:33542590-33542612 TTTTCAGCCCCCGCCCCCACTGG - Exonic
1178708160 21:34890588-34890610 CTCTCCGCCTCCGCTCCCCCTGG + Intronic
1178849149 21:36198687-36198709 CTCCCAGCACCATCTCCAACTGG + Intronic
1179177805 21:39021586-39021608 CGCCCAGGCCCAGCTCCAACAGG - Intergenic
1179269930 21:39842942-39842964 CGCTAAGCCCCAGCTCACATGGG + Intergenic
1179416088 21:41199738-41199760 CTCCCAGCCCCAGCTCTCACTGG + Intronic
1179538788 21:42070766-42070788 CTCTCAGCCCAAGCTCCGGGAGG + Intronic
1179687750 21:43063700-43063722 CACCCAGCCCCAGCTCCTTCGGG + Intronic
1180141039 21:45893488-45893510 CTCTGCACCCCAGCTCCCAGGGG - Intronic
1180164067 21:46011372-46011394 CTGTCAGCCCCAGGACCGACTGG + Intergenic
1181059738 22:20276622-20276644 CTGTCAGCCCCAGCCCGCTCTGG - Intronic
1181349816 22:22246824-22246846 CACTCAGACCCACCACCCACGGG - Intergenic
1181444199 22:22956302-22956324 CACTCTACCCCAGCTGCCACAGG - Intergenic
1181541553 22:23575733-23575755 CTCTCACCCCCATCTCTCCCAGG + Intronic
1181687925 22:24542296-24542318 CTCTCGGGCCTAGATCCCACTGG - Intronic
1181796832 22:25317572-25317594 CTCTCACCCCCATCTCTCCCAGG - Intergenic
1182662586 22:31935497-31935519 CTCTGAGCCTCAGTTCCCACAGG + Intronic
1182922196 22:34090198-34090220 CTCTATGCCCCAGAACCCACTGG - Intergenic
1183099950 22:35577918-35577940 CTCTCCACCCCACTTCCCACTGG - Intergenic
1183600251 22:38835792-38835814 CTCTGAGCCTCAGCTTCCCCTGG + Intronic
1183675420 22:39296570-39296592 CTCGCTGACCCAGCACCCACTGG + Intergenic
1183720690 22:39559872-39559894 CTCTCAGCCCCAGCTTTCTCAGG - Intergenic
1184188468 22:42879528-42879550 TTCTCAGTCCCAGCCCCCTCAGG + Intronic
1184224875 22:43123864-43123886 CCCCCAACCCCAGCTCCCACAGG - Intronic
1184249208 22:43250715-43250737 CCCTCAGCCTGAGCTCCCTCTGG - Intronic
1184555801 22:45232592-45232614 CTCTCCATCCCAGCTCCCCCAGG + Intronic
1184745002 22:46451055-46451077 TCCTCCTCCCCAGCTCCCACCGG + Intronic
1185337071 22:50275475-50275497 GCCCCAGCCCCAGCTCCCTCCGG - Exonic
949416743 3:3823226-3823248 CTCTAAGTACCACCTCCCACAGG - Intronic
949881110 3:8661659-8661681 CCCTCAGCCTCAGTTTCCACAGG + Intronic
950011332 3:9726254-9726276 CTCTAAGTCCCAGTTCCCACTGG + Intronic
950771389 3:15314389-15314411 TTCTCAGTCCCAGCTCCTGCTGG + Intronic
951109360 3:18783943-18783965 CCCTGAGCCTCAGTTCCCACAGG + Intergenic
951117773 3:18885736-18885758 TTCTCAGGCCCAGTGCCCACTGG - Intergenic
951957695 3:28275490-28275512 CTCTGAGACCAAGATCCCACAGG - Intronic
952530431 3:34257098-34257120 TTCTCAGCCTCAGCTCCCTCAGG + Intergenic
952919439 3:38274897-38274919 CACTGAGGCCCAGCCCCCACAGG + Intronic
953422999 3:42769722-42769744 CGCGCAGCCCCAGTTCTCACCGG - Intronic
953423434 3:42772744-42772766 CTTCCAGGCCCAGCCCCCACAGG - Intronic
953738071 3:45513368-45513390 CTCTAAGCCTCAGCTCCCTCTGG + Intronic
953854221 3:46488673-46488695 TTCTCTCCCCCAGCCCCCACTGG + Intergenic
953896606 3:46808076-46808098 CACTGAGCCCCAGCTCCCTCAGG + Intronic
953975707 3:47380538-47380560 CTCTCAGCCCCGACTCCTTCAGG + Intergenic
954137445 3:48588516-48588538 CTCTCAGACCCTGCCCCCAAAGG + Intronic
954198150 3:49008140-49008162 GTCTCAGCCCCTGCTTCCCCGGG - Intronic
954582744 3:51711879-51711901 CTCCCACCCTCAGGTCCCACAGG - Intronic
955151488 3:56371669-56371691 CTCTCTACCCCACCTCCCAAGGG + Intronic
956016815 3:64892648-64892670 CTCCCAGGCCCAGCCCCCAAGGG + Intergenic
957921780 3:86757602-86757624 CACTCAGCCCCGGTTCCCGCTGG - Intergenic
958562160 3:95760131-95760153 CGCCCGTCCCCAGCTCCCACTGG + Intergenic
958858065 3:99410808-99410830 CTCTCACCCTCAGCTCCCAGAGG + Intergenic
960333740 3:116392168-116392190 CGCTTGTCCCCAGCTCCCACTGG - Intronic
960506476 3:118500670-118500692 CTCTGAGCCCCAGTTCCCTCAGG + Intergenic
960526224 3:118713818-118713840 TTATCAGCCCCAATTCCCACAGG - Intergenic
960595202 3:119402018-119402040 CGCTCAGGCCCGGCCCCCACCGG + Exonic
961353218 3:126316839-126316861 CACTCAGCCCCTGCTGCCCCAGG - Intergenic
962105412 3:132383708-132383730 CACTTGTCCCCAGCTCCCACCGG + Intergenic
962591110 3:136890351-136890373 CACGCAGCCCCAGTTCCCGCTGG + Intronic
962752210 3:138441585-138441607 GTCTCAGCCCCTGCTCCCTGAGG - Intronic
965198369 3:165626694-165626716 CTCTGAGCCCCAGTTTTCACAGG + Intergenic
966215320 3:177496000-177496022 CCCTAAGCTCCAGTTCCCACAGG + Intergenic
966299889 3:178466252-178466274 ATCTCAGTACCAGCTCCAACTGG - Intronic
968071938 3:195789478-195789500 ACCTTTGCCCCAGCTCCCACCGG - Exonic
968413261 4:407005-407027 CTCCAAGCCACAGCTCCCAGGGG - Intergenic
968500267 4:946725-946747 CACCCAGCCCCGGCTCCCACAGG + Intronic
969195757 4:5562600-5562622 CTTTCAGCCCCACCTCCCCAGGG - Exonic
970613156 4:17744036-17744058 CTCTCAGCTCCAGAGGCCACCGG + Intronic
971534642 4:27734049-27734071 CTCTTAGCACCTGCTTCCACAGG - Intergenic
972447637 4:39161042-39161064 CTTCCAGCCTCAGCTCCCACAGG + Intergenic
972790824 4:42369652-42369674 CGCGCAGCCCCGGCTCCAACTGG - Intergenic
973273922 4:48289071-48289093 CCATCAGTCCCACCTCCCACCGG - Intergenic
973745459 4:53959498-53959520 CTCTCAGCCCGGCCTCCCTCAGG + Intronic
974448544 4:62018740-62018762 CCCTCAGCCCCAGTTCCAGCAGG - Intronic
974839411 4:67283308-67283330 TCCTCAGCCTCAGCGCCCACTGG - Intergenic
975219655 4:71799560-71799582 CCATCAGCCCCAGGTCCCCCTGG - Intronic
975720700 4:77245998-77246020 CTCTCAACCCCACCACCCTCTGG - Intronic
976235922 4:82896937-82896959 CTTCCACCCCCACCTCCCACAGG + Intronic
976963829 4:91011570-91011592 CTCTGAGCCCAAGCTGCCAGGGG - Intronic
977177003 4:93829752-93829774 TTCTCAGCCCCAGCTTCTGCGGG + Exonic
980442609 4:132868003-132868025 CTCTCACCCCCAGTTCCAAAAGG + Intergenic
980882501 4:138726751-138726773 GTCTCAGCACCTGCTCCCCCAGG + Intergenic
981282207 4:142971337-142971359 CACTAAGCCCCAGTTCTCACAGG + Intergenic
982297396 4:153843863-153843885 CTCTCATCCTCAACTCCCAAGGG - Intergenic
984102288 4:175500001-175500023 CACTCATCCCTGGCTCCCACTGG + Intergenic
984298632 4:177886731-177886753 TTCTGAGCTCCAGCTCTCACTGG - Intronic
985126660 4:186701559-186701581 ATTCTAGCCCCAGCTCCCACAGG + Intronic
985516165 5:345792-345814 TTCCCAGCCCCAGCTCCTCCTGG - Intronic
985528322 5:419117-419139 CCCTCAGCCCCAACGACCACAGG - Intronic
985564393 5:608192-608214 CTCCCAAACCCAGCTCCCTCTGG - Intergenic
986308560 5:6533535-6533557 CACTGAGCCCTGGCTCCCACGGG - Intergenic
989207126 5:38821907-38821929 CGCGCAGCCCCAGCTCCCGCCGG - Intergenic
990368320 5:55092222-55092244 CAGGCAGCCCCAGCTACCACTGG + Intergenic
990487939 5:56277690-56277712 CTCTCAGGCACAGCAGCCACAGG + Intergenic
992219753 5:74560133-74560155 CTCCCAGCCCCAGCCCCTCCTGG - Intergenic
992321144 5:75614219-75614241 CTCCAAGCCCCAATTCCCACAGG + Intronic
992877388 5:81070210-81070232 AACTCAGCCCCAGCTGCCAGTGG - Intronic
994321936 5:98404493-98404515 CTCCCAGCCCCAGCTCCACCTGG - Intergenic
994754642 5:103779125-103779147 CACGCAGCCCCGGCTCCCACTGG + Intergenic
996437343 5:123449459-123449481 CTCTGAGCCCCAACTCTTACAGG + Intergenic
997375471 5:133394363-133394385 CACGCAGCCCCAGTTCCCGCCGG - Intronic
997464864 5:134080393-134080415 GGCTCTGCCCCAGGTCCCACAGG - Intergenic
997592475 5:135084038-135084060 TTCTCAACCCCTCCTCCCACAGG + Intronic
998600040 5:143576028-143576050 TTCTCAGCTCCAGCTCCCACAGG + Intergenic
998778883 5:145634019-145634041 CCATGTGCCCCAGCTCCCACAGG + Intronic
999133609 5:149302599-149302621 CTTGCAGTTCCAGCTCCCACAGG - Intronic
999406098 5:151309032-151309054 CTCACAGCCCTAGCTCGCTCTGG + Intergenic
1000354396 5:160379816-160379838 CTCTCAGTCCCAGCTCCGTGGGG + Intergenic
1000622950 5:163505774-163505796 CTCGGCGCCCCCGCTCCCACCGG - Intronic
1001415384 5:171541790-171541812 TTCCCAGCTCCAGCTCCAACCGG - Intergenic
1001585485 5:172831398-172831420 TTCTTAGCTCCATCTCCCACTGG + Intergenic
1001679309 5:173544457-173544479 GCCACAGCTCCAGCTCCCACTGG + Intergenic
1002098703 5:176846816-176846838 CCAGCAGCCCCAGCTCCCTCCGG - Intronic
1002099882 5:176852121-176852143 CTCTCAGCCGGGGCTGCCACAGG + Intronic
1002422936 5:179159016-179159038 CTCTCAGGACCTGCTCCCACTGG + Intronic
1002613366 5:180435754-180435776 CTCTCAGCCCCCACTCCAGCGGG - Intergenic
1003070187 6:2939640-2939662 CGCACAGCCCCAGTTCCCGCTGG - Intergenic
1005465278 6:26106961-26106983 CTCCCAGCCCCTGCACCCCCTGG - Intergenic
1005935514 6:30517978-30518000 CGCGCAGCCCCTGTTCCCACTGG - Intergenic
1006170499 6:32089203-32089225 CCCACAGCCCCAGCTCTCACTGG + Intronic
1006400754 6:33815854-33815876 CTCTGCATCCCAGCTCCCACTGG - Intergenic
1006912408 6:37571963-37571985 CTCCCAGCCTCAGCTGCCAGAGG + Intergenic
1006924738 6:37648158-37648180 CTCTCAGCCCCAGCTCTTCGAGG - Intronic
1007341628 6:41194399-41194421 CACTCAACCCCAGGCCCCACAGG + Intronic
1007357637 6:41332878-41332900 CTCTCTGCCCCAGCTCCAGCAGG - Intergenic
1007387280 6:41528409-41528431 CGCTCAGCCCCCGCTCCCTACGG - Intergenic
1007532360 6:42554239-42554261 CGCGCAGCCCCAGCTCCCGCCGG - Intergenic
1007718153 6:43869363-43869385 CTCACAGCTCCAGCCCCCAGAGG - Intergenic
1008419628 6:51282878-51282900 CTCATTGCCCCAGCTCCCAATGG - Intergenic
1009944764 6:70330493-70330515 CCCTGAGCCCCAGTTCCCACAGG + Intergenic
1010192533 6:73209046-73209068 CTCTCATCCCCACTTCCCAGGGG + Intergenic
1010196082 6:73241492-73241514 CTCTCATCCCCACTTCCCAGGGG + Exonic
1010367251 6:75065692-75065714 TCCTCAGCTCCAGCTCTCACTGG - Intergenic
1011526308 6:88268977-88268999 CTCTCTTCCTCAGCTCTCACAGG + Intergenic
1011828611 6:91341150-91341172 CCCTGAGCCCCAGTTCCCACAGG - Intergenic
1012252455 6:96993795-96993817 TTCTGAGCCCCAATTCCCACAGG + Intronic
1013803998 6:113976636-113976658 CTCTTGCCCCCAACTCCCACAGG - Intronic
1014342788 6:120229686-120229708 TTCTCAGCCCCACCTCCCCATGG - Intergenic
1014743289 6:125170579-125170601 CTCTGAGCCCCAGTTCCAAAAGG - Intronic
1016518333 6:144922261-144922283 CTCTCAGCCACAGCAGCTACTGG - Intergenic
1016645303 6:146400045-146400067 CTCTCTGACCCAGCCCCCAGGGG - Intronic
1017816020 6:158017265-158017287 ATTTCAGCCTCAGCTCCCCCAGG - Exonic
1018390311 6:163336518-163336540 CTCCCACCCCCAGCAGCCACAGG + Intergenic
1018748734 6:166782746-166782768 CTCCCAGCCCCAGCTCAGCCCGG + Intronic
1019349946 7:549963-549985 CTCTCAGCCTCATCTCCCCTGGG + Exonic
1019379588 7:713878-713900 CCCTCACCCTCAGCACCCACTGG + Intronic
1019387821 7:768369-768391 CTGTGAGCCGCAGCTCACACTGG + Intronic
1019481338 7:1268254-1268276 CTCCCAGACCCAGCTGCTACAGG - Intergenic
1019709806 7:2513047-2513069 CTCCCAGCCCCAGCCCACAGTGG + Intronic
1019931074 7:4223510-4223532 CTGTCAGCCCCAGATCACCCAGG - Intronic
1020807383 7:12807512-12807534 CTCCCACCTCCACCTCCCACAGG + Intergenic
1022494342 7:30843807-30843829 CCCACAGCCCCAGGACCCACTGG - Intronic
1022575829 7:31496099-31496121 CACTCAGACTCAGCACCCACTGG - Intergenic
1023075183 7:36474678-36474700 CTCTCTGGCCAAGCTCCCTCAGG + Intergenic
1023222137 7:37930234-37930256 GTCACAGCCCCAGCTCTCTCAGG + Intronic
1023794435 7:43780175-43780197 ATCTCAGTCACAGCTGCCACAGG + Intronic
1023938474 7:44755806-44755828 CTCTAAACCCCAGTTTCCACGGG + Intronic
1024260702 7:47571958-47571980 CTCTCACCGCCAGGGCCCACAGG + Intronic
1024553902 7:50586379-50586401 ATCTCTGCCACAGCTCTCACAGG + Intergenic
1026670367 7:72385529-72385551 TTCTCATCCCCAGGTACCACAGG + Intronic
1026828166 7:73596638-73596660 CTCTCACCCCCAGCGCCCAGCGG - Exonic
1027291535 7:76717277-76717299 TCCTCAGCCGCAGCTCCAACAGG + Intergenic
1027572116 7:79882647-79882669 CCCTGAGCCCCAGTTCCAACAGG - Intergenic
1028846872 7:95491382-95491404 CTCCCACCCCTAGCTCCCATGGG + Intronic
1029221663 7:98995228-98995250 CACCCGGCCCCATCTCCCACCGG - Intronic
1029271587 7:99380249-99380271 CTCTCAGCCAATGCTGCCACAGG - Intronic
1029381363 7:100217316-100217338 TTCTCAGCAGCACCTCCCACTGG + Intronic
1029400793 7:100344626-100344648 TTCTCAGCAGCACCTCCCACTGG + Intronic
1033661708 7:143407545-143407567 CTCTCCACCCCATTTCCCACTGG + Intronic
1034264476 7:149774210-149774232 CCCTCAGCCCCAGCTCCTCAGGG + Intergenic
1034276896 7:149827802-149827824 CGCAGAGCCCCAGCTCCCCCGGG - Intergenic
1034349225 7:150405548-150405570 CTGCAAGCCCCAGCTCCCAGAGG - Intronic
1034671498 7:152862258-152862280 CTCTCAGCTCCACCTCCCCTCGG - Intergenic
1035170556 7:157015132-157015154 CTTTAAGGCCCAGCTCCCAGGGG - Intergenic
1035171789 7:157021313-157021335 CGCTCAGCCCCCACCCCCACAGG + Intergenic
1035175478 7:157046910-157046932 CTCACAGCCCCAGCTGCCTGTGG - Intergenic
1035356120 7:158276873-158276895 CCCTCGGCCCCAGCTCACAGTGG - Intronic
1035400965 7:158565417-158565439 ATCTCAACCCCAGGTGCCACAGG + Intronic
1036235988 8:7039963-7039985 CTCTCTACCCCAGCTCCTATAGG - Intergenic
1036273359 8:7328079-7328101 CCCTCACCCCCAGCCCCCAACGG - Intergenic
1036347990 8:7982273-7982295 CCCTCACCCCCAGCCCCCAACGG + Intergenic
1036843276 8:12142544-12142566 CCCTCACCCCCAGCCCCCAACGG + Intergenic
1036864638 8:12384859-12384881 CCCTCACCCCCAGCCCCCAACGG + Intergenic
1036979942 8:13459567-13459589 CTCCCAGCCCCTGCCCCCATTGG - Intronic
1037842561 8:22255773-22255795 CCCACAGCCCCAGCTGCCTCTGG + Intergenic
1040391405 8:46953635-46953657 CTCTCAGCTCCACCACTCACTGG + Intergenic
1040556152 8:48478957-48478979 CTCTGACCCCCACTTCCCACTGG - Intergenic
1041914444 8:63125954-63125976 CTCACAGCCCCCGCTCGCTCTGG + Intergenic
1041914490 8:63126119-63126141 CGCTCAGCCCCGGTTCCCGCTGG - Intergenic
1042568332 8:70135097-70135119 CTGTGAGCTCCAGCTACCACGGG + Intronic
1043218592 8:77628500-77628522 TTCTCAGTCTCACCTCCCACAGG + Intergenic
1043542772 8:81281292-81281314 CTGTCAGCCCCGTCTCCCCCAGG + Intronic
1043731972 8:83694306-83694328 CGCGCAGCCCTAGTTCCCACTGG + Intergenic
1044520217 8:93190471-93190493 TTCTCAGTCCCAGCTCCAGCTGG + Intergenic
1046049829 8:109009741-109009763 CCCTCAGCTCCTGTTCCCACAGG + Intergenic
1047097373 8:121639862-121639884 ACCTCCACCCCAGCTCCCACAGG + Intronic
1047228078 8:122973397-122973419 CTCTCAGACGCACCTCCCAGAGG + Exonic
1047402323 8:124557461-124557483 CCCTCAGCCCCAGCTACCTGTGG + Intronic
1048256398 8:132908223-132908245 CTTTCAGCTCCAGCTCCCGCCGG + Exonic
1048497519 8:134947408-134947430 CTCAGTGCCCCAGCTCCCAATGG + Intergenic
1048949080 8:139478097-139478119 CTCACAGCCACAGCCTCCACTGG - Intergenic
1048957863 8:139551729-139551751 CCCTCAGCCACAGCTTCTACTGG - Intergenic
1048980565 8:139701753-139701775 GTACCTGCCCCAGCTCCCACAGG + Intronic
1049016465 8:139923534-139923556 ATCTCAGCCCCACCTCCACCTGG + Intronic
1049497642 8:142943864-142943886 CTCTGGGCCCCACCTCCAACTGG - Intergenic
1049687546 8:143944964-143944986 CTCGGTCCCCCAGCTCCCACAGG + Intronic
1049780444 8:144426327-144426349 CTCTGTGCTCCAGCTCCCTCTGG - Intronic
1050192853 9:3046605-3046627 CTGTGAGCTCCAGTTCCCACAGG - Intergenic
1051001670 9:12290386-12290408 CACTTGTCCCCAGCTCCCACAGG - Intergenic
1051358703 9:16263155-16263177 GTCTCAGCCCCTGCTCTCCCAGG - Intronic
1052342243 9:27375236-27375258 CTCCCAGCCCCAGCAAGCACTGG + Intronic
1052985387 9:34483115-34483137 CACTCAGCCCCGGTTCCCGCTGG + Intronic
1053010574 9:34630595-34630617 CTCTCAGCCTCAGCTTGCTCTGG + Intergenic
1053122101 9:35555266-35555288 GTCTCAGTCCCAGCTCCCTCAGG + Exonic
1054882506 9:70159821-70159843 CTCTCTGGCCCACCTCCCATAGG - Intronic
1055290535 9:74778259-74778281 CTCTGAGCTGCAGCCCCCACAGG + Intronic
1056761367 9:89417779-89417801 CTCTCGGCCTCTCCTCCCACTGG - Intronic
1056836908 9:89962781-89962803 AACTCAGCCCCAGGCCCCACTGG - Intergenic
1056953281 9:91062790-91062812 CCCTGAGCCCCAGATCCCCCAGG - Intergenic
1057257115 9:93558559-93558581 CTCTCTACCCCGGGTCCCACAGG + Exonic
1057293297 9:93820612-93820634 CTAGCAGCCCCAGCTCCCCAGGG + Intergenic
1057311465 9:93945838-93945860 GTCTCGGTCCCAGCTCCCTCGGG + Intergenic
1057583602 9:96309580-96309602 CTTTCAACCCCAGCACCCCCTGG - Intergenic
1057821212 9:98332480-98332502 CTCTGAGCCCCAGTGCCCATAGG - Intronic
1058447088 9:105064086-105064108 CTTTCAGCCTCAGCTGCCTCTGG + Intergenic
1058657910 9:107241573-107241595 GATACAGCCCCAGCTCCCACAGG + Intergenic
1058835430 9:108855451-108855473 CGCTCAGCCCCAGCAGCAACCGG - Exonic
1059405898 9:114098303-114098325 CGCGCAGCGCCAGCTCCCCCAGG + Intronic
1059532453 9:115048350-115048372 CTCTAAGCTCCAGCTTCCTCTGG + Exonic
1059556844 9:115289896-115289918 CTGTCAGCCACAGCCCACACTGG + Intronic
1060177661 9:121509039-121509061 CTCTTACCCCCAAGTCCCACGGG - Intergenic
1060267365 9:122120190-122120212 CCCAGAGACCCAGCTCCCACTGG + Intergenic
1060883228 9:127133255-127133277 CCCTCAGCCCCAGTCCCCAAGGG + Intronic
1060958849 9:127664663-127664685 CTACCAGCCTGAGCTCCCACAGG - Intronic
1060975808 9:127764363-127764385 CTATCACCACCACCTCCCACTGG + Intronic
1061304439 9:129724286-129724308 CCCTCCACCCCAGCCCCCACTGG - Intergenic
1061629456 9:131862934-131862956 CTGGCAGCCCCATCTCCCACTGG + Intronic
1061799789 9:133107492-133107514 CACCAAGCCCCAGCTCCAACAGG + Intronic
1062268404 9:135697908-135697930 TCCTCAGCCCCAGCACTCACGGG + Intronic
1062473675 9:136717498-136717520 CTCTCAACCCCACTTCCCACAGG - Intronic
1062730389 9:138105218-138105240 CTCTGGGGCCCAGCTCCCAGTGG - Intronic
1186295670 X:8145258-8145280 CGCGCAGCCCCAGTTCCCACCGG + Intergenic
1191927463 X:66329123-66329145 CTTGCAGCCCCGGCTCCCACTGG - Intergenic
1193557441 X:82973676-82973698 CTTACTGCCCCAGCTGCCACTGG + Intergenic
1194644434 X:96441341-96441363 TTCCCAGCTCCAGCTCTCACTGG + Intergenic
1194948748 X:100099397-100099419 TCCTCAGCCCCAATTCCCACAGG - Intergenic
1195671654 X:107475008-107475030 CTATCAGGCCCACCTCCAACAGG + Intergenic
1195747390 X:108132308-108132330 CTCTCATCCCCAAGTCCAACTGG - Intronic
1196118325 X:112021111-112021133 GTTTCTACCCCAGCTCCCACAGG - Intronic
1197750396 X:129959928-129959950 CTCTCAGACCCACCTCCAACTGG + Intergenic
1197758281 X:130011191-130011213 CTCCCACCCACAGCTCCCAAGGG + Intronic
1197809594 X:130429607-130429629 CTCTCAGCATCAGCTCTCATTGG + Intergenic
1199833061 X:151563131-151563153 CACGCAGCCCCAGTTGCCACCGG + Intergenic
1199862810 X:151817047-151817069 CTCTCATCCCCACTTCCCCCAGG + Intergenic
1200228241 X:154431214-154431236 CTCCCATCCCCAGCTTCCTCTGG - Intronic
1202085935 Y:21136804-21136826 CCCTCAGCCCCACCCCCAACAGG + Intergenic
1202202460 Y:22367511-22367533 CGCACAGCCCCAGTTCCCACAGG + Intronic