ID: 1091700342

View in Genome Browser
Species Human (GRCh38)
Location 12:2654882-2654904
Sequence TCTCAGCCCCAGCTCCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 422}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091700336_1091700342 -3 Left 1091700336 12:2654862-2654884 CCGGTCCCAGCATCCACCGCTCT 0: 1
1: 0
2: 0
3: 24
4: 223
Right 1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG 0: 1
1: 0
2: 2
3: 40
4: 422
1091700334_1091700342 15 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG 0: 1
1: 0
2: 2
3: 40
4: 422
1091700332_1091700342 22 Left 1091700332 12:2654837-2654859 CCTGTGTCCTGTCAGAAGCAGGA 0: 1
1: 0
2: 0
3: 35
4: 280
Right 1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG 0: 1
1: 0
2: 2
3: 40
4: 422
1091700335_1091700342 -2 Left 1091700335 12:2654861-2654883 CCCGGTCCCAGCATCCACCGCTC 0: 1
1: 0
2: 5
3: 19
4: 239
Right 1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG 0: 1
1: 0
2: 2
3: 40
4: 422
1091700337_1091700342 -8 Left 1091700337 12:2654867-2654889 CCCAGCATCCACCGCTCTCAGCC 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG 0: 1
1: 0
2: 2
3: 40
4: 422
1091700338_1091700342 -9 Left 1091700338 12:2654868-2654890 CCAGCATCCACCGCTCTCAGCCC 0: 1
1: 0
2: 0
3: 33
4: 402
Right 1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG 0: 1
1: 0
2: 2
3: 40
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091700342 Original CRISPR TCTCAGCCCCAGCTCCCACT GGG Intronic
900384891 1:2406003-2406025 GCCCCGCCCCAGCCCCCACTGGG - Intronic
900541806 1:3206644-3206666 CCTCAGACCCAGCTCACCCTAGG - Intronic
901130735 1:6961528-6961550 GCTCAGCCCAGGCTGCCACTGGG - Intronic
901458378 1:9376876-9376898 TCTCAGCCCCTCCTCACTCTGGG + Intergenic
902188017 1:14740108-14740130 CCACAGCCCCAGCACACACTCGG - Intronic
902636688 1:17739435-17739457 TCTCAGCCCCAGCTGCACCCGGG + Intergenic
903034634 1:20485933-20485955 TTTCAGCCCCGTCTCCCTCTCGG - Exonic
903135137 1:21304371-21304393 CCTCAGCCCCAGCCACCACGTGG - Intronic
903215249 1:21840069-21840091 TGTCAGCCCCAGCTCTGGCTTGG + Intronic
903437504 1:23362334-23362356 TTTCAGCCGCATCTCACACTTGG - Exonic
904237229 1:29123481-29123503 TCTCAGCCCCGGCTCCAGCAAGG + Intronic
904443668 1:30550600-30550622 TCCCAGGCCCAGCTCCGCCTTGG - Intergenic
904467005 1:30714215-30714237 CCCCAGCCCCAGCCCCCTCTGGG + Intronic
905655179 1:39682304-39682326 TTCTAGCCCCACCTCCCACTTGG - Exonic
906244497 1:44263413-44263435 TCTCAGCCCAAGGTCACAGTAGG + Intronic
907383989 1:54113936-54113958 CCTCAGCCCCTGCTGCCCCTGGG - Intergenic
907556587 1:55349577-55349599 TCTCAGCACCCGCTGCCACCAGG + Intergenic
908974413 1:69880298-69880320 TCTCACCTCCAGCTCCCACAAGG - Intronic
910892111 1:92029335-92029357 TCTCAGCCTCAGCACCGACATGG - Intergenic
911259682 1:95670143-95670165 TCACAGCCCTCGCTCCCTCTCGG - Intergenic
912069839 1:105795917-105795939 GCGCAGCCCCGGCTCCCGCTGGG - Intergenic
914898108 1:151695126-151695148 TCTCCTCCCCAGCACCCTCTTGG - Exonic
914927986 1:151905981-151906003 TCACAGCCCTCGCTCCCTCTCGG + Intronic
914963112 1:152224396-152224418 TCTCAGCCCCACCTGCCAAAGGG + Intergenic
915213574 1:154326442-154326464 ACCCAGCCCCAGCCCCCTCTCGG - Intronic
917565344 1:176207084-176207106 CCTCAGCCCCACCTCCGGCTCGG - Exonic
918058923 1:181045679-181045701 TCACAGCCCTAGCTCGCTCTTGG + Intronic
918904568 1:190476057-190476079 TCTCAACCCCCGTTCCCTCTCGG + Intronic
919878879 1:201889285-201889307 TCTCAGCCCCAGAGCCCCCGAGG - Intronic
921403853 1:214757451-214757473 ACTAAGCTCCATCTCCCACTTGG - Intergenic
922551143 1:226495484-226495506 ATTCAGCCCCAGCTCCTCCTGGG + Intergenic
922671322 1:227510369-227510391 TCCCAGCCCCTGCTCCCTCCTGG - Intergenic
922706828 1:227794644-227794666 TCTCCTCCCCAGCACCCAGTGGG - Intergenic
922854246 1:228760467-228760489 TGGCAGCCCCATCTCCCTCTAGG - Intergenic
924243757 1:242062349-242062371 TCCCAGCCCCTGCTCCCTCCTGG - Intergenic
1063541927 10:6942758-6942780 GATCAGCCCCAGCTCCCACCTGG + Intergenic
1066632387 10:37469809-37469831 TTTCAACCCCAGCTCCGCCTAGG - Intergenic
1067476901 10:46573287-46573309 TCTCAGCCCTTCCTCTCACTGGG + Intergenic
1067617836 10:47768493-47768515 TCTCAGCCCTTCCTCTCACTGGG - Intergenic
1069553695 10:69382699-69382721 CCTCAGCCCCAGCTCCATCTCGG - Exonic
1069832629 10:71290563-71290585 TTTCAGCCCCAGCACTCACAGGG + Intronic
1071492860 10:86147898-86147920 TCTATGCCCCAGAGCCCACTGGG + Intronic
1073457501 10:103646539-103646561 TCCCACCCCCAGCACCCACAGGG + Intronic
1073553979 10:104429933-104429955 TGACAGCCCCTCCTCCCACTCGG + Intronic
1073882701 10:108001967-108001989 CCTCTTCCCCAGCTTCCACTGGG + Intergenic
1076131128 10:128014718-128014740 TCTCAACCCCAGCTTCACCTTGG + Intronic
1076611036 10:131725990-131726012 TCCCGGACCCATCTCCCACTCGG - Intergenic
1077047059 11:551332-551354 GCTGAGCCCCAGCTCCCCCCAGG + Intronic
1077048110 11:555111-555133 TCTCAGCCCCCGCGCCCCCCAGG - Exonic
1077050317 11:563484-563506 TCTGTGCCCCACCTCCCCCTGGG + Intronic
1077268812 11:1665662-1665684 TCTCACCCTCACCTCCCTCTGGG - Intergenic
1077271941 11:1685518-1685540 TCTCACCCTCACCTCCCTCTGGG + Intergenic
1077351042 11:2093310-2093332 TCACAGCCTCACCACCCACTGGG - Intergenic
1077412339 11:2409495-2409517 GCTCAACCCCAGCTCCGGCTCGG + Intronic
1077931426 11:6737143-6737165 TTTGAGCCCCACATCCCACTGGG - Intergenic
1078634083 11:13032824-13032846 TCTCACCTCCCGCCCCCACTTGG - Intergenic
1079138941 11:17794941-17794963 CCTCAGCCCCAGCGCTCACAGGG - Intronic
1080402218 11:31946736-31946758 TCCAAGCCACAGGTCCCACTTGG - Intronic
1081788771 11:45767905-45767927 TCTCAGCTCCATTTCCCTCTGGG + Intergenic
1081998431 11:47378709-47378731 TCTCAGTCCCAGCTTCCTCTGGG - Intergenic
1082095602 11:48126990-48127012 CCACTGCCCCAGCTCTCACTGGG - Intronic
1083267268 11:61552406-61552428 TCCCAGCCCATTCTCCCACTGGG + Intronic
1083770291 11:64863428-64863450 AGTCAGCAGCAGCTCCCACTGGG - Intronic
1083783286 11:64929276-64929298 ACTGAGCACCAGCACCCACTGGG + Intronic
1084556575 11:69879479-69879501 TCCCACCCCCACCTCCCCCTGGG - Intergenic
1084578984 11:70010712-70010734 TCAAAGCCCCCGCTCCCACCAGG + Intergenic
1084645192 11:70452733-70452755 CCTCAGCCCCAGAACCCACAGGG - Intergenic
1084840702 11:71843968-71843990 ACACAGCCCCGGCTCCCACCAGG + Intergenic
1085462316 11:76701514-76701536 TCTTGGCCTCAGATCCCACTAGG + Intergenic
1085619985 11:78030701-78030723 TCTGAGTCCCAGCTGCCATTTGG - Intronic
1085735376 11:79034325-79034347 TCTCAGCCCCAGCATGCAGTGGG - Intronic
1085739249 11:79064973-79064995 TTCCAGCCCCAGCTCCCGCAGGG + Exonic
1086594983 11:88559988-88560010 TCTCACCCTCAACTCTCACTTGG - Intronic
1087407389 11:97746131-97746153 TCTCAGCCCTGGCTCGCTCTCGG - Intergenic
1089579008 11:119469803-119469825 TCTCAGGCCAAGTTCCCACCTGG + Intergenic
1089647603 11:119890373-119890395 GCTCAGCCCCCACACCCACTCGG - Intergenic
1091317346 11:134623928-134623950 TCCCAGCCCCAGCTCTTACCTGG + Intergenic
1091645547 12:2269852-2269874 TCCCAGCTACAGCTCCCACCAGG - Intronic
1091700342 12:2654882-2654904 TCTCAGCCCCAGCTCCCACTGGG + Intronic
1091797510 12:3305720-3305742 ACTCAGGCTCAGCTCCCAGTTGG - Intergenic
1091977443 12:4836789-4836811 TATCAGACACTGCTCCCACTGGG - Intronic
1092471687 12:8787111-8787133 TCACAGCCCTCGCTCCCTCTTGG + Intergenic
1092915127 12:13182562-13182584 TCTCAACCCCATGTCCCCCTGGG - Intergenic
1093346203 12:18040127-18040149 CCTCAGCCTTAGCGCCCACTCGG + Intergenic
1094494459 12:30980684-30980706 ACTCAGGCCCAGCTCCCAGTGGG + Intronic
1094596518 12:31871361-31871383 TTTCACCCCCAGCGCCCACTTGG + Intergenic
1094813326 12:34162693-34162715 TCCCAGCCCCTGCTCCCTCCTGG + Intergenic
1095103588 12:38205832-38205854 TCCCAGCCCCTGCTCCCTCCTGG - Intergenic
1095974096 12:47927478-47927500 CCTCAATCCCACCTCCCACTCGG - Intronic
1095974206 12:47928241-47928263 CCTCACTCCCATCTCCCACTCGG - Intronic
1096500720 12:52062578-52062600 TCCCAGGCCCAGCTCACACAAGG - Intergenic
1097984353 12:65768043-65768065 TCTCAGCCACATCTCCTATTTGG - Intergenic
1101570458 12:105948879-105948901 ACTCAGCACCATCTCCCATTGGG + Intergenic
1102197530 12:111035351-111035373 TCCCAGCCCCGGCTCCTACGGGG - Intronic
1102507405 12:113392358-113392380 TCTCAGCCCCAGCTCTCAACTGG - Intergenic
1102532984 12:113560328-113560350 TCACATCCCCAGCTCCTGCTGGG + Intergenic
1102634508 12:114311430-114311452 CCATGGCCCCAGCTCCCACTGGG - Intergenic
1102654126 12:114466058-114466080 TCTCACCACCTGCTCCCAATTGG + Intergenic
1102818085 12:115885173-115885195 TCTCGGCCCCAGATGCCACCTGG + Intergenic
1103191226 12:119003687-119003709 TGTCACCCCCAGCTCCCCCAGGG + Intronic
1103912781 12:124361426-124361448 TCTCTGCCCCACTTCCCACTAGG - Intronic
1104055388 12:125226271-125226293 TTCCAGCCCCAGCTCCACCTTGG + Intronic
1104523086 12:129493733-129493755 TCTCAGCCCCAGCTTCCTCCAGG - Intronic
1105708528 13:22983352-22983374 GCTCAGCCACAGCTGCCACCTGG + Intergenic
1106405823 13:29471914-29471936 TCACAGCGCCAGCTCCCTTTTGG + Intronic
1108597034 13:51958403-51958425 TCTCAGCCACAGCAACCACCAGG + Exonic
1110428752 13:75399304-75399326 TCTCAGCCTCAGCTCTCATTGGG - Intronic
1110751478 13:79120136-79120158 TCACAGCCCTCGCTCCCTCTAGG - Intergenic
1112018904 13:95354474-95354496 GCTCATCCCCAGCTCCACCTTGG - Intergenic
1112234801 13:97625540-97625562 TCTCAGCCCTGGCTCCAACTGGG - Intergenic
1115309641 14:31966255-31966277 GCTCAGCCACAGCTAACACTAGG + Intergenic
1115400484 14:32953724-32953746 TCTGAGCCCCAGTTCCCACAGGG + Intronic
1116376310 14:44206585-44206607 TCTGAGCCCCAATTCCCACAAGG - Intergenic
1117965764 14:61205500-61205522 TCACATCTACAGCTCCCACTGGG - Intronic
1118765081 14:68904217-68904239 TCTATGCCCCAGCTCTGACTGGG - Intronic
1119036040 14:71231258-71231280 GCTTGTCCCCAGCTCCCACTGGG - Intergenic
1119633714 14:76256925-76256947 TCTCCTCCCCATCTCCCAATGGG + Intergenic
1120390885 14:83907096-83907118 TCTCAGCCTCAGTTTCCTCTAGG + Intergenic
1120632392 14:86905946-86905968 TCACAGCCCTCGCTCCCTCTTGG - Exonic
1122632298 14:103112540-103112562 TCCCAGCCCCAGCCACCGCTGGG - Intergenic
1122736728 14:103847667-103847689 TCCCCGCCCCCGCTCCCACCGGG - Intergenic
1122999333 14:105283921-105283943 GCGCAGCCCCAGCCCCCACCTGG + Intronic
1128107659 15:65056296-65056318 TCTCAGCCCCTGCTCCTGCCAGG - Intronic
1128482871 15:68054691-68054713 CCCCAGCCCCAGCTCCCCATGGG - Intronic
1128570034 15:68727038-68727060 TCTCAGCCTCAGCTTCCAGGAGG - Exonic
1129266922 15:74398116-74398138 ACTCAGCACCAGCCACCACTGGG + Intergenic
1129461048 15:75700275-75700297 TCTCACACCCTCCTCCCACTGGG - Intronic
1129506229 15:76083737-76083759 TCACAGCCCCTGCTCCCATGAGG - Intronic
1129723772 15:77891450-77891472 TCTCACACCCTCCTCCCACTGGG + Intergenic
1129742170 15:77994571-77994593 GCTCAGGCCCAGCTGCCACTGGG - Intronic
1129843311 15:78756909-78756931 GCTCAGGCCCAGCTGCCACTGGG + Intergenic
1130536291 15:84787254-84787276 GCTCTTCTCCAGCTCCCACTAGG - Intronic
1131284254 15:91044152-91044174 CCTCACCCCCACCCCCCACTTGG - Intergenic
1131943889 15:97597983-97598005 TCTAATCCCCAGCTCTCCCTGGG + Intergenic
1132686240 16:1163301-1163323 TCCCAGGCCCTGCTCCAACTGGG - Intronic
1133259155 16:4537603-4537625 TCTCAGCCCCAGCTGCGCCCGGG + Intronic
1133338599 16:5022367-5022389 TCTCAGGCCCACCTGCAACTTGG + Intergenic
1135042293 16:19127071-19127093 TCTCAGCTCCACCTGTCACTGGG + Intronic
1135622565 16:23968432-23968454 TCTTAGCCCCAGCTCTCAATAGG - Intronic
1136218176 16:28809688-28809710 GCTCAGCCCCAGCTCACAGAGGG + Intergenic
1136525501 16:30827010-30827032 TCTAAGCCACATCTCCCACCTGG + Intergenic
1137043976 16:35639369-35639391 TCTCAGCCCCAGCTGGGCCTTGG + Intergenic
1137792295 16:51185337-51185359 GCTCAGCCTCAGCTTCCACGGGG + Intergenic
1138111490 16:54327786-54327808 CCTCAGGCCCAGGCCCCACTTGG - Intergenic
1138286797 16:55816445-55816467 TCCCACCCCCACCTCCCAGTGGG - Intronic
1138419528 16:56890225-56890247 CTTCTCCCCCAGCTCCCACTGGG - Intronic
1139600226 16:67982121-67982143 TCACAGCCCTCGCTCCCTCTCGG + Intergenic
1140912757 16:79468603-79468625 GCTCAGCCCCAGCTCACCCTGGG + Intergenic
1140919555 16:79524452-79524474 TCTCATGCCGAGCTCCCATTTGG - Intergenic
1141655889 16:85416387-85416409 TCTCACCACTTGCTCCCACTTGG - Intergenic
1141805844 16:86340947-86340969 GCACAAGCCCAGCTCCCACTTGG + Intergenic
1142150793 16:88511772-88511794 TCTTAGCCCCAGCTCACCCCAGG - Intronic
1142609413 17:1100421-1100443 TCTCAGCTCCAGCTCTCAAAAGG - Intronic
1142767927 17:2076075-2076097 TTACAGCCCCAGATCTCACTTGG + Intronic
1143028240 17:3953401-3953423 TTCCAGCACCAGCTCCCACAGGG + Exonic
1143118340 17:4592965-4592987 TCTCAGCACCAGATCCCCCCAGG + Exonic
1143296657 17:5876355-5876377 TCTGAGGCTCAGCTCCCACCAGG + Intronic
1143758964 17:9087526-9087548 TCTCAGCTCCACTGCCCACTGGG - Intronic
1143978146 17:10845241-10845263 ACTCAGCCCCAGCTCCTTCCTGG - Intergenic
1143985261 17:10907609-10907631 TCACAGCCCAGGCTCGCACTGGG - Intergenic
1144029254 17:11304796-11304818 CCTCATCCCCAGCTCCTACCGGG - Intronic
1144386256 17:14751466-14751488 GCTCAGCCCCAATTCCCCCTGGG - Intergenic
1144495666 17:15743277-15743299 TACCAGGCCCACCTCCCACTGGG - Intronic
1144632831 17:16882665-16882687 TACCAGGCCCACCTCCCACTGGG + Intergenic
1144726181 17:17503849-17503871 CATCAGTCCCAGCCCCCACTGGG - Intergenic
1144796348 17:17893841-17893863 TGTCTTCTCCAGCTCCCACTGGG - Intronic
1145263760 17:21369635-21369657 GCTCATCCCCAGCCCACACTGGG + Intergenic
1146225289 17:31060699-31060721 TCTTACCCCCAGCTCCTCCTGGG - Intergenic
1146659304 17:34653742-34653764 TCTCACCCCCAGCTCTCAGCAGG + Intergenic
1146725761 17:35154600-35154622 TCTCAGCCCCTGCTTCCTCACGG - Exonic
1146839847 17:36143627-36143649 TCACAGCCCCAGCTCCCCTGAGG + Intergenic
1146931324 17:36780188-36780210 TCTTAGCCACAGCTCCCCCAGGG + Intergenic
1147157399 17:38551154-38551176 CCTGAGCCCCTCCTCCCACTGGG + Exonic
1147327369 17:39675924-39675946 TCTCAGCCCAAGCTTCCCCCGGG + Intronic
1149039571 17:52171744-52171766 TCTCAGAACCAGCTTCCACTAGG - Intergenic
1149529454 17:57383153-57383175 TCTGAGCCACAGATGCCACTTGG + Intronic
1150839650 17:68595877-68595899 TCCCTGCCCCAGCTCCCCCATGG - Intronic
1151680433 17:75620092-75620114 TCCCAGCCCCTGCCCCCACAGGG - Intergenic
1151825763 17:76523357-76523379 TCACAGCCCCAGCTCGCCCGGGG + Intergenic
1151866350 17:76805975-76805997 TCTCAGCCCTCGCTCGCTCTTGG + Intergenic
1151903553 17:77033554-77033576 TCTCACCCCAACCCCCCACTGGG + Intergenic
1152876341 17:82788621-82788643 CCTCACTCCCAGCTCCCGCTCGG + Intronic
1154255396 18:12777367-12777389 TCGCAGCCCTCGCTCCCTCTCGG - Intergenic
1154301226 18:13194399-13194421 CCTGAGCCCCAGTTCCCACAGGG - Intergenic
1155623422 18:27807518-27807540 TCTCTGCTCCATCTTCCACTGGG + Intergenic
1156038584 18:32794420-32794442 TCACAGCCCCCGCTCCCTCTCGG + Intergenic
1156493621 18:37511434-37511456 TCTCAGGCCCAGCTCAGCCTGGG + Intronic
1156496536 18:37529495-37529517 GCTCAGCACCAGCTCCCAAATGG + Intronic
1156842945 18:41630710-41630732 TCTCAGCCCTACCTACCACATGG - Intergenic
1157135177 18:45047170-45047192 TCACAGCCAAACCTCCCACTGGG - Intronic
1157621739 18:49020939-49020961 TCTGGGCCCCAGCTCACACAGGG - Intergenic
1157858451 18:51121433-51121455 TCGCAGCCCTCGCTCACACTTGG - Intergenic
1157959712 18:52139441-52139463 TCTGAGCCCCAGTTCCCACAGGG + Intergenic
1160375114 18:78405840-78405862 TCTATGCCCCAGGTCCCACAGGG + Intergenic
1161171028 19:2812587-2812609 CCACAGTCCCAGCTCCCACCCGG - Intronic
1162152213 19:8654785-8654807 TCTCAACCCCAGCCCCGCCTCGG + Intergenic
1163350050 19:16770947-16770969 CCATAGCCCCAGCTCCCACAGGG + Intronic
1163501666 19:17680026-17680048 TCTGAGACCCCTCTCCCACTGGG - Intronic
1163716942 19:18878415-18878437 TCCCAGCCCCAGCTCCTGTTTGG + Exonic
1164674455 19:30092165-30092187 GCTCAGCCCCAGCTCTGATTGGG + Intergenic
1164934796 19:32202114-32202136 TGGGTGCCCCAGCTCCCACTTGG - Intergenic
1165132457 19:33641400-33641422 TCTCCGCCCCACCACCCCCTGGG + Intronic
1165461356 19:35945909-35945931 TCCCTGCCCCAGCTTCCCCTGGG - Intergenic
1166075673 19:40412589-40412611 TCTCAGCCAAAGCTCCCCTTTGG - Intronic
1166332538 19:42087479-42087501 TCTCAGCCCCAACTCCTACTGGG + Intronic
1166389899 19:42402974-42402996 GCCCAGCCCCAGGGCCCACTGGG - Exonic
1167036065 19:46995640-46995662 GCCCAGCCCCACCTTCCACTCGG + Intronic
1167196143 19:48030204-48030226 TCTCTTCCCCAGCTTCCCCTTGG - Exonic
1167341804 19:48920999-48921021 TCCCACTCCCACCTCCCACTTGG + Intronic
1167793751 19:51695816-51695838 TCACGGCCCCAGCCCCCACTCGG - Intergenic
1167998939 19:53429494-53429516 TCTCAGCCCAGGCTTCCAGTTGG + Intronic
1168071871 19:53958128-53958150 TCCCAGCCCCAGCCCCATCTCGG + Intergenic
1168336198 19:55599183-55599205 GCTCCGCCCCAGCAGCCACTAGG + Intronic
925856809 2:8137016-8137038 TCTCAGCCCCAGCTTACCCATGG + Intergenic
926056566 2:9777327-9777349 TCTCAGCACCAGCTCCCGGGGGG - Intergenic
926459618 2:13112423-13112445 TCTCTGCCCCAGCTCTTCCTTGG - Intergenic
926990770 2:18677315-18677337 TGTCTGACCCAGCTCCCACCTGG - Intergenic
930742676 2:54847935-54847957 TTGCTGCCCCAGCCCCCACTGGG + Intronic
932211641 2:69936364-69936386 TCACAGCCCCAGCACCTCCTAGG + Intronic
932731002 2:74221942-74221964 TCCCAGCCTCAGCTCCCTATAGG - Intronic
932803602 2:74764398-74764420 TCTGTGCCTCATCTCCCACTGGG - Intergenic
933811014 2:86032725-86032747 TCTCATCCCCACCTGCAACTGGG - Intronic
934127853 2:88915836-88915858 TGTTAGCCCCAACTCCCACTGGG - Intergenic
934808884 2:97265122-97265144 TCTCAGCCCCAGACACCAGTGGG - Intergenic
934828621 2:97492047-97492069 TCTCAGCCCCAGACACCAGTGGG + Intergenic
934876413 2:97924699-97924721 TCTCAGCCCCAGCTCCGCATTGG - Intronic
935849127 2:107199495-107199517 CCTCAGCCTCATCTCTCACTGGG + Intergenic
938266321 2:129930774-129930796 TCTCTGGCCCAGCTCCTGCTTGG + Intergenic
942842099 2:180374636-180374658 TCAAAGCCCCAGTTCCCACCAGG + Intergenic
944966793 2:204944352-204944374 TCTGTCCCCCAGCTCCCGCTAGG + Intronic
945921811 2:215762573-215762595 TTTCTGCACCAGCTCCCACCTGG + Intergenic
946180787 2:217947760-217947782 TCTCAGCCCCAGCCCCACCCAGG + Intronic
946210382 2:218143068-218143090 ACTCAGTCCCGTCTCCCACTTGG + Intergenic
946408456 2:219505035-219505057 TCTCCCACCCAGCCCCCACTTGG - Intronic
946668003 2:222071382-222071404 CCTCAGCCCCAGTTCCCAAAGGG + Intergenic
947501550 2:230674807-230674829 ACTGCACCCCAGCTCCCACTGGG - Intergenic
947505540 2:230705583-230705605 TCTCAGCCACAGCACACACCAGG + Intergenic
947545975 2:231010615-231010637 TCTCAGTCCCATCTCCCCCAAGG - Intronic
948077218 2:235174312-235174334 CCTCAACCCCAGCTCCCAGAAGG - Intergenic
948572410 2:238926000-238926022 TCCCAGCCTCAGCTGACACTCGG - Intergenic
948674427 2:239588688-239588710 TCACAGCTCCAGCTTCCAATTGG + Intergenic
948726074 2:239934896-239934918 TTTCAATCCAAGCTCCCACTGGG + Intronic
1168758105 20:329771-329793 ACTCAGCCCTGGCTCCTACTGGG - Exonic
1169168706 20:3446327-3446349 CCACAGCCCCAGCTTCCACCTGG + Intergenic
1169811164 20:9610803-9610825 TGACAGCCCCACCTCACACTGGG - Intronic
1170136150 20:13075681-13075703 TCTCTGCCCCATCTCCAAATGGG - Intronic
1170572254 20:17639002-17639024 TCACAGCCCCATCTCCTTCTGGG + Intronic
1171412504 20:24956676-24956698 TCTCAGGCCCAGCCCCCAGGAGG - Intronic
1171421204 20:25018940-25018962 TCTCATCCCCATCTCACATTTGG + Intronic
1172659129 20:36555376-36555398 TCTAAGCCCCACCTCACCCTAGG - Intergenic
1173733558 20:45344550-45344572 TCCCAGCCCCATCTCCCTGTTGG - Intronic
1174195425 20:48769429-48769451 TAGGAGCCCCAGCACCCACTAGG + Intronic
1174291765 20:49513877-49513899 TCTCAGCCCTGTTTCCCACTGGG - Intronic
1174773456 20:53322669-53322691 TCCAAGCCCAAGCTGCCACTGGG + Intronic
1175903840 20:62370350-62370372 GCTCAGCCCCCGCTTCCTCTTGG - Intergenic
1177403237 21:20633574-20633596 TCTCAGCCTCTGCTCTCTCTAGG + Intergenic
1178514713 21:33236723-33236745 TAGGAGCCCCAGCTCACACTTGG - Intronic
1178611469 21:34085716-34085738 CCTCAGCCCCAGCTGGGACTGGG + Intronic
1178708161 21:34890589-34890611 TCTCCGCCTCCGCTCCCCCTGGG + Intronic
1179470255 21:41605571-41605593 TCCCAGCCCCACTGCCCACTTGG - Intergenic
1179534678 21:42043917-42043939 TCTGAGCCCCAGCTTCCTCCTGG - Intergenic
1179657019 21:42851929-42851951 GCACAGCACCAGCTCCCTCTGGG + Intronic
1179881452 21:44294874-44294896 TCTCACCCCCAGCCCTCCCTGGG + Intronic
1180942763 22:19670348-19670370 GCTCTGCCCCAGCTCTGACTGGG - Intergenic
1181005036 22:20009281-20009303 CAGCAGACCCAGCTCCCACTAGG + Intronic
1181059737 22:20276621-20276643 TGTCAGCCCCAGCCCGCTCTGGG - Intronic
1181282235 22:21728208-21728230 TCTCCACCTCCGCTCCCACTCGG + Intronic
1181781694 22:25198393-25198415 TCTCACCACCATCTCCCTCTAGG + Intergenic
1182320700 22:29477106-29477128 TCTCAGCCCCTGCTGTCCCTGGG - Intergenic
1182520352 22:30881384-30881406 TACCACCTCCAGCTCCCACTAGG + Intronic
1182662587 22:31935498-31935520 TCTGAGCCTCAGTTCCCACAGGG + Intronic
1182907373 22:33949862-33949884 TCTCAGTCCCTGCTCTCAATAGG + Intergenic
1183639524 22:39084572-39084594 TCACAGACACAGCTCCCACCAGG + Intronic
1184214934 22:43060355-43060377 TGTCAGCCCCTGCTCCCTCCAGG + Intronic
1184249206 22:43250714-43250736 CCTCAGCCTGAGCTCCCTCTGGG - Intronic
1184489080 22:44799052-44799074 TCCCATCCCCAGCCCCCACCTGG + Intronic
1184745004 22:46451056-46451078 CCTCCTCCCCAGCTCCCACCGGG + Intronic
1185413350 22:50697335-50697357 CCCCATCCCCCGCTCCCACTAGG + Intergenic
1185414076 22:50700239-50700261 TCACAGCCACTGCTCCCACAAGG - Intergenic
950015537 3:9752252-9752274 TCTGAACCCCAACTCTCACTTGG + Intronic
950436476 3:12983431-12983453 CCCCAGCCCCACCTCTCACTGGG + Intronic
950644323 3:14368141-14368163 TGCCAGCCCCAGCTCCCCATGGG + Intergenic
950771390 3:15314390-15314412 TCTCAGTCCCAGCTCCTGCTGGG + Intronic
953718662 3:45336667-45336689 TCACAGCCCCAGCTCTCTCAAGG - Intergenic
953720025 3:45347132-45347154 CCACAGCCACAGCCCCCACTGGG - Intergenic
953738072 3:45513369-45513391 TCTAAGCCTCAGCTCCCTCTGGG + Intronic
954410809 3:50370100-50370122 TCACGGCCCTAGCTCCCACCAGG - Intronic
955671102 3:61404182-61404204 TCTCTGCTCCAGGGCCCACTAGG + Intergenic
956481381 3:69677298-69677320 TCACAGCCCTAGCTCGCTCTCGG + Intergenic
956600069 3:71011235-71011257 TCTCATCCCCAGCCCCCATGTGG + Intronic
956754416 3:72370993-72371015 TCTAGGCCTAAGCTCCCACTCGG + Intergenic
958858066 3:99410809-99410831 TCTCACCCTCAGCTCCCAGAGGG + Intergenic
959312874 3:104763080-104763102 TCCCAGGCTCAGCTCCCTCTGGG + Intergenic
959930720 3:111979101-111979123 GCCCAGCCCCAGCTCCGACAAGG - Exonic
960110376 3:113839204-113839226 TCTCAGCCCCAGGCCCCCTTGGG + Intronic
960274213 3:115708735-115708757 TAACAGCCCCACCTGCCACTTGG - Intronic
960526223 3:118713817-118713839 TATCAGCCCCAATTCCCACAGGG - Intergenic
961525171 3:127492206-127492228 TGACAGGCCCAGGTCCCACTGGG - Intergenic
962046730 3:131768045-131768067 TCTCAGCCTCCTCTTCCACTAGG - Intronic
962270391 3:133973935-133973957 TCTGGGCCCCAGCTGACACTGGG - Intronic
964720068 3:159762391-159762413 TCTCAGCACCACATCCCACTAGG + Intronic
966239986 3:177745222-177745244 TCTCAGCCCCGGCTCCCTCCCGG + Intergenic
968071936 3:195789477-195789499 CCTTTGCCCCAGCTCCCACCGGG - Exonic
968869003 4:3231823-3231845 GCTCAGGCCCAGATCCCCCTAGG + Intronic
969332889 4:6490156-6490178 GCTCATCCCCACCTCCCACCTGG + Intronic
969374527 4:6754411-6754433 GGGCATCCCCAGCTCCCACTTGG - Intergenic
969781799 4:9409961-9409983 ACACAGCCCCGGCTCCCACCAGG + Intergenic
970945610 4:21687950-21687972 CCTCAGCCCCAGCACACCCTAGG + Intronic
971263470 4:25077364-25077386 TCTCAAGCCCAGCTCACATTAGG + Intergenic
971555151 4:28003997-28004019 GCTCAGCCCCTGTTCCCAGTGGG + Intergenic
973229296 4:47823770-47823792 TCCCAGCCCCAGCTGCCATGTGG + Intronic
974839409 4:67283307-67283329 CCTCAGCCTCAGCGCCCACTGGG - Intergenic
974892371 4:67897075-67897097 TCTCAGCCCTCGCTCGCTCTTGG - Intergenic
975720965 4:77248275-77248297 TCCAAGACCCAGATCCCACTTGG + Intronic
975817189 4:78230591-78230613 TCTTTGACCCAGCTCCCATTCGG - Intronic
976387941 4:84482143-84482165 TCTACCCCGCAGCTCCCACTAGG - Intergenic
980702743 4:136454353-136454375 TCTTGGCTCCAGCTCCCAATAGG - Intergenic
984298631 4:177886730-177886752 TCTGAGCTCCAGCTCTCACTGGG - Intronic
984946303 4:184971291-184971313 CCTCAGCACCAGCTCCCAGCAGG + Intergenic
985126661 4:186701560-186701582 TTCTAGCCCCAGCTCCCACAGGG + Intronic
985516164 5:345791-345813 TCCCAGCCCCAGCTCCTCCTGGG - Intronic
985564392 5:608191-608213 TCCCAAACCCAGCTCCCTCTGGG - Intergenic
985579302 5:688677-688699 TCTCAGCCTCACCTCCCACCAGG - Intronic
985594147 5:780736-780758 TCTCAGCCTCACCTCCCACCAGG - Intergenic
985927149 5:3027388-3027410 CCTCAGCCACAGCCTCCACTGGG + Intergenic
986096002 5:4554699-4554721 TCAAGGCCCGAGCTCCCACTGGG - Intergenic
987869678 5:23599376-23599398 TCTCAGCCCCATCCCCCAACAGG + Intergenic
991464402 5:66894890-66894912 TCTCTGCCCCAGCTTCCAAGTGG - Intronic
992127261 5:73654493-73654515 TTTCAGCCCCAGCTCTCTCCAGG - Intronic
995911383 5:117191795-117191817 CCTCAGCCCTAGCACCCAGTAGG + Intergenic
995988518 5:118208462-118208484 TCGCAGCCCTCGCTCCCTCTTGG - Intergenic
996110746 5:119563622-119563644 CCCCAGCCCCAGCATCCACTCGG + Intronic
996968132 5:129330540-129330562 TCTCTGCCCCAACTCCCTATAGG - Intergenic
997464863 5:134080392-134080414 GCTCTGCCCCAGGTCCCACAGGG - Intergenic
998018742 5:138753125-138753147 TCCCGGCCTAAGCTCCCACTAGG + Intronic
998600041 5:143576029-143576051 TCTCAGCTCCAGCTCCCACAGGG + Intergenic
999406099 5:151309033-151309055 TCACAGCCCTAGCTCGCTCTGGG + Intergenic
1000023894 5:157342632-157342654 TCTCAGCAGCAGCGTCCACTCGG - Exonic
1001059322 5:168475075-168475097 TCTCAGCCCCACCCCTCCCTAGG + Intergenic
1001415383 5:171541789-171541811 TCCCAGCTCCAGCTCCAACCGGG - Intergenic
1001541814 5:172545110-172545132 TTTGGGCTCCAGCTCCCACTTGG + Intergenic
1001558173 5:172650400-172650422 TCCCTGTCCCAGCTCCCACGTGG + Intronic
1002001572 5:176199279-176199301 ACGCGGCCCCAGCGCCCACTGGG - Intergenic
1002252769 5:177939701-177939723 ACGCGGCCCCAGCGCCCACTGGG + Intergenic
1002422937 5:179159017-179159039 TCTCAGGACCTGCTCCCACTGGG + Intronic
1002721848 5:181266004-181266026 TCTCAGCCCCATCTCACGGTAGG + Intergenic
1003124673 6:3346726-3346748 CCTCAGACCCACCTTCCACTTGG + Intronic
1003486855 6:6587473-6587495 TGACAGCCTCAGCTTCCACTGGG - Intergenic
1003508914 6:6762994-6763016 TCACAGCCCTCGCTCCCTCTCGG - Intergenic
1003637090 6:7842259-7842281 ACTCAGCCCCAGCCACCACCTGG - Intronic
1003747929 6:9024124-9024146 TCACAGCCCTAGCTCGCTCTCGG + Intergenic
1003770239 6:9290950-9290972 TCACAGCCCTCGCTCCCTCTCGG - Intergenic
1004074706 6:12334366-12334388 TCTCAGCCCTGTATCCCACTTGG + Intergenic
1004146931 6:13076644-13076666 TCTCCACTCCAGCTCCAACTGGG - Intronic
1005066802 6:21826235-21826257 ACTCAGCCCCACCTCTCAGTTGG + Intergenic
1006389535 6:33750385-33750407 CCTCAGCCCCACCTCACACCTGG + Intergenic
1006400753 6:33815853-33815875 TCTGCATCCCAGCTCCCACTGGG - Intergenic
1006627591 6:35408412-35408434 TGACTGCCCCAGCTGCCACTTGG + Intronic
1007221077 6:40279499-40279521 ACCCAGCCCCACCTCCCACCAGG + Intergenic
1009944766 6:70330494-70330516 CCTGAGCCCCAGTTCCCACAGGG + Intergenic
1009957348 6:70471606-70471628 TATCAGGCCCAGCATCCACTAGG - Intronic
1010355889 6:74932672-74932694 TCTCAGCCCCAGGCTCCAATAGG - Intergenic
1010367249 6:75065691-75065713 CCTCAGCTCCAGCTCTCACTGGG - Intergenic
1013487787 6:110614599-110614621 TCTCAGTCCCAGAGCACACTTGG - Exonic
1014921155 6:127215105-127215127 TCACAGCCCTCGCTCCCTCTCGG - Intergenic
1015043096 6:128745042-128745064 ACTCAACTCCAGCTCCAACTGGG + Intergenic
1017310128 6:152966443-152966465 TCACAGCCCTCGCTCCCTCTTGG - Intergenic
1017985704 6:159441523-159441545 TGCCAGCCACACCTCCCACTTGG - Intergenic
1018682334 6:166275038-166275060 TCACAGCCCCCGGCCCCACTGGG + Intergenic
1018909969 6:168096292-168096314 CCTCACTCCCACCTCCCACTCGG + Intergenic
1019164363 6:170088332-170088354 CCGCAGCCCCAGCTCCCAGATGG + Intergenic
1019387822 7:768370-768392 TGTGAGCCGCAGCTCACACTGGG + Intronic
1019435021 7:1018146-1018168 GCTAAGCACCAGCTCCCACCAGG + Intronic
1019709807 7:2513048-2513070 TCCCAGCCCCAGCCCACAGTGGG + Intronic
1021653553 7:22854056-22854078 ACACGGCCCCGGCTCCCACTTGG - Intergenic
1022174211 7:27857523-27857545 TCGCAGCCCTAGCTCGCTCTCGG - Intronic
1022492057 7:30828507-30828529 TCTCAGCCACAGGTTCCACATGG - Intronic
1022494340 7:30843806-30843828 CCACAGCCCCAGGACCCACTGGG - Intronic
1022504252 7:30900711-30900733 ATTCAGCCCTGGCTCCCACTTGG + Intergenic
1023058147 7:36305901-36305923 TCTCAGACCCAGTTCCCAAGAGG - Intergenic
1023222138 7:37930235-37930257 TCACAGCCCCAGCTCTCTCAGGG + Intronic
1023431074 7:40091410-40091432 TTCCTGCCCCAGCCCCCACTAGG - Intronic
1023794436 7:43780176-43780198 TCTCAGTCACAGCTGCCACAGGG + Intronic
1024046905 7:45591237-45591259 CCTCAGCCCCAGCATCCAGTAGG + Intronic
1024656808 7:51458007-51458029 TCTCCATCCCATCTCCCACTGGG + Intergenic
1025095400 7:56092163-56092185 CCCCAGCCCCAGCTCTGACTGGG + Intronic
1025965286 7:66263987-66264009 TTTCAGCCCCAGCTGACACATGG - Intronic
1026145220 7:67740780-67740802 TCTGGGCCCCAGCTCCTTCTAGG + Intergenic
1026512261 7:71037440-71037462 CCTCAGCCCCCGCTCGCTCTCGG + Intergenic
1029421607 7:100474733-100474755 CCAATGCCCCAGCTCCCACTGGG + Intronic
1033150514 7:138910805-138910827 CCTCTGCCTCAGCTCCCACCTGG + Intronic
1034272176 7:149808651-149808673 CCTCAGTCCCAGCTCTCACCTGG - Intergenic
1035303968 7:157917861-157917883 TCCCAGCCCCAGCCCCAGCTCGG - Intronic
1035457003 7:159015220-159015242 GCTCAGGCCCAGCTCATACTTGG - Intergenic
1035626020 8:1071149-1071171 TCTCCTCCCCAGCTTCCGCTCGG - Intergenic
1037842563 8:22255774-22255796 CCACAGCCCCAGCTGCCTCTGGG + Intergenic
1039068657 8:33631524-33631546 TCACAGCCCTTGCTCCCTCTTGG + Intergenic
1039254754 8:35706690-35706712 TCTCAGCCCCACCTGCACCTTGG - Intronic
1040026469 8:42786621-42786643 TCACAGCCCTTGCTCCCTCTCGG + Intronic
1040556151 8:48478956-48478978 TCTGACCCCCACTTCCCACTGGG - Intergenic
1041166249 8:55095692-55095714 TCTATGCCCAAGCCCCCACTGGG + Intergenic
1041173583 8:55170528-55170550 TCTCAGACACAGGTCTCACTGGG - Intronic
1041914445 8:63125955-63125977 TCACAGCCCCCGCTCGCTCTGGG + Intergenic
1042304487 8:67316946-67316968 TCTCAGCCCCACCTCCAAGGAGG + Intronic
1043640087 8:82441268-82441290 TCACAGCCCTAGCTCGCTCTTGG + Intergenic
1044447831 8:92299138-92299160 TTTCAGCCCCACCTCCCACATGG - Intergenic
1044520218 8:93190472-93190494 TCTCAGTCCCAGCTCCAGCTGGG + Intergenic
1044540151 8:93399542-93399564 TCTAAGCTTCAGCCCCCACTGGG - Intergenic
1044700989 8:94965118-94965140 TCTCAGCCTCAGGGCCGACTGGG - Intronic
1045324806 8:101110054-101110076 TCGCAGACCCACCTCCCCCTAGG + Intergenic
1045714624 8:105026626-105026648 TCTAAGCCTCAGCTCACACATGG - Intronic
1046395516 8:113633800-113633822 CCTCAGGCCCAGCTCCAACTCGG + Intergenic
1047759477 8:127943600-127943622 TCGCAACCCCAGCTTCCAGTTGG + Intergenic
1048256399 8:132908224-132908246 TTTCAGCTCCAGCTCCCGCCGGG + Exonic
1048426785 8:134330485-134330507 TAACAGCTCCAGCTCCCTCTTGG + Intergenic
1048949079 8:139478096-139478118 TCACAGCCACAGCCTCCACTGGG - Intergenic
1049063146 8:140291962-140291984 ACACAGCCCCAGATGCCACTTGG + Intronic
1049331969 8:142059434-142059456 TCTCAGGCCCCGCTGCCTCTGGG - Intergenic
1049779949 8:144424345-144424367 CCTCAGCCACAGCTGTCACTTGG + Intronic
1049780443 8:144426326-144426348 TCTGTGCTCCAGCTCCCTCTGGG - Intronic
1049982651 9:919012-919034 CCTCAGCCCCACCTCCCAGAAGG - Intronic
1051091487 9:13414568-13414590 TCCCATCCCCACCTCCCACATGG - Intergenic
1052022803 9:23544230-23544252 TCTCAGCCCAATATTCCACTGGG + Intergenic
1052935043 9:34085906-34085928 TCTCAGCTACAGCTCCAAATAGG + Intergenic
1053063740 9:35051745-35051767 GCTCAGCCCCACAACCCACTAGG - Intergenic
1053122102 9:35555267-35555289 TCTCAGTCCCAGCTCCCTCAGGG + Exonic
1053142471 9:35690233-35690255 CCCCAGCCGCAGCTGCCACTGGG - Exonic
1053142601 9:35690734-35690756 TCCCCGCCCCCGCTCCCACCCGG + Exonic
1055490919 9:76804682-76804704 TCTCCTTCCCAGCACCCACTGGG - Intronic
1055796057 9:79976064-79976086 TCTGAGCACCAGCTCTCATTTGG - Intergenic
1056761366 9:89417778-89417800 TCTCGGCCTCTCCTCCCACTGGG - Intronic
1056836907 9:89962780-89962802 ACTCAGCCCCAGGCCCCACTGGG - Intergenic
1057311466 9:93945839-93945861 TCTCGGTCCCAGCTCCCTCGGGG + Intergenic
1057548860 9:96037640-96037662 TCCCTGGCCCTGCTCCCACTTGG - Intergenic
1058604274 9:106704168-106704190 TCACAGCCCCAGCTGCTTCTTGG + Intergenic
1058818883 9:108711000-108711022 TTCCAGCCCCAGTTCCCACCAGG + Intergenic
1059532454 9:115048351-115048373 TCTAAGCTCCAGCTTCCTCTGGG + Exonic
1060006874 9:120008159-120008181 TCACAATCCCAGCTCCCACCCGG + Intergenic
1060267367 9:122120191-122120213 CCAGAGACCCAGCTCCCACTGGG + Intergenic
1060410954 9:123399894-123399916 TCTGGGCCTGAGCTCCCACTCGG + Intronic
1060793706 9:126501503-126501525 CCTCAGCCCCAGCTGAGACTCGG + Intronic
1060848892 9:126859302-126859324 TCTGAGCCTCAGTTCCCTCTTGG + Intergenic
1061219765 9:129243387-129243409 TCTCAGCCACAGCAGCCACGAGG + Intergenic
1061245859 9:129401050-129401072 TCCAAGCCCCATCTCCCTCTTGG + Intergenic
1061618268 9:131794158-131794180 TTTCAGCCGCAGCCCCCACATGG - Intergenic
1061629457 9:131862935-131862957 TGGCAGCCCCATCTCCCACTGGG + Intronic
1062254910 9:135616343-135616365 TCCCATCCCCAGCACCCCCTGGG + Intergenic
1062268406 9:135697909-135697931 CCTCAGCCCCAGCACTCACGGGG + Intronic
1062397865 9:136359734-136359756 TCTGTGCCCCAGCTCCCCCGTGG - Intronic
1062421725 9:136485646-136485668 TCTCTGCCCCTGCTCACACCTGG + Exonic
1062730388 9:138105217-138105239 TCTGGGGCCCAGCTCCCAGTGGG - Intronic
1186525602 X:10245218-10245240 TCACAGCACCAGCTGCCAATGGG + Intergenic
1187455768 X:19440083-19440105 TGTTAGACCCAGCTCCCACCAGG + Intronic
1189712898 X:43833009-43833031 TCTAAGCCTCAGCACCCACCTGG - Intronic
1192198833 X:69050625-69050647 CCTCATCCCCATCCCCCACTTGG + Intergenic
1193557442 X:82973677-82973699 TTACTGCCCCAGCTGCCACTGGG + Intergenic
1194644435 X:96441342-96441364 TCCCAGCTCCAGCTCTCACTGGG + Intergenic
1194948746 X:100099396-100099418 CCTCAGCCCCAATTCCCACAGGG - Intergenic
1195896449 X:109749834-109749856 TCGCAGCCCCCGCTCACTCTCGG - Intergenic
1197023168 X:121716081-121716103 TGACAGCCCCTACTCCCACTGGG + Intergenic
1198275810 X:135096327-135096349 TCTCAGCCCCAGCCCACCCCAGG + Intergenic
1198310709 X:135424410-135424432 TCTCAGCCCCAGCCCACCCCAGG - Intergenic
1198834371 X:140786015-140786037 TCTAAGTCTCAGCTCCCACCAGG + Intergenic
1200129156 X:153831513-153831535 CCTCAGCCCCAGCCCTCACCCGG + Intergenic
1201568004 Y:15386309-15386331 TCTCACCCCCCGCCCCCACCAGG - Intergenic