ID: 1091700345

View in Genome Browser
Species Human (GRCh38)
Location 12:2654889-2654911
Sequence CCCAGCTCCCACTGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 8, 3: 80, 4: 471}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091700338_1091700345 -2 Left 1091700338 12:2654868-2654890 CCAGCATCCACCGCTCTCAGCCC 0: 1
1: 0
2: 0
3: 33
4: 402
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471
1091700332_1091700345 29 Left 1091700332 12:2654837-2654859 CCTGTGTCCTGTCAGAAGCAGGA 0: 1
1: 0
2: 0
3: 35
4: 280
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471
1091700336_1091700345 4 Left 1091700336 12:2654862-2654884 CCGGTCCCAGCATCCACCGCTCT 0: 1
1: 0
2: 0
3: 24
4: 223
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471
1091700334_1091700345 22 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471
1091700337_1091700345 -1 Left 1091700337 12:2654867-2654889 CCCAGCATCCACCGCTCTCAGCC 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471
1091700339_1091700345 -9 Left 1091700339 12:2654875-2654897 CCACCGCTCTCAGCCCCAGCTCC 0: 1
1: 0
2: 3
3: 116
4: 1158
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471
1091700335_1091700345 5 Left 1091700335 12:2654861-2654883 CCCGGTCCCAGCATCCACCGCTC 0: 1
1: 0
2: 5
3: 19
4: 239
Right 1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG 0: 1
1: 0
2: 8
3: 80
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091700345 Original CRISPR CCCAGCTCCCACTGGGCTGC AGG Intronic
900119915 1:1044170-1044192 CCCAGATGCCACCGCGCTGCCGG - Exonic
900365839 1:2311644-2311666 CCCTGCCCCCACGTGGCTGCTGG - Intergenic
900524225 1:3120618-3120640 TCCCGCTCCCAGGGGGCTGCCGG - Intronic
901022295 1:6261405-6261427 CCCAGCTCCCTCTGGCCCCCGGG - Intergenic
901217601 1:7563390-7563412 CCCAGGTCCTGCTGTGCTGCAGG - Intronic
901425648 1:9181163-9181185 CCCAGCCACCTCTGGGCTCCAGG + Intergenic
901803708 1:11724557-11724579 CCCTTCTACCACTGAGCTGCTGG + Exonic
901870854 1:12138463-12138485 CCCATCTGCCCCTGGGCTGCAGG - Intronic
902228442 1:15011945-15011967 CCCAGCACCTTCAGGGCTGCTGG + Intronic
902376608 1:16032921-16032943 CCCCGCCCCCTCTGTGCTGCTGG + Intronic
902381773 1:16056175-16056197 CCCCGCCCCCTCTGTGCTGCTGG + Intronic
902627221 1:17683587-17683609 CTCAGCTACCTCTGGGCTCCTGG - Intronic
902671353 1:17976414-17976436 CCTGGCTACCACTTGGCTGCAGG + Intergenic
902962526 1:19974954-19974976 AGCAGCTCCTACTGGCCTGCTGG - Intergenic
903342225 1:22661662-22661684 CCCACCTCCCACTGTGTGGCTGG - Intergenic
903352907 1:22728885-22728907 GACAGCTCCCAGTGGCCTGCGGG + Intronic
903628112 1:24745662-24745684 CCCGGCTCCCTCCCGGCTGCGGG + Intronic
904165577 1:28552911-28552933 CCTAGCGCCCAGTGGGTTGCAGG + Intergenic
904418699 1:30377924-30377946 CTCAGCTGTCACTGGGCAGCTGG + Intergenic
904435198 1:30490463-30490485 ACCAGCACCCACAGGACTGCAGG - Intergenic
904701538 1:32361398-32361420 CCCAGCTCCCGCGGAGCCGCAGG + Exonic
905872557 1:41413434-41413456 CCCAACCCCCACGAGGCTGCTGG + Intergenic
906762265 1:48386875-48386897 CCCTGCTGCCACTGGGCTCCAGG - Intronic
907326081 1:53639355-53639377 CCCATCTCCCATTGGCCCGCAGG + Intronic
907328565 1:53656812-53656834 CCAAGGTGCCACTAGGCTGCAGG + Intronic
909221596 1:72969287-72969309 CTCACCTCCTACTGTGCTGCTGG + Intergenic
910666081 1:89727266-89727288 AACAGCTACCACTGGGCAGCAGG + Intronic
910929215 1:92425894-92425916 CCCAGCTGCCACTGAGGAGCAGG + Intergenic
912069873 1:105796038-105796060 ATGAGCTCCCTCTGGGCTGCCGG + Intergenic
915041245 1:152969893-152969915 CCCAACTCCCAATGGGCAGATGG + Intergenic
915686806 1:157642273-157642295 CCCATTTCTCACTGTGCTGCTGG + Intergenic
915705413 1:157839120-157839142 CCCAGCTCTTACTTGGATGCTGG + Intronic
916051813 1:161041742-161041764 CCCATCTCCCACTGCCGTGCTGG + Exonic
917051994 1:170935276-170935298 CCCAGCTTCTACTGGACTGTTGG + Intergenic
917618249 1:176768232-176768254 CCCACCTCCCCCTGTACTGCTGG + Intronic
918069898 1:181127076-181127098 GGCAGCTCCCACAGGGCTGCAGG - Intergenic
918696375 1:187551138-187551160 ACGAGCTCCCTCTGGGCTGCCGG - Intergenic
919381602 1:196867891-196867913 ACCAGCCCTCACTGGGCTGCAGG - Intronic
920340046 1:205269906-205269928 CCCACGTCCGGCTGGGCTGCAGG - Intronic
920379227 1:205526238-205526260 CCCAGCTCCCACAAGGGTGCAGG - Intronic
921686397 1:218093975-218093997 CCCAGCTCCCAGAGGGCTCCAGG - Intergenic
922733848 1:227969102-227969124 CCCAACTCCTGCTGAGCTGCTGG + Intergenic
922807420 1:228397588-228397610 CCCAGCTCCACCTGCCCTGCAGG + Intronic
924570889 1:245236783-245236805 CCCAGCCCCCACGGGGCTCACGG - Intronic
924878971 1:248137114-248137136 CCCAGCTACTGCTGGGCTGGTGG - Intergenic
1062890535 10:1056673-1056695 CCCAGACCCCTCGGGGCTGCGGG + Intronic
1062982554 10:1737333-1737355 ACTTGCTCCCACTGGGCTGGGGG + Exonic
1064694377 10:17950777-17950799 ACGAGCTCCCTCTAGGCTGCTGG - Intergenic
1066067799 10:31774860-31774882 CCCATCTCCCTCCAGGCTGCAGG - Intergenic
1066201143 10:33143648-33143670 CCCAGATCCCTCAGGGCTGTGGG + Intergenic
1066238163 10:33507255-33507277 CCCTTTTCCCACTGGGCTGGAGG + Intergenic
1067054392 10:43042593-43042615 CCCATCTCCCAGTGGGCTCTGGG + Intergenic
1069153517 10:64996871-64996893 CCCAGGTCTCACAGGGCTCCTGG + Intergenic
1069551641 10:69368395-69368417 CCCAGATCACACTGGGCTTGGGG - Intronic
1069816271 10:71196515-71196537 GCCTGCTGCCACTGGGCTGTGGG - Intergenic
1069928237 10:71865865-71865887 AACAGCTCCCGCTGGGATGCAGG - Intergenic
1070773152 10:79094329-79094351 TCCAGCTCCCTCCGGGTTGCAGG - Intronic
1070779629 10:79130017-79130039 CCAAGCCCCCAGAGGGCTGCGGG + Intronic
1070933435 10:80276393-80276415 CAAACCGCCCACTGGGCTGCAGG + Exonic
1071271269 10:84009834-84009856 GCCATGTACCACTGGGCTGCTGG - Intergenic
1071346534 10:84699166-84699188 GGCAGCTTCCACTGGGCTGGGGG + Intergenic
1071715694 10:88093181-88093203 CCCAGCTCGCACAGCACTGCTGG - Intergenic
1073246017 10:102090686-102090708 CCCAGATCTCCCAGGGCTGCTGG + Intergenic
1073882704 10:108001974-108001996 CCCAGCTTCCACTGGGTTGCTGG + Intergenic
1073971405 10:109048141-109048163 ATGAGCTCCCTCTGGGCTGCTGG + Intergenic
1075102498 10:119516308-119516330 TTAAGCGCCCACTGGGCTGCAGG + Intronic
1075727684 10:124618876-124618898 CCCAGGCCCCTCAGGGCTGCAGG + Intronic
1075906853 10:126089055-126089077 CCCAACTCCCAGTTGGCAGCTGG + Intronic
1076003743 10:126931798-126931820 CCCTGCTCTCCCTGGGCTTCGGG + Intronic
1076008497 10:126967595-126967617 CCATGCTCCCACGGGGCTGTGGG + Intronic
1076402862 10:130194938-130194960 CCCAGCTCTCCCTGGCCTGGAGG - Intergenic
1076408966 10:130232490-130232512 CTGAGCTCCCACTGGGATGAAGG - Intergenic
1076445854 10:130513324-130513346 CACAGCACCCACGAGGCTGCTGG + Intergenic
1076514618 10:131036919-131036941 CCCATCTCCCATGGGGCTGGGGG + Intergenic
1076807723 10:132867324-132867346 ACCGGCGCCCGCTGGGCTGCGGG + Intronic
1076917181 10:133430115-133430137 CCCAGCTTCTCCTGGGCTGGAGG + Intergenic
1076937276 10:133574874-133574896 CCCAGCTTCTCCTGGGCTGGAGG + Intergenic
1076999537 11:315783-315805 CCGAGCTCCCGCGGGGCTCCCGG - Intergenic
1077236220 11:1483222-1483244 CCCAGCTCCCCCTGTGCTGCTGG + Intronic
1077373477 11:2194510-2194532 CCCAGATCCAGCTGGGCGGCAGG - Intergenic
1077877298 11:6319488-6319510 CCCAGCTCGGACTGGTCCGCCGG + Exonic
1078010798 11:7571765-7571787 CTCAGCTCCCAAGGGGCTCCTGG + Intronic
1079081885 11:17419320-17419342 GCCAGCTCCTAGTGGGCTGGAGG - Intronic
1079284040 11:19113277-19113299 CTCAGCCTCCACTTGGCTGCCGG - Intergenic
1079400785 11:20104787-20104809 TCCAGCTCCCTATGGCCTGCAGG + Intronic
1080924655 11:36743934-36743956 GCCTGCTCCCACCTGGCTGCTGG + Intergenic
1081106684 11:39078849-39078871 ACAAGCTCCCTCTGGGCTGCTGG + Intergenic
1081789379 11:45772064-45772086 CCCAGCTCCCTCCGGGCTCCGGG + Exonic
1081998426 11:47378702-47378724 CCCAGCTTCCTCTGGGCAGGGGG - Intergenic
1083314561 11:61806412-61806434 CCCAGTTTCCACTGGGAAGCTGG - Intronic
1083404512 11:62447329-62447351 CCTAGATCCCACTGGGCAGAAGG - Intronic
1083475022 11:62909893-62909915 CCCAGCTCCCACAGGGTCTCGGG + Exonic
1083648307 11:64185832-64185854 CACCTCTCCCATTGGGCTGCCGG - Exonic
1083945230 11:65919598-65919620 CCCAGTTCCCGCTGGGCAGGCGG + Intronic
1084030125 11:66476221-66476243 CAGAGCTCCCTCTGGGCTGCAGG - Exonic
1084445633 11:69202051-69202073 CCTGGCTCCCTCAGGGCTGCGGG - Intergenic
1084449809 11:69229813-69229835 CCCAGCCCCCTCTCTGCTGCTGG + Intergenic
1084657383 11:70527406-70527428 CCCAGGGCCCACTGGGAAGCGGG - Intronic
1084715465 11:70870645-70870667 TCCAGCTCCCAGTGGCCTGTAGG + Intronic
1085351712 11:75802085-75802107 TCCAGCTCCCACTGGACGGGAGG + Intergenic
1087318858 11:96635936-96635958 ACAAGCTCCCTCTGGGCTGCTGG + Intergenic
1088653400 11:111977375-111977397 CCCATCTCCCACTGGGAGGGAGG - Intronic
1089060624 11:115623264-115623286 CCTTGCTCACACTGGGCTTCTGG - Intergenic
1089161962 11:116445248-116445270 TCCTGCTACCTCTGGGCTGCTGG + Intergenic
1089339283 11:117746645-117746667 CCCAGCTTCCAGTGTGCTACTGG + Intronic
1089489033 11:118870199-118870221 CCCAGCAGCCACTGAGCTGGAGG - Intergenic
1089954462 11:122556936-122556958 ACGAGCTCCCTTTGGGCTGCTGG + Intergenic
1090240965 11:125181581-125181603 CCCAGCCCTCACTGGGCAGCTGG - Intronic
1090263940 11:125342431-125342453 CCCAGCTCCCAGTGAGCGTCAGG + Intronic
1090351533 11:126111394-126111416 TGCAGCACCCTCTGGGCTGCTGG + Intergenic
1091394101 12:143083-143105 CTCAGCACCACCTGGGCTGCAGG - Intronic
1091544355 12:1491237-1491259 TTCAGCAGCCACTGGGCTGCAGG - Exonic
1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG + Intronic
1091781325 12:3216156-3216178 CCCAGCTCCCAGAGGGCCCCAGG - Intronic
1092171209 12:6375019-6375041 CCCAACTCCCGCAGGTCTGCTGG - Exonic
1092938476 12:13385954-13385976 CCCATCTTTCACTGGGCTGAAGG + Intronic
1094475862 12:30840090-30840112 GCCAGCTCACACTGGTCTGCAGG + Intergenic
1095662852 12:44757913-44757935 CCCAGTTCCCACAGTGCTACTGG - Intronic
1095749813 12:45697468-45697490 CCCAGCTCCCACTGGCCCCACGG + Intergenic
1096542960 12:52318474-52318496 CCCTGCCCCCACTCAGCTGCAGG + Intronic
1096597383 12:52705039-52705061 CCCAGCTCCCACGGGTCAGGGGG + Intergenic
1098885377 12:75955384-75955406 CACAGCTCCCAGTTGACTGCAGG + Intergenic
1099437251 12:82659448-82659470 ATGAGCTCCCTCTGGGCTGCGGG - Intergenic
1101783865 12:107864568-107864590 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
1102452975 12:113055603-113055625 CCCATCCAACACTGGGCTGCAGG + Intergenic
1103363231 12:120366369-120366391 GCCAAGTCCCACTGGGCTCCAGG + Intronic
1103524627 12:121559474-121559496 TCCAGCCCCCACGGGGCAGCAGG + Intronic
1104963237 12:132498018-132498040 CCCAGCTCTCCCAGGGGTGCAGG - Intronic
1105508986 13:21035762-21035784 CCCAGCTCCCAAAGGGCTGCAGG + Intronic
1106162290 13:27212271-27212293 ACGAGCTCCCTCTGGGCTGCCGG + Intergenic
1106163371 13:27219891-27219913 ATGAGCTCCCTCTGGGCTGCCGG + Intergenic
1106554087 13:30795427-30795449 CAGAGCTCCCACTGGGCACCAGG - Intergenic
1107012323 13:35681016-35681038 CCCAGCACACACTGGGAAGCTGG + Intergenic
1107015679 13:35706392-35706414 CACAGCTCCCAGCAGGCTGCAGG + Intergenic
1108133902 13:47334276-47334298 TCTGGCTCCCACTGGGCTACAGG + Intergenic
1108855481 13:54787871-54787893 ATGAGCTCCCTCTGGGCTGCTGG - Intergenic
1108958253 13:56187754-56187776 ACCAGCTCTCTCTGTGCTGCTGG + Intergenic
1109149216 13:58823691-58823713 ACCAGCTCCCTCTGGGATGCCGG - Intergenic
1109534086 13:63693776-63693798 ACAAGCTCCCTCTGGGCTGCTGG - Intergenic
1111096068 13:83517062-83517084 ACGATCTCCCTCTGGGCTGCTGG + Intergenic
1111232610 13:85363291-85363313 ACCAGCTCCCTCTGGGCTGCCGG + Intergenic
1113344793 13:109466825-109466847 CACAGCTCCCACAAGGCTGCTGG + Intergenic
1113517468 13:110914670-110914692 CCCGACTCCCACTGGACAGCCGG + Intronic
1113650194 13:112028918-112028940 CCGAGCTCCCACCAGGCAGCTGG - Intergenic
1113901782 13:113801834-113801856 CCCGGCTCCCAGTGAGCAGCGGG - Intronic
1113932696 13:113976674-113976696 CCCACCTCCCACTGCCCTGTAGG + Intergenic
1114566356 14:23635896-23635918 ATGAGCTCCCTCTGGGCTGCTGG + Intronic
1115545629 14:34462572-34462594 CCGAGCGCCCGCTGGGCTGCGGG - Intronic
1115707736 14:36015359-36015381 GCCAGCTCCCCCTGGCCTTCAGG + Intergenic
1117819409 14:59632195-59632217 CAGAGCTCCCACAGGGCTGATGG + Intronic
1118614540 14:67566288-67566310 CACTGGTCCCCCTGGGCTGCTGG + Intronic
1118748345 14:68789889-68789911 CGCCGCTGCCACCGGGCTGCTGG - Exonic
1118907858 14:70035900-70035922 CCCATCTCCCACTGGACTCCTGG - Intergenic
1119036037 14:71231251-71231273 CCCAGCTCCCACTGGGTCTGTGG - Intergenic
1119840691 14:77790689-77790711 CCCAGCTGTCAATGGGCTTCAGG - Intergenic
1120030124 14:79631569-79631591 ACGAGCTCCCTCTGGGCTGCCGG + Intronic
1121342623 14:93114787-93114809 CCCACCGCGCCCTGGGCTGCTGG + Intronic
1121422357 14:93824611-93824633 CCCAGCTCCCTCTCCCCTGCTGG - Intergenic
1122604326 14:102938264-102938286 CCCACCTCCCCCAGGGCTGCGGG + Intronic
1122793935 14:104196423-104196445 CCCAGCCCCCACAGCGGTGCTGG - Intergenic
1122819715 14:104335354-104335376 CCCAGTCTCCACTGGGCTGCAGG - Intergenic
1122924375 14:104892874-104892896 CCCAGCTCCCAGGCAGCTGCTGG - Intronic
1124023445 15:25944302-25944324 CTCTGCTTCCTCTGGGCTGCTGG - Intergenic
1126191817 15:45886098-45886120 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
1128482863 15:68054684-68054706 CCCAGCTCCCCATGGGGGGCAGG - Intronic
1128543276 15:68551410-68551432 CAAAGTTCCCACTGGGCTGTGGG + Intergenic
1128771341 15:70284688-70284710 CCCAGCTTGACCTGGGCTGCAGG + Intergenic
1129224851 15:74163181-74163203 CCCAGCTCCCATTGGCCCTCTGG + Intergenic
1129767373 15:78178878-78178900 CCAAGCCCCCACTGGGGAGCCGG + Intronic
1130078146 15:80707960-80707982 GCAAGCTCCCACTGAGCTTCAGG - Intronic
1130138038 15:81197916-81197938 TCAAGCTCCCACTGGGTTCCTGG + Intronic
1130918437 15:88324203-88324225 CCCAGCTCCCATTTGCCGGCAGG - Intergenic
1131117668 15:89804683-89804705 CCCAGGGCCCAGTGGGCTGGGGG + Intronic
1131764935 15:95665511-95665533 CCAAGCTCCCAGTGTGCTGCTGG + Intergenic
1132577464 16:670592-670614 CCCAGCACCCCCTGGGCCCCTGG - Intronic
1132599959 16:768967-768989 CCCTGCTGCCACTGTGCTGAGGG + Intergenic
1132873593 16:2126105-2126127 CCCATCACCCACTCGGCTGTGGG + Intronic
1132925576 16:2427659-2427681 CCCGTTTCCCACTGGGCTTCAGG - Intergenic
1133147186 16:3797109-3797131 CCCAGTTCCCACTGGCAGGCAGG + Intronic
1133400442 16:5482400-5482422 GCCAGCCCCGCCTGGGCTGCAGG - Intergenic
1134552680 16:15145279-15145301 CCCATCACCCACTCGGCTGTGGG + Intergenic
1135338954 16:21630207-21630229 ACAAGCTCCCACTGGGCTGTCGG - Intronic
1135340046 16:21637594-21637616 ACAAGCTCCCTCTGGGCTGCTGG - Intronic
1135422268 16:22313433-22313455 CCCACCTCCACCTGGCCTGCTGG - Intronic
1136512554 16:30748290-30748312 CCCAGCCCCAATTGGGCGGCCGG + Exonic
1137583876 16:49652163-49652185 CCCCGCCCCCACATGGCTGCTGG + Intronic
1138014025 16:53412875-53412897 ACAAGCTCCCTCTGAGCTGCTGG + Intergenic
1138580950 16:57940103-57940125 CCCTGCTCCCTCTGTCCTGCGGG + Intronic
1139088510 16:63617354-63617376 GCGAGCTCCCTCTGGGCTGCGGG - Intergenic
1139440973 16:66966642-66966664 CCCAGCAGCCACTGAGCTGCAGG - Intronic
1140218326 16:73025624-73025646 CCCAGGCACCCCTGGGCTGCAGG + Intronic
1140376008 16:74446040-74446062 CCCAGCTGCCATTGGGTTGTAGG - Intergenic
1140992812 16:80230737-80230759 ACCAGCACCCACTGGGTTGACGG - Intergenic
1141490181 16:84367603-84367625 CAAAGCACCCACTTGGCTGCTGG + Intergenic
1141603835 16:85142052-85142074 CCCAGGTACCCCTAGGCTGCCGG + Intergenic
1141869951 16:86778566-86778588 GCCAGTGCCCACTGGGCTGGAGG - Intergenic
1142138490 16:88462172-88462194 CCCAGCTTCCCCTGGGCTGCTGG + Intronic
1142978392 17:3658300-3658322 CCCCGCTCCCGCTGGGCTCCCGG - Intronic
1144276279 17:13671730-13671752 CCCAGCTCGCACTGGGATCTGGG - Intergenic
1144659041 17:17056503-17056525 CCCAACTCCCACTGGGCTCCTGG - Intronic
1145220635 17:21085745-21085767 ACAAGCTCCCTCTGGGATGCTGG - Intergenic
1145263763 17:21369642-21369664 CCCAGCCCACACTGGGCCCCCGG + Intergenic
1145782843 17:27574968-27574990 CACTCCTCCCACTGGGCTGTAGG + Intronic
1145799231 17:27672602-27672624 CAAGGCTCCCACTGGGTTGCAGG - Intergenic
1146287120 17:31581532-31581554 CCCATCTCCCACTAAGGTGCTGG - Intergenic
1146476494 17:33166745-33166767 TCCCGCTCCCACTGCACTGCAGG + Intronic
1147178898 17:38673052-38673074 CTTTGCTCCCACTGGGGTGCAGG + Exonic
1147915303 17:43882141-43882163 GTCAGCTGCCCCTGGGCTGCAGG + Intronic
1148344777 17:46895866-46895888 CCCTGCTCCCACTTGTCTCCTGG - Intergenic
1148471308 17:47895593-47895615 CCCAACTCCCACTATGGTGCCGG + Intergenic
1148676118 17:49445962-49445984 CACAGCACCCACAGTGCTGCGGG + Intronic
1148818924 17:50349058-50349080 GCCAGCTCCCACTGCAGTGCAGG + Intronic
1148821889 17:50364661-50364683 CACATCACCCCCTGGGCTGCAGG + Intergenic
1150215837 17:63468645-63468667 CCCAGTCCCCGCTGGGCTCCTGG - Intergenic
1150216836 17:63476018-63476040 CCCACCTCCCACTGCGCCGCCGG + Intergenic
1151365142 17:73612208-73612230 CCCAGCTGCACCCGGGCTGCAGG + Intronic
1151365168 17:73612272-73612294 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG + Intronic
1151830642 17:76547343-76547365 CGCATCTCCAGCTGGGCTGCTGG - Intronic
1151979337 17:77499386-77499408 CCCCGCCCCCACCGGGCTGCAGG + Exonic
1152224225 17:79085313-79085335 CCCAGCCCCCACTCAGCTGCCGG - Exonic
1152476466 17:80521582-80521604 CCCAGCTCCCAGCTGGCTGTTGG - Intergenic
1152568778 17:81112169-81112191 CCCAGGTCCCTCTGAGCTGAGGG + Intronic
1152726378 17:81948798-81948820 CCCAGCTCCCACAGCACGGCAGG + Intergenic
1152801189 17:82331345-82331367 CCCAGCTCTGTCTGGGCAGCAGG + Intronic
1152805927 17:82356360-82356382 CCCAGCTACCTCGGGGGTGCAGG - Intergenic
1152891475 17:82883939-82883961 CCCAGCTCCCACATGGCGTCTGG + Intronic
1153225732 18:2898310-2898332 TGCTGCTGCCACTGGGCTGCAGG - Intronic
1153630855 18:7068262-7068284 CCCAGCTCTCAAGGGGCTTCTGG - Intronic
1154345969 18:13543864-13543886 CCTACCTCCAACAGGGCTGCTGG + Intronic
1156118933 18:33820157-33820179 ACGAGCTCCCTCTGGGCTGCCGG - Intergenic
1157069249 18:44386709-44386731 CACAGCTCCCCCTGGGTTCCAGG - Intergenic
1157904849 18:51560651-51560673 GCCAGCTCCCACTTGCCAGCTGG - Intergenic
1159346704 18:67215753-67215775 ACCAGCTCCCTCTGGGCTGCCGG - Intergenic
1160069011 18:75608241-75608263 CCCAGCTCCTCCTTGGCTCCTGG + Intergenic
1160721322 19:598120-598142 CCCAGCACCGAGTGGGCTGAGGG - Intronic
1160754476 19:750544-750566 CCGGGCTCCCTCAGGGCTGCTGG - Intergenic
1160873727 19:1287922-1287944 CCCACCTGCCACAGGGCTGTGGG + Intronic
1160878423 19:1308589-1308611 CCCAGCTCCGACTGCCCCGCCGG + Intergenic
1160992353 19:1864865-1864887 CCCAGCTCCGGCGGGGCGGCGGG + Intergenic
1161280708 19:3444024-3444046 CCCATCTCCCACTGAAATGCCGG - Intronic
1161742627 19:6032616-6032638 CCCAACTCCCACTTGGCAGGGGG + Intronic
1162486393 19:10962936-10962958 CCCAGCTCTCACGGTGCTGGGGG - Intronic
1163092918 19:15033688-15033710 CCCTCCTCCCTCTGTGCTGCAGG + Intergenic
1163231157 19:16003150-16003172 CTCAGGTTCCACTGTGCTGCTGG + Intergenic
1163668350 19:18613411-18613433 CCCAGCTCCCTCAGGCCTGATGG + Intronic
1163723631 19:18910263-18910285 CCACCCTCCCACTGGGCTCCAGG + Intronic
1165087907 19:33364170-33364192 TCCAGTTCCCACTTGGCTGAAGG + Intergenic
1166442443 19:42826656-42826678 CACAGCTCTCCCTGGGATGCTGG - Intronic
1166450007 19:42890686-42890708 CACAGCTCTCCCTGGGATGCTGG - Intronic
1166461885 19:42994973-42994995 CACAGCTCTCCCTGGGATGCTGG - Intronic
1166479165 19:43154935-43154957 CACAGCTCTCCCTGGGATGCTGG - Intronic
1166862460 19:45818183-45818205 CCCACCTCCCAGGGGGCAGCTGG - Intronic
1167072102 19:47227498-47227520 CCTCGCTCCCCTTGGGCTGCCGG + Intronic
1167455491 19:49595324-49595346 CCCACCACCCAGGGGGCTGCAGG - Exonic
924963883 2:58016-58038 ACAAGTTCCCACTGGTCTGCAGG - Intergenic
925340759 2:3134036-3134058 GCCAGCTCCCAGTGGCCAGCTGG + Intergenic
925351823 2:3206353-3206375 CAGAGCCCCCAGTGGGCTGCAGG + Intronic
926083347 2:10006309-10006331 ACGAGCTCCCTCTGGGCTGCCGG - Intergenic
926170538 2:10550335-10550357 CCCAGCCCCCAGAGGGCGGCCGG + Intergenic
927137342 2:20106671-20106693 ACTAGCTCCCTGTGGGCTGCCGG - Intergenic
927484165 2:23477539-23477561 GGCTGCCCCCACTGGGCTGCTGG - Intronic
927747263 2:25634052-25634074 CCCACCTCCCTCCTGGCTGCCGG - Intronic
927909589 2:26887433-26887455 CCCAGCTCCCCTGGGCCTGCGGG - Intronic
927937616 2:27084437-27084459 CCCAGGGCCTCCTGGGCTGCAGG + Exonic
928373627 2:30758552-30758574 CATAGCTCCCACTGGGCTGCCGG - Intronic
930036448 2:47088470-47088492 CCAGGCTCCCACTGAGCTGTTGG - Intronic
931988863 2:67769117-67769139 CCCTGCTCCTTCTGGGCTGGTGG - Intergenic
932112468 2:69013475-69013497 CCCTGCTCTCCCCGGGCTGCGGG + Exonic
932274589 2:70442667-70442689 CCCCACTCCCACTGGGCTTCAGG - Intergenic
933275014 2:80274422-80274444 CCCAGTTCGCTCTGGGCTGTGGG + Intronic
933703699 2:85274149-85274171 CCCAGCCACCAATGTGCTGCAGG - Intronic
934674425 2:96239553-96239575 CCCAGCCCCCACTGAGCTGAGGG - Intergenic
934984163 2:98872016-98872038 CCCAGCTCCATCTGTGTTGCTGG - Intronic
935177589 2:100663398-100663420 CCCAGCTCCTGCCAGGCTGCGGG + Intergenic
935580224 2:104750179-104750201 CACAGCTCCCACTGGAGAGCAGG + Intergenic
936347751 2:111688106-111688128 CCCAGCACCCGCGGAGCTGCGGG + Intergenic
936713558 2:115161259-115161281 CCCGCCTCCCACGGGGCTCCGGG + Intronic
937246874 2:120499315-120499337 CTCAACTCCCCCTCGGCTGCGGG + Intergenic
937956891 2:127426702-127426724 CTGTGGTCCCACTGGGCTGCCGG - Intronic
938153139 2:128903750-128903772 ATGAGCTCCCTCTGGGCTGCCGG - Intergenic
938408104 2:131043917-131043939 CCCAGCTTCCTCTACGCTGCCGG + Intronic
942037865 2:172028363-172028385 CCCACCTCCCTCTGGCCTCCTGG - Intronic
944471087 2:200054822-200054844 CCCAGCCCCGCCTGGGCTGTCGG + Intergenic
944688213 2:202136581-202136603 ATGAGCTCCCTCTGGGCTGCCGG - Intronic
945319603 2:208406653-208406675 CCCTCCGCCCCCTGGGCTGCGGG + Intronic
946692526 2:222319988-222320010 CCCAGCTCCCTCCCGGCTCCCGG + Intergenic
947832832 2:233153871-233153893 CCCAGCTCCCAGGATGCTGCTGG + Intronic
948130673 2:235598258-235598280 GCCTGCCCCCACTGAGCTGCTGG + Intronic
948150419 2:235740146-235740168 CCCTGCTCCTGCTGGGCAGCGGG - Intronic
948164584 2:235851266-235851288 CCCAGCTCCGACCGAGCAGCAGG - Intronic
948381876 2:237556417-237556439 CCCAGATGCCATTGAGCTGCAGG - Intergenic
948421490 2:237863170-237863192 CCCAGCTCCCACTGTCTTCCTGG - Intronic
948436371 2:237956573-237956595 CTTAGCTCCCTCCGGGCTGCTGG + Intergenic
948541613 2:238695039-238695061 CCCAGATGCCACTGAGCTGCCGG + Intergenic
948840337 2:240645553-240645575 CCCAGCTCCAAGGGGGCGGCGGG + Intergenic
948840610 2:240647097-240647119 CCCGGCTCCCCCTTGGCTCCAGG + Intergenic
948950052 2:241243634-241243656 CCAGGCTCCGACTGAGCTGCAGG - Intronic
1168793961 20:598694-598716 CACAGGTCCCACTGGGCAGCCGG - Intergenic
1168806928 20:676936-676958 CCCAGCACCCTCTGGGCAGGGGG - Intergenic
1168883475 20:1226309-1226331 TCCAGCCCCAGCTGGGCTGCGGG - Intronic
1170109595 20:12790486-12790508 GCCAGCTCCCACTGGTCAGTTGG - Intergenic
1170119431 20:12895576-12895598 CCCCGCTGCCACTGGGCACCTGG - Intergenic
1170546905 20:17442139-17442161 CCCAGCTCCCGGTGGGCTGTTGG - Intronic
1172174208 20:32962293-32962315 CCCAGCTCCCTTCAGGCTGCAGG - Intergenic
1172902054 20:38342521-38342543 CCCTGCTCCTAATGGGCTGGGGG - Intergenic
1173535008 20:43802842-43802864 CCCAGCTCCCACTGGGGATAGGG + Intergenic
1173827477 20:46057078-46057100 TCCAGCCCGAACTGGGCTGCTGG - Intronic
1173945824 20:46950248-46950270 CCCAGCTGCCACTAATCTGCAGG + Intronic
1173992709 20:47315534-47315556 CCCAGCCCCCACTGGAGTGGGGG - Intronic
1176000445 20:62829124-62829146 CACAGCACCCACTGGGCACCAGG - Intronic
1176272525 20:64243571-64243593 CTCAGCTCCCAGTAGGCTGGTGG - Intergenic
1176300864 21:5098333-5098355 CCCTGCTCCCTATGGGCTTCTGG - Intergenic
1176309941 21:5144289-5144311 CCCAGCTTGCTCTGGGCTCCAGG + Intronic
1176381006 21:6111906-6111928 CACACCTCCCACGGGGCTGGAGG + Intronic
1177856682 21:26407627-26407649 CCCTTCTCCCACAGGCCTGCAGG + Intergenic
1178336729 21:31750082-31750104 CCCAGCTCCAACTTGGCGGCTGG - Intergenic
1178384335 21:32137235-32137257 CCCAGCTCCTTAGGGGCTGCTGG - Intergenic
1179003469 21:37485242-37485264 CCCAGATCCTGATGGGCTGCAGG - Intronic
1179169672 21:38963086-38963108 CCCAGCTTCTGCTGGGTTGCTGG - Intergenic
1179573783 21:42294295-42294317 CCCAGCTCATCCTGGGCTGCAGG + Intronic
1179709575 21:43205531-43205553 CCAGGCTCCAGCTGGGCTGCTGG + Intergenic
1179742466 21:43426334-43426356 CACACCTCCCACGGGGCTGGAGG - Intronic
1179847115 21:44117743-44117765 CCCAGCTTGCTCTGGGCTCCAGG - Intronic
1179856172 21:44163620-44163642 CCCTGCTCCCTATGGGCTTCTGG + Intergenic
1180089201 21:45525159-45525181 CCCAGGTCTCACTGGGCAGGAGG - Intronic
1180093982 21:45546215-45546237 CTCAGCTGCCACAGGGCTTCTGG - Intergenic
1180320213 22:11313143-11313165 GCCTGCTGCCACTGGCCTGCTGG - Intergenic
1181412183 22:22731655-22731677 CTCAGAACCCCCTGGGCTGCTGG + Intergenic
1181419416 22:22787433-22787455 CTCAGAACCCCCTGGGCTGCTGG + Intronic
1182118517 22:27772209-27772231 CCCAGCCCCTGCTGGGCTGAGGG - Intronic
1182147114 22:28003354-28003376 CACAGTTCCCACTGAGCAGCAGG - Intronic
1182518486 22:30872061-30872083 CCCAGATCCCACAGTGCTGGGGG + Intronic
1183278871 22:36921761-36921783 CTAAGCTCCCCGTGGGCTGCTGG - Intronic
1183528581 22:38339183-38339205 ACCAGCCCCCACTGGGCTAAAGG + Intronic
1183675532 22:39297097-39297119 TCCAGCTCCCACGGGCCCGCTGG + Intergenic
1183786994 22:40035265-40035287 CCCAGCTCCCACGCGCTTGCTGG - Exonic
1183862814 22:40681848-40681870 CGAAGCTGCCCCTGGGCTGCAGG - Exonic
1184384746 22:44167615-44167637 CCCTGCCTCCACTGGGCTGTTGG + Intronic
1184782326 22:46655595-46655617 CCCAGCCCTCTCTGGGCGGCCGG - Intronic
1184867126 22:47207884-47207906 CTCTGCTCCCTGTGGGCTGCTGG - Intergenic
1185088391 22:48752886-48752908 CCCAGCTCTCACTGTGATACAGG - Intronic
949516367 3:4810849-4810871 CCCACCAGACACTGGGCTGCAGG + Intronic
949546787 3:5079825-5079847 CCCATCTTGCATTGGGCTGCAGG + Intergenic
950535871 3:13577806-13577828 CCCAGCTGCCCCCGGGCTGGTGG - Intronic
950969278 3:17170269-17170291 CCCAGCTCCCACTGGGTAGGTGG + Intronic
951982066 3:28576329-28576351 CCCCGCTCCCAGGGGGCTGGCGG + Intergenic
952788089 3:37176021-37176043 CCCTGCTCCCACCGGGCTGGCGG + Intronic
953582909 3:44173243-44173265 ACGAGCTCCCTCTGGGCTGCCGG - Intergenic
954109575 3:48426598-48426620 CCCGGCTTCCACCAGGCTGCTGG - Intronic
954326398 3:49866566-49866588 ACAAGCTCCCTCTGGGCAGCCGG - Intronic
954613504 3:51958234-51958256 CACAGCTCCCCCTGGCCTGCTGG - Exonic
954614764 3:51964041-51964063 CCCAGCCCCCTCTGGTCAGCAGG + Intronic
956663841 3:71623945-71623967 CCCAACAACCACTGGTCTGCAGG + Intergenic
956722149 3:72127687-72127709 CCCAGATCCCAGTGGGATGAGGG - Intergenic
957272077 3:78043698-78043720 CCCAGCTCCTACAGGCCTGCTGG + Intergenic
958562165 3:95760139-95760161 CCCAGCTCCCACTGGCTTCCAGG + Intergenic
960896709 3:122514226-122514248 CCCACCTCCCTCCGGGCCGCCGG + Intronic
961043047 3:123690807-123690829 CCCAGCTCCCAATTTGCAGCTGG + Intronic
961062452 3:123842925-123842947 GCTAGCTCCCAATGTGCTGCTGG + Intronic
961440046 3:126947336-126947358 GCCAACTCCCATTGGGCAGCCGG - Intronic
964130539 3:153281535-153281557 ATGAGCTCCCTCTGGGCTGCTGG + Intergenic
964749526 3:160041467-160041489 CATAGCTCACACAGGGCTGCTGG + Intergenic
965139863 3:164818605-164818627 ACGAGCTCCCTCTGGGCTGCTGG + Intergenic
965524237 3:169699662-169699684 CCCAGCTCCAGCAGGGCTTCTGG - Intergenic
965605197 3:170491631-170491653 TCCAGCTCCCACCGGACTCCAGG - Intronic
969641461 4:8401584-8401606 CCCAGCTCCCACAGGGAGGATGG - Intronic
970438118 4:16055381-16055403 ACCAGCTCTCATTTGGCTGCAGG + Intronic
972784626 4:42315291-42315313 ACGAGCTCCCTCTGGGCTGCAGG - Intergenic
972998442 4:44913446-44913468 CCTAGCTGCCACAAGGCTGCAGG - Intergenic
973858632 4:55038692-55038714 TCCAGCACACACTGAGCTGCAGG - Intergenic
975557581 4:75680023-75680045 CCTAGCCCTCAGTGGGCTGCAGG + Intronic
976741436 4:88361157-88361179 ACAAGCTCCCTCTGGGCTGTCGG + Intergenic
977312930 4:95409973-95409995 CCAATCTCCCAGTGGGCTGATGG + Intronic
979259018 4:118632004-118632026 CCCAACTCCTGCTGAGCTGCTGG + Intergenic
979329332 4:119408557-119408579 CCCAACTCCTGCTGAGCTGCTGG - Intergenic
979638068 4:122979068-122979090 CCCAGCTCCCACTGGCTTCGTGG + Intronic
979780952 4:124650869-124650891 ACGAGCTCCCTCTGGGCTGCCGG + Intergenic
980234753 4:130090706-130090728 ACAAGCTCCCTGTGGGCTGCTGG + Intergenic
981027620 4:140092735-140092757 CCAAGCTCCCACAGAGCAGCAGG - Intronic
981170333 4:141615733-141615755 ATGAGCTCCCTCTGGGCTGCAGG + Intergenic
982024348 4:151236362-151236384 ATGAGCTCCCTCTGGGCTGCCGG + Intronic
982166221 4:152615835-152615857 GCATGCTCCCTCTGGGCTGCTGG + Intergenic
982701779 4:158665074-158665096 ACGAGCTCCCTCTGGGCTGCTGG + Intergenic
984266151 4:177499803-177499825 ACAAGCTCCCTCTGGGCTGTTGG + Intergenic
984778817 4:183505743-183505765 CCGGGCTCCCGCTGGTCTGCGGG + Intronic
985126664 4:186701567-186701589 CCCAGCTCCCACAGGGCATCAGG + Intronic
985487962 5:162570-162592 CACAGCCCCCACTGGGTGGCGGG + Intronic
985574457 5:667239-667261 CCAGACTCCCCCTGGGCTGCGGG - Intronic
985680603 5:1253816-1253838 CTCAGCTGCGTCTGGGCTGCGGG + Exonic
985702193 5:1380394-1380416 ATGAGCTCCCTCTGGGCTGCCGG - Intergenic
986540635 5:8840688-8840710 ACTAGCTCCCTCTGGGCTGCCGG + Intergenic
987488207 5:18546713-18546735 CTCACCTCCCCCTGGCCTGCTGG + Intergenic
988455521 5:31384002-31384024 GCCAGATTCCACTGGGCTGGTGG + Intergenic
988591395 5:32553000-32553022 ACAAGCTCCCTCTGGGCTGCCGG - Intronic
989377560 5:40780644-40780666 CCCAGGACCCAGGGGGCTGCTGG + Intronic
991031133 5:62083493-62083515 AGCAGAGCCCACTGGGCTGCTGG + Intergenic
991107753 5:62862588-62862610 CCCAGCTCCCACTGGCTTCATGG + Intergenic
991120576 5:63008484-63008506 ACGAGCTCCCTCTGGGCTGCTGG + Intergenic
992277003 5:75130902-75130924 ACGAGCTCCCTCTGGGCTACCGG - Intronic
992906974 5:81356460-81356482 CCCAGCACCCTGTGGGCTGCAGG + Intronic
993068938 5:83134186-83134208 ACGAGCTCCCTCTGGGCTGCCGG + Intronic
994932557 5:106207713-106207735 CTCGGCTCCCACTGCTCTGCTGG + Intergenic
995705980 5:114989819-114989841 ACGAGCTCTCTCTGGGCTGCTGG + Intergenic
995707396 5:114999465-114999487 ACAAGCTCCCTCTGGGCTGTTGG + Intergenic
996221429 5:120937091-120937113 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
998133185 5:139661212-139661234 CCCAGCTCACCCTGCTCTGCTGG - Intronic
998169292 5:139863027-139863049 CCCAGCTACAACTGGTATGCGGG - Intronic
998569363 5:143243742-143243764 GCCAGTTCCTACTGGGCTTCTGG + Intergenic
998691774 5:144595364-144595386 ACAAGCTCCCTCTGAGCTGCCGG + Intergenic
999113667 5:149142630-149142652 CCCTGGGCCCACCGGGCTGCAGG - Intronic
999730346 5:154472872-154472894 CCCAGCTCCCACCGCACAGCTGG - Intergenic
1000137332 5:158365420-158365442 CCCAGCTACAACTTGGCTCCAGG + Intergenic
1000258866 5:159566803-159566825 ACCAGTTCCCACAGGGCTGCAGG - Intergenic
1001192121 5:169641002-169641024 CCCAGCTGCCAGTGGTTTGCTGG + Intronic
1001558177 5:172650407-172650429 CCCAGCTCCCACGTGGCAGATGG + Intronic
1001679312 5:173544465-173544487 TCCAGCTCCCACTGGACTCCGGG + Intergenic
1002434229 5:179221357-179221379 TTCAGCTCCCTCTTGGCTGCTGG - Intronic
1002458139 5:179357685-179357707 CCCTGGTCCCACTGCCCTGCTGG - Intergenic
1002688318 5:181032598-181032620 ACTAGCTCCCTCTGGGCTGCTGG + Intergenic
1003120173 6:3312933-3312955 CCCTGCTCCCACCGGGAAGCTGG - Intronic
1003523864 6:6882461-6882483 GCCAGGTCCCACGGGGCTGTGGG - Intergenic
1005232530 6:23720139-23720161 CTCAACTCCCTCTGGGCTGTTGG + Intergenic
1006221435 6:32495380-32495402 ATGAGCTCCCTCTGGGCTGCTGG - Intergenic
1007004046 6:38343047-38343069 CACTGCTCCCACTTGGCTGAGGG + Intronic
1007532380 6:42554323-42554345 ACGAGCTCCCTCTGGGCTGCCGG + Intergenic
1007788739 6:44297195-44297217 CCTACCTCCCACTGCACTGCCGG - Intronic
1007902635 6:45424310-45424332 CCCAGCGCACACTGGGTTGATGG + Intronic
1009690929 6:67031183-67031205 ACAAGCTCCCTCTGGGCTGCTGG + Intergenic
1009971268 6:70627929-70627951 AGGAGCTCCCTCTGGGCTGCCGG - Intergenic
1011472009 6:87717455-87717477 CCCAGCTCCCAGGTGGCTCCTGG - Intergenic
1011713782 6:90083059-90083081 TCCAGCTGCCACAAGGCTGCAGG + Intronic
1013244941 6:108277424-108277446 CCCAGCCCACACTGAGCAGCAGG + Intergenic
1013361339 6:109396380-109396402 TCCAACTCCCAATGGACTGCGGG - Intronic
1014284077 6:119476644-119476666 CCCAGCTCCTGCTGTGGTGCTGG - Intergenic
1016183524 6:141175227-141175249 ATGAGCTCCCTCTGGGCTGCTGG + Intergenic
1017017781 6:150115862-150115884 ACAAGCTCCCTCTGGGCTGCTGG - Intergenic
1017294361 6:152776865-152776887 GAAAGCTCCCACTGGGGTGCTGG + Intergenic
1017737736 6:157380325-157380347 CGCAGCTCCTCCTGGGCTGTCGG + Intergenic
1017853990 6:158332574-158332596 CCCAGCTGCCAATGGCCTGAGGG - Intronic
1018397854 6:163393971-163393993 CCCAGCTCCCTCTGCCCTGCTGG + Intergenic
1018734832 6:166679887-166679909 ACGAGCTCCCTCTGGGCTGCAGG + Intronic
1019433544 7:1010615-1010637 CCTGGCTCCCCCTGGGCTGCAGG + Intronic
1019728152 7:2614421-2614443 CCAAGCTCCCAAGGGCCTGCTGG + Exonic
1019728676 7:2617517-2617539 TCCAGCACCCTGTGGGCTGCTGG + Intergenic
1020308643 7:6853781-6853803 CCCAACTCCGACTGGTTTGCTGG + Intergenic
1021006138 7:15397129-15397151 GAGAGCTCCCTCTGGGCTGCGGG - Intronic
1022389268 7:29929195-29929217 CCGAGCTGACTCTGGGCTGCTGG - Intronic
1022490790 7:30816037-30816059 CCCACCTCCAGCAGGGCTGCAGG + Intronic
1022577976 7:31517441-31517463 ACGAGCTCCCTCTGGGCTGTGGG - Intronic
1023002129 7:35821073-35821095 TCCAGTTGCCACTAGGCTGCTGG + Intronic
1023138562 7:37078054-37078076 CCCAGCAGCCACAGTGCTGCAGG + Intronic
1023939784 7:44762012-44762034 CTCCGCTCCCACTGCGCCGCTGG - Intronic
1024363766 7:48497896-48497918 CCCTGCTGCCACTGGGGTGGGGG + Intronic
1024649406 7:51391150-51391172 CCCAACTCCTGCTGAGCTGCTGG - Intergenic
1025182390 7:56830019-56830041 CCCAACTCCTGCTGAGCTGCTGG - Intergenic
1027226318 7:76246080-76246102 CTCTGCTCTCCCTGGGCTGCAGG - Intronic
1027269829 7:76513241-76513263 CCCTGCTCCCACAGGGCTGGGGG + Intronic
1029522011 7:101068799-101068821 CCCAGCTCCCGGTGGTCGGCTGG + Intergenic
1030950913 7:115789962-115789984 AGGAGCTCCAACTGGGCTGCCGG - Intergenic
1032085233 7:128880266-128880288 CCCAGCTCCCAGCTGGCGGCAGG + Intronic
1033327736 7:140393377-140393399 CCAGGCCCCCACTGGGCAGCTGG + Intronic
1033661712 7:143407553-143407575 CCCATTTCCCACTGGCCTTCAGG + Intronic
1033951290 7:146788113-146788135 ACAAGCTCCCTCTGGGCTGCTGG - Intronic
1034009184 7:147509050-147509072 CCCAGTTCCCACTCAGCTGCAGG + Intronic
1035125591 7:156606692-156606714 CCCAGGTGCGACTTGGCTGCCGG - Intergenic
1035335470 7:158125081-158125103 CACAGAGCCCACTGAGCTGCCGG + Intronic
1035626016 8:1071142-1071164 CCCAGCTTCCGCTCGGCAGCTGG - Intergenic
1035754502 8:2021736-2021758 CCCAGCTCCAGCTGTGCAGCCGG + Intergenic
1035754508 8:2021776-2021798 CCCAGCTCCAGCTGTGCAGCCGG + Intergenic
1035754514 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG + Intergenic
1036794766 8:11747416-11747438 CCCAGCTACCACAAGGCTGCCGG - Intronic
1037689734 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG + Intergenic
1037815515 8:22109663-22109685 CCGAGCGCGCACTGGTCTGCAGG + Intergenic
1037920452 8:22802008-22802030 CCCAGAGCTCCCTGGGCTGCTGG - Intronic
1038970132 8:32624276-32624298 CCCAGCCCCCACTCAGCTGGAGG - Intronic
1040033993 8:42851138-42851160 CACAGCCCCCATTGGGCTCCTGG + Intronic
1040672130 8:49704433-49704455 CCCAGGTCACCCTGGTCTGCTGG + Intergenic
1041145880 8:54875347-54875369 ATGAGCTCCCTCTGGGCTGCAGG + Intergenic
1041148575 8:54907312-54907334 CCCCGCACACACTGGACTGCAGG - Intergenic
1041166254 8:55095699-55095721 CCAAGCCCCCACTGGGGTGGTGG + Intergenic
1041357318 8:57014334-57014356 GGCAGCTCACACTGGCCTGCAGG - Intergenic
1041729531 8:61050789-61050811 CCCTGCCACCGCTGGGCTGCAGG - Intergenic
1042876967 8:73448950-73448972 CCCAGCCCCAGCCGGGCTGCAGG - Intronic
1043224086 8:77700959-77700981 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
1045653423 8:104364003-104364025 ATGAGCTCCCTCTGGGCTGCTGG - Intronic
1048116096 8:131524826-131524848 CCCATCTCCCACTGGAAGGCAGG - Intergenic
1048940457 8:139396115-139396137 TCCAGCTTCCACAGGGCAGCTGG + Intergenic
1049059246 8:140263361-140263383 CCCAGTACCCACTGTGCTTCAGG - Intronic
1049367641 8:142248422-142248444 CTCAGCACCCACGGGGCTCCTGG + Intronic
1049395292 8:142397410-142397432 CCCACCTCCCAGGAGGCTGCAGG + Intronic
1049442195 8:142614611-142614633 CCCTGCGCCCACTCGGCTCCCGG + Intergenic
1049443482 8:142619615-142619637 CCCATCTCCCACTGGCCCCCAGG - Intergenic
1049449821 8:142654635-142654657 CTCAGCTCTCACTGGGCATCTGG + Intergenic
1049468555 8:142764805-142764827 CCCATCTGCCACTGAGCTGAGGG + Intronic
1049479710 8:142816094-142816116 CTCAGCTCCCAGCAGGCTGCAGG + Intergenic
1049570023 8:143365300-143365322 CCCAGCACCCACTGGGCAAGGGG + Intergenic
1049773813 8:144395641-144395663 CCCTGCTCCCACAGAGCTGAGGG - Intronic
1049827177 8:144676672-144676694 ACGAGCTTCCTCTGGGCTGCCGG - Intergenic
1050898281 9:10911169-10911191 ACAAGCTCCCTCTGGGCTGCTGG + Intergenic
1051934814 9:22433983-22434005 ATGAGCTCCCTCTGGGCTGCCGG + Intergenic
1051968835 9:22863097-22863119 ACAAGCTCCCTCTGGGCTGCCGG - Intergenic
1052020635 9:23521799-23521821 TCCAGCACTCCCTGGGCTGCAGG - Intergenic
1052558272 9:30048906-30048928 CCCAGAACCCACTGAGCTGCGGG - Intergenic
1053300555 9:36946241-36946263 CCCAGCTGCCCCTGAGCTTCAGG + Intronic
1055462071 9:76528763-76528785 ACGAGCTCCCTCTGGGTTGCCGG - Intergenic
1055530406 9:77177778-77177800 CCCAGCTCTCTCTGGGCATCTGG + Exonic
1055785179 9:79863656-79863678 CCCAGCTCACACAGCCCTGCTGG + Intergenic
1057113879 9:92501810-92501832 CCCAGATCCCAGTTGTCTGCTGG + Intronic
1057219256 9:93247231-93247253 CCCAGCGCCCCCGGGGCTGGTGG - Intronic
1057274473 9:93669099-93669121 CCCAGGTCCCGCAGGGTTGCTGG - Intronic
1057762937 9:97891074-97891096 CCCAGCTCCCATTCTGCTTCTGG + Intergenic
1057921735 9:99104237-99104259 CCCAGCTCCCGCGGGGCGGAGGG - Intronic
1058901479 9:109446242-109446264 CCCACTTCCCACTGGGGTGCTGG - Intronic
1059609544 9:115878019-115878041 ACCAGCTCCTACTGGGGTGGAGG + Intergenic
1059695456 9:116726055-116726077 CCAAGCTGCCACTGTGCTGAGGG - Intronic
1059948376 9:119436414-119436436 CCCAGCTCTCACTGGCCAGCTGG + Intergenic
1060191585 9:121597370-121597392 CCCTTCTCCCACTGACCTGCAGG + Intronic
1060731177 9:126038005-126038027 CCCTCCTCCCACGGGGCTTCGGG - Intergenic
1060872053 9:127050574-127050596 CCCACCTCCCACTGAGCTTCAGG + Intronic
1061211093 9:129193925-129193947 CCCAGCTGCCCCTGGGAGGCAGG - Intergenic
1061391981 9:130321782-130321804 ACCAGCTCCCACCTGGCAGCCGG + Intronic
1061764561 9:132873708-132873730 CCCAGCACCCACTCGGCCTCAGG + Intronic
1061881085 9:133569401-133569423 CGCAGCTTCCACTGCACTGCAGG - Exonic
1062044875 9:134420336-134420358 CCCAGCACTCACAGGGCTCCCGG - Intronic
1062138056 9:134940075-134940097 CCCAGCCCCCTGTGGGCTGATGG - Intergenic
1062262647 9:135670587-135670609 GCCAGCTCCCAGAGAGCTGCGGG - Intergenic
1062289380 9:135787685-135787707 CCCAGCGCCCACAGGGCTGGGGG - Intronic
1062393639 9:136343828-136343850 CCCAAGGGCCACTGGGCTGCTGG - Intronic
1062597227 9:137304839-137304861 CTCAGCTCCGACTGTGCAGCTGG + Intergenic
1062610173 9:137369991-137370013 CAGAGCCCCCACTGGGCTCCGGG - Intronic
1203368433 Un_KI270442v1:278897-278919 GCCTGCTGCCACTGGCCTGCTGG - Intergenic
1185457166 X:317036-317058 GCCACCTGCCACTCGGCTGCGGG + Exonic
1185611302 X:1395050-1395072 CCCAGCACCCACAGCGCTCCTGG - Intergenic
1190260696 X:48795130-48795152 ACCATTTCCCACAGGGCTGCAGG - Intergenic
1190296974 X:49033425-49033447 CCCACCTCCCGCTGGCCTGAGGG + Intronic
1192234876 X:69289382-69289404 CCCAGCCCAAGCTGGGCTGCAGG - Intergenic
1192554287 X:72077716-72077738 CCCGGATCCCTCTGGGCTGGAGG - Intergenic
1192822092 X:74656558-74656580 GCCTGCTGCCACTGGGCAGCTGG + Intergenic
1193962168 X:87939741-87939763 ATGAGCTCCCTCTGGGCTGCTGG - Intergenic
1194035351 X:88864031-88864053 ATGAGCTCCCTCTGGGCTGCCGG + Intergenic
1194451144 X:94045990-94046012 ATGAGCTCCCTCTGGGCTGCTGG + Intergenic
1195654412 X:107321220-107321242 CCTAGCTAGCACTGGGCTGAGGG + Intergenic
1196663659 X:118294470-118294492 ATGAGCTCCCTCTGGGCTGCTGG - Intergenic
1196741302 X:119028481-119028503 ACGAGCTCCCTCTGGGCTGCCGG - Intergenic
1196911417 X:120488138-120488160 CTCAGCTGGCACTGAGCTGCAGG + Intergenic
1197078950 X:122388975-122388997 ACGAGCTCCCTCTGGGCTGCTGG - Intergenic
1197722620 X:129755490-129755512 CCCAGCCCCCACAGGGCTAGGGG - Intronic
1199437446 X:147828638-147828660 ATGAGCTCCCTCTGGGCTGCTGG - Intergenic
1200180021 X:154144401-154144423 CCCAGCCTCCACGGGCCTGCTGG - Intronic
1200185849 X:154182795-154182817 CCCAGCCTCCACGGGCCTGCTGG - Intergenic
1200191501 X:154219933-154219955 CCCAGCCTCCACGGGCCTGCTGG - Intronic
1200197256 X:154257737-154257759 CCCAGCCTCCACGGGCCTGCTGG - Intronic
1200383552 X:155865504-155865526 ATGAGCTCCCTCTGGGCTGCCGG + Intergenic
1200430363 Y:3072775-3072797 CTGAGCTCCTTCTGGGCTGCCGG + Intergenic
1200921748 Y:8619376-8619398 TCCAGCTCCCATTTGGCTCCAGG - Intergenic
1202242465 Y:22785722-22785744 ATGAGCTCCCTCTGGGCTGCTGG + Intergenic
1202395450 Y:24419471-24419493 ATGAGCTCCCTCTGGGCTGCTGG + Intergenic
1202475334 Y:25250621-25250643 ATGAGCTCCCTCTGGGCTGCTGG - Intergenic