ID: 1091700347

View in Genome Browser
Species Human (GRCh38)
Location 12:2654890-2654912
Sequence CCAGCTCCCACTGGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091700332_1091700347 30 Left 1091700332 12:2654837-2654859 CCTGTGTCCTGTCAGAAGCAGGA 0: 1
1: 0
2: 0
3: 35
4: 280
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1091700334_1091700347 23 Left 1091700334 12:2654844-2654866 CCTGTCAGAAGCAGGATCCCGGT 0: 1
1: 0
2: 0
3: 13
4: 53
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1091700336_1091700347 5 Left 1091700336 12:2654862-2654884 CCGGTCCCAGCATCCACCGCTCT 0: 1
1: 0
2: 0
3: 24
4: 223
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1091700339_1091700347 -8 Left 1091700339 12:2654875-2654897 CCACCGCTCTCAGCCCCAGCTCC 0: 1
1: 0
2: 3
3: 116
4: 1158
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1091700335_1091700347 6 Left 1091700335 12:2654861-2654883 CCCGGTCCCAGCATCCACCGCTC 0: 1
1: 0
2: 5
3: 19
4: 239
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1091700338_1091700347 -1 Left 1091700338 12:2654868-2654890 CCAGCATCCACCGCTCTCAGCCC 0: 1
1: 0
2: 0
3: 33
4: 402
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1091700337_1091700347 0 Left 1091700337 12:2654867-2654889 CCCAGCATCCACCGCTCTCAGCC 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091700347 Original CRISPR CCAGCTCCCACTGGGCTGCA GGG Intronic
900524223 1:3120617-3120639 CCCGCTCCCAGGGGGCTGCCGGG - Intronic
900526198 1:3130039-3130061 CCACCTCCCTCTGGGGTGCTTGG - Intronic
900813048 1:4822516-4822538 CCAGCTCCCAGTGAGCACCAAGG - Intergenic
900860093 1:5222889-5222911 CCAGCTCCCAGAGGGGTGAAGGG - Intergenic
901593337 1:10365200-10365222 CCAGCTCCCACTGGTGCTCAAGG - Exonic
901870852 1:12138462-12138484 CCATCTGCCCCTGGGCTGCAGGG - Intronic
902096768 1:13952034-13952056 ACAGCTCCCATAGGCCTGCAGGG - Intergenic
902661819 1:17909689-17909711 CCAGCTCCCCATTGGCTGCCTGG - Intergenic
902962525 1:19974953-19974975 GCAGCTCCTACTGGCCTGCTGGG - Intergenic
903226394 1:21896346-21896368 CCAGCTCCCACTGAGCCCCACGG + Intronic
904701540 1:32361399-32361421 CCAGCTCCCGCGGAGCCGCAGGG + Exonic
905387736 1:37615858-37615880 CTAGCTCCACATGGGCTGCAGGG - Intronic
907326083 1:53639356-53639378 CCATCTCCCATTGGCCCGCAGGG + Intronic
907836388 1:58113054-58113076 GTTTCTCCCACTGGGCTGCAGGG - Intronic
909465834 1:75973114-75973136 CCAGCTCAGAGTGGACTGCATGG - Intergenic
910625843 1:89305521-89305543 GCAGCTCCCTCTGGTCTACATGG + Intergenic
911719709 1:101177610-101177632 TCACCTCCCACTGTGCTGCATGG - Intergenic
911924782 1:103816632-103816654 CCAAGCACCACTGGGCTGCAGGG - Intergenic
915331894 1:155117852-155117874 CCATCTCCCACCTGCCTGCAGGG + Intergenic
915530213 1:156498919-156498941 CCAGCTCCCACGGCCCTGCCTGG - Intronic
917958841 1:180126607-180126629 CAAGCCCCTAGTGGGCTGCAAGG + Intergenic
917975135 1:180233421-180233443 CCACCTCCCTCCGGGCTGTAGGG + Intronic
919381600 1:196867890-196867912 CCAGCCCTCACTGGGCTGCAGGG - Intronic
920685271 1:208104410-208104432 CCAACTCCCACTGGACCGTAGGG - Intronic
924310779 1:242741181-242741203 GCAGGTCCCACAAGGCTGCAAGG + Intergenic
1064599357 10:16977533-16977555 ACAGCTCCCAGTGGGATGGATGG - Intronic
1065929266 10:30464781-30464803 CCAGGTCCCACTGTGGTGCTCGG - Intergenic
1066067797 10:31774859-31774881 CCATCTCCCTCCAGGCTGCAGGG - Intergenic
1066439742 10:35427168-35427190 CCAGCTGCCCCTGGGGTGCTTGG + Intronic
1067089149 10:43257800-43257822 TGGGCTCCCACAGGGCTGCATGG + Intronic
1067239221 10:44476238-44476260 CCAGATCCCACTGGGAAGGAAGG + Intergenic
1067968478 10:50941801-50941823 TCTGCTCCCCCTGGGCAGCAGGG - Intergenic
1069065808 10:63940797-63940819 CCTAGTCCCAGTGGGCTGCAAGG + Intergenic
1069725117 10:70572494-70572516 CAACCACCCACGGGGCTGCACGG - Intergenic
1069928236 10:71865864-71865886 ACAGCTCCCGCTGGGATGCAGGG - Intergenic
1070773150 10:79094328-79094350 CCAGCTCCCTCCGGGTTGCAGGG - Intronic
1073057847 10:100713635-100713657 CCAGCTCCCCCTGCGCGGCCAGG - Intergenic
1074547857 10:114415745-114415767 CCATCTCCCACGGGGTTGCTTGG - Intergenic
1075062870 10:119268968-119268990 CCATCTCCCTCTGGGCCCCAAGG - Intronic
1075258681 10:120944855-120944877 CCACCTCCCACTGGCCAGCAAGG - Intergenic
1075901024 10:126043006-126043028 CCTCCTCCCACCGGGATGCAGGG + Intronic
1076402860 10:130194937-130194959 CCAGCTCTCCCTGGCCTGGAGGG - Intergenic
1076408965 10:130232489-130232511 TGAGCTCCCACTGGGATGAAGGG - Intergenic
1076773363 10:132679288-132679310 CCAGCTCCCACTGGAAACCACGG - Intronic
1076774207 10:132685291-132685313 CCAGCTCCCAGTGCGCCCCAGGG - Intronic
1078064054 11:8066383-8066405 CCAGCTCCCTCTGGACTGCACGG - Intronic
1078076706 11:8168832-8168854 CCAGCTCCCTCTGAGCTTCCCGG - Intronic
1078914858 11:15769694-15769716 CCAGCTCCCCCTGTGTAGCATGG + Intergenic
1079081883 11:17419319-17419341 CCAGCTCCTAGTGGGCTGGAGGG - Intronic
1079439615 11:20497754-20497776 TCAGTTCACACAGGGCTGCAAGG + Intronic
1081756612 11:45549307-45549329 CCTTCTCCCAGTGGGATGCAGGG + Intergenic
1082091085 11:48090365-48090387 CCAGCTCACACTGGTCTTGAAGG + Intronic
1082851029 11:57764949-57764971 CCAGCTCCCCATGGGCTCTATGG - Intronic
1083234610 11:61343608-61343630 CCAGCTCTCACTGGACTAGAAGG + Intronic
1083783288 11:64929284-64929306 CCAGCACCCACTGGGCATCAAGG + Intronic
1083921202 11:65781999-65782021 CCAGCTGGCACTGGCTTGCATGG - Intergenic
1083928376 11:65823426-65823448 CCAGGCCCCACTGGCCTGCCTGG - Intronic
1084028019 11:66465122-66465144 CCACCTGACACTGGACTGCATGG - Intronic
1084438146 11:69155979-69156001 CCTGCACCCACTGGGCTGCCTGG - Intergenic
1084469485 11:69348728-69348750 CCAGCTCCCACTCTGGTGCATGG + Intronic
1084625126 11:70300287-70300309 CCAGTTCCTACTGGGATTCAGGG + Intronic
1084705008 11:70811004-70811026 CCAGTGTCCCCTGGGCTGCATGG + Intronic
1085100702 11:73797483-73797505 CCAGCAACCACAGGGCTCCAAGG - Intronic
1085351714 11:75802086-75802108 CCAGCTCCCACTGGACGGGAGGG + Intergenic
1085708192 11:78805481-78805503 CCATCTCACAGTGGACTGCATGG - Exonic
1089879106 11:121756328-121756350 CCAGCTCCCATTGGCCAGCATGG - Intergenic
1090263942 11:125342432-125342454 CCAGCTCCCAGTGAGCGTCAGGG + Intronic
1090404644 11:126469430-126469452 CCTCCTCCCCCAGGGCTGCAAGG - Intronic
1091552547 12:1547492-1547514 CGAGCCACCCCTGGGCTGCACGG - Intronic
1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG + Intronic
1091781323 12:3216155-3216177 CCAGCTCCCAGAGGGCCCCAGGG - Intronic
1096123488 12:49103655-49103677 CCAGCTTCCTCCAGGCTGCATGG - Intronic
1096669736 12:53191501-53191523 CCAGTTCCCACTGTCCTCCAAGG + Exonic
1096829653 12:54304410-54304432 CCAGCTCCCTCTGGGACCCATGG - Intronic
1097192023 12:57224026-57224048 TCAGCCCCAACTGGCCTGCAAGG - Intronic
1097248961 12:57621883-57621905 CCAGTTCCCACAGGACCGCAGGG - Intronic
1097637511 12:62140749-62140771 CCAGCTTCCCCAGGGCTGCCAGG + Intronic
1102756249 12:115343295-115343317 CCAGCTTTCACTGGACTCCAAGG + Intergenic
1103363233 12:120366370-120366392 CCAAGTCCCACTGGGCTCCAGGG + Intronic
1104771140 12:131365574-131365596 ACAGCTCCCACAGGGATGCGAGG - Intergenic
1105508988 13:21035763-21035785 CCAGCTCCCAAAGGGCTGCAGGG + Intronic
1106463686 13:29994379-29994401 GCATCTCCCACAGCGCTGCAGGG + Intergenic
1106554086 13:30795426-30795448 AGAGCTCCCACTGGGCACCAGGG - Intergenic
1108459135 13:50647490-50647512 ACAGTTCCCACTGGGCATCAAGG - Intronic
1108494016 13:51006710-51006732 CCAGCTACCAGAGAGCTGCATGG + Intergenic
1109058423 13:57581971-57581993 GCAGCTCCCACTTGGATGAACGG - Intergenic
1110250257 13:73373185-73373207 GCAGCTCCCCATTGGCTGCAGGG - Intergenic
1112046673 13:95604336-95604358 CCAGCTTCCCCAGGGCGGCAGGG - Intronic
1112998190 13:105599750-105599772 CCAGCTCCCACGTAGCAGCAGGG + Intergenic
1113502716 13:110790452-110790474 CCAGATCCCAGTGGGCTGTCAGG + Intergenic
1113535028 13:111059154-111059176 GCAGCTCCCACTTGGATGGACGG - Intergenic
1115545628 14:34462571-34462593 CGAGCGCCCGCTGGGCTGCGGGG - Intronic
1115707738 14:36015360-36015382 CCAGCTCCCCCTGGCCTTCAGGG + Intergenic
1118497670 14:66324906-66324928 CCAGCTCCCATAGACCTGCAGGG - Intergenic
1118976032 14:70677371-70677393 CCAGCAGCCTCTGAGCTGCAAGG + Intergenic
1118978820 14:70699900-70699922 CCTCCTGTCACTGGGCTGCAGGG - Intergenic
1120946781 14:90005260-90005282 CCAGAGCCCACAGGGCTCCAAGG - Intronic
1121175055 14:91884793-91884815 CCAACTCCCACTGGGCAGGGAGG + Intronic
1121441874 14:93954615-93954637 CTTGCAGCCACTGGGCTGCAGGG - Intronic
1122598466 14:102909124-102909146 CCAGCCCCAGCTGGGCTGGAGGG + Exonic
1122604328 14:102938265-102938287 CCACCTCCCCCAGGGCTGCGGGG + Intronic
1122628746 14:103097861-103097883 CCAGCTTCCCCTGGGGTTCACGG - Intergenic
1122819713 14:104335353-104335375 CCAGTCTCCACTGGGCTGCAGGG - Intergenic
1124421808 15:29529419-29529441 CCAGCAGCCTCTGGGCTGGAGGG + Intronic
1124477234 15:30045429-30045451 CCAGCCCCCGCCGGGCTGTAAGG - Intergenic
1127827459 15:62717653-62717675 CCAGCTGCTGCTGGGCCGCAGGG - Exonic
1128482861 15:68054683-68054705 CCAGCTCCCCATGGGGGGCAGGG - Intronic
1129463243 15:75710374-75710396 CCAGCTCCTTCTGAGCTGTATGG - Intronic
1129744377 15:78007921-78007943 GCACCTCCCGCTGGCCTGCAGGG + Intronic
1130078145 15:80707959-80707981 CAAGCTCCCACTGAGCTTCAGGG - Intronic
1130909772 15:88263021-88263043 CTGCCTCCCCCTGGGCTGCAGGG + Intergenic
1131264118 15:90905731-90905753 CCAGCTCCCAGGAGTCTGCAGGG - Intronic
1132544647 16:527691-527713 ACGGCTCCCACAGGGCTGCGCGG - Intergenic
1132601554 16:775219-775241 CCACGTCCCCCTGGGCGGCACGG + Exonic
1132987478 16:2775419-2775441 CCACCACCCACTGGGCTGGGTGG - Intronic
1135250929 16:20900549-20900571 CCAGCTCCCTCCGGGTTGCTAGG - Intronic
1135376758 16:21953759-21953781 CCCGCTCCCCCTGGGTTTCACGG - Intronic
1139347920 16:66316384-66316406 CCAGGGCTCACTGGGCTGCCTGG - Intergenic
1139348556 16:66320859-66320881 CCAGCTCCCAATGAGGTGCCAGG + Intergenic
1139449948 16:67021512-67021534 GGAGCTCCCACTGGGCAGGAGGG + Intergenic
1140406372 16:74714049-74714071 GCACCTTCCACTAGGCTGCAGGG + Exonic
1141362311 16:83407114-83407136 CCTGCTCCCAGAGGGCTGCCTGG - Intronic
1141479128 16:84294701-84294723 CCACCGCCCACTGAGCTGCCTGG + Exonic
1141705191 16:85661008-85661030 CCAGTGCCAACAGGGCTGCAGGG - Intronic
1142978390 17:3658299-3658321 CCCGCTCCCGCTGGGCTCCCGGG - Intronic
1143038773 17:4016944-4016966 CCAGCACCTGCAGGGCTGCAAGG + Intronic
1143974429 17:10819727-10819749 CCATCTCCCACTGCACAGCAGGG - Intergenic
1144891320 17:18495932-18495954 CCTCCTCCCACTGGGATGCCAGG - Intergenic
1145140903 17:20448385-20448407 CCTCCTCCCACTGGGATGCCAGG + Intergenic
1145205248 17:20981345-20981367 CCAACTCCCACTGTGCTGGCTGG - Intergenic
1145799230 17:27672601-27672623 AAGGCTCCCACTGGGTTGCAGGG - Intergenic
1145836407 17:27957290-27957312 CCAGCCCCCACCGAGCTTCAGGG + Intergenic
1148220737 17:45860041-45860063 ACAGCTCCCACATGGCTGCCTGG + Intergenic
1148227479 17:45909052-45909074 GCAGCTCCCGCTGGGATCCATGG - Intronic
1148818926 17:50349059-50349081 CCAGCTCCCACTGCAGTGCAGGG + Intronic
1150216838 17:63476019-63476041 CCACCTCCCACTGCGCCGCCGGG + Intergenic
1151398837 17:73842663-73842685 CAACCTCACACTGGGCTGGAAGG + Intergenic
1151730879 17:75910415-75910437 CCAGCTCTCACTGGGCTCTGTGG - Intronic
1152616419 17:81339999-81340021 CCAGCAGCCACTTGGCTGCCAGG + Intergenic
1152722307 17:81928999-81929021 CCAGCTCCCGCTGTGTGGCACGG - Intergenic
1152726380 17:81948799-81948821 CCAGCTCCCACAGCACGGCAGGG + Intergenic
1155168127 18:23247516-23247538 CCTGCTCCCGCTCAGCTGCATGG - Intronic
1157069248 18:44386708-44386730 ACAGCTCCCCCTGGGTTCCAGGG - Intergenic
1157914677 18:51653406-51653428 CCATCAACCACTGAGCTGCATGG - Intergenic
1160162091 18:76481081-76481103 CAAGCCCCCTCTGGGCTTCATGG + Intronic
1160310539 18:77786066-77786088 CCAGCTGCCCCTGGGCTGAATGG + Intergenic
1160397044 18:78580193-78580215 CCTGCTCCCACTCAGCTCCATGG - Intergenic
1160591451 18:79947145-79947167 TCAGGCCACACTGGGCTGCAGGG - Intronic
1160970230 19:1764677-1764699 CCAGCTCCCCGAGGGGTGCAGGG + Intronic
1160990507 19:1858467-1858489 TCTGCTCCCACTGGAGTGCAGGG - Intronic
1161452986 19:4357087-4357109 CCAGCTCCCACTGGACTCAGTGG + Intronic
1161574466 19:5048041-5048063 CCAGGCCCCTCTGGGCAGCATGG - Intronic
1162527471 19:11214723-11214745 CCAGTGCCCCCTGGGCTGCCAGG - Intronic
1162939046 19:13997161-13997183 CCAGCCTCCCCTGGGCTGCTTGG - Intronic
1163723632 19:18910264-18910286 CACCCTCCCACTGGGCTCCAGGG + Intronic
1165454899 19:35904685-35904707 CCTTCTCCCAGTGGCCTGCAAGG + Intronic
1167366820 19:49058781-49058803 CCAGCTCCTGCTTGGCTACAGGG - Exonic
1167615217 19:50529264-50529286 CTGTCTCCCACTGGGCTTCACGG - Intronic
1168594633 19:57665247-57665269 CTAGCTGCCACTGTGCTGCTAGG + Intergenic
926046813 2:9716085-9716107 CTTGCTTCCACTGGGATGCAGGG - Intergenic
926143150 2:10380523-10380545 CCATCACCCACTGGCCTCCATGG + Intronic
927143434 2:20145088-20145110 CCAGCCACCCCTAGGCTGCATGG - Intergenic
927210936 2:20638627-20638649 CCAGATCCCCAGGGGCTGCAGGG - Exonic
927467232 2:23346645-23346667 CCAGCACCCAGTGGGATGCAAGG - Intergenic
927484164 2:23477538-23477560 GCTGCCCCCACTGGGCTGCTGGG - Intronic
927937618 2:27084438-27084460 CCAGGGCCTCCTGGGCTGCAGGG + Exonic
933810106 2:86027777-86027799 CAAGATCCCACTGGTGTGCAAGG + Intronic
934674423 2:96239552-96239574 CCAGCCCCCACTGAGCTGAGGGG - Intergenic
935571374 2:104664368-104664390 CCAGGTCCCTCTTGGCAGCAGGG + Intergenic
935744523 2:106178980-106179002 CCAGGTCCCTGTGGGCTGGACGG + Intronic
935897448 2:107753070-107753092 TCGGTTCCCACTGGGCTCCAGGG - Intergenic
937207191 2:120244359-120244381 TCAGCTCCCACTGAGCTGAGCGG - Intronic
937863347 2:126730397-126730419 CCAGCCTCCTCTGGGCTCCAGGG + Intergenic
941072589 2:160971123-160971145 CCAGTTACCACTGGCCTGGAAGG + Intergenic
941805850 2:169711770-169711792 CCAGCTCTCCCTTGGCTTCAGGG + Intronic
943301967 2:186213994-186214016 CCAGCTGTCACTGAGCAGCATGG + Intergenic
945679248 2:212893443-212893465 CCATCTCCCACTGGGCTCAGAGG - Intergenic
947634405 2:231672858-231672880 CCAGCTCCCCCAGGAGTGCATGG + Intergenic
948130675 2:235598259-235598281 CCTGCCCCCACTGAGCTGCTGGG + Intronic
948353240 2:237357929-237357951 GCAGCTGCCACTGGACTGGATGG + Intronic
948569566 2:238909427-238909449 ACAGCTCCCTCGGGCCTGCACGG + Intronic
948715998 2:239864303-239864325 CCTGCTGCCCCTGGGCTGGAGGG + Intergenic
948759145 2:240179732-240179754 CTGGCTCCTCCTGGGCTGCACGG - Intergenic
948856960 2:240734781-240734803 CCCGCTCCCGCTGCGCTGCCCGG - Intronic
948903208 2:240966388-240966410 CCCGCTCCCGCTGGGCTTCCCGG - Intronic
1170109593 20:12790485-12790507 CCAGCTCCCACTGGTCAGTTGGG - Intergenic
1171436612 20:25129796-25129818 CCTGCCCCCACTGAGCTGCTTGG - Intergenic
1171443603 20:25187198-25187220 ATAGCTCCCACTGGGCAGCCTGG + Intergenic
1172784411 20:37457482-37457504 CCATCTCACACTGGGCAGAATGG - Intergenic
1173827475 20:46057077-46057099 CCAGCCCGAACTGGGCTGCTGGG - Intronic
1173945826 20:46950249-46950271 CCAGCTGCCACTAATCTGCAGGG + Intronic
1174182314 20:48682660-48682682 CCAGCTCCCACGTGACTGCCCGG + Intronic
1175189246 20:57199981-57200003 CCTGCAGCCACTAGGCTGCAAGG + Intronic
1175571474 20:60026035-60026057 CCAGGCCTCACTGGGATGCATGG + Intronic
1175715282 20:61251529-61251551 CCAGCTCCCTTTGCCCTGCATGG - Intergenic
1176000444 20:62829123-62829145 ACAGCACCCACTGGGCACCAGGG - Intronic
1176309656 21:5142857-5142879 CCTGCAACCACTGGGTTGCACGG - Intronic
1176381007 21:6111907-6111929 ACACCTCCCACGGGGCTGGAGGG + Intronic
1176809368 21:13521064-13521086 AGAGCTGCCACTGGGCTCCAAGG + Intergenic
1179416095 21:41199747-41199769 CCAGCTCTCACTGGCAGGCAAGG + Intronic
1179742465 21:43426333-43426355 ACACCTCCCACGGGGCTGGAGGG - Intronic
1179847402 21:44119176-44119198 CCTGCAACCACTGGGTTGCACGG + Intronic
1179992699 21:44956925-44956947 CCAGCTGCCACGGTGCTGCCTGG - Intronic
1180119234 21:45735716-45735738 CCAGCTCCTGCTGGTCTACATGG - Intronic
1181276953 22:21693509-21693531 CCACCTCCCACAGAGCTGCATGG + Intronic
1181521843 22:23452746-23452768 CCTGCTCCCACTGGCCTTCCTGG - Intergenic
1182246874 22:28965115-28965137 CCAGGTGGCACTGGTCTGCATGG - Intronic
1182948564 22:34349155-34349177 CTGGCTCCCACTGGCCTCCAAGG + Intergenic
1183528583 22:38339184-38339206 CCAGCCCCCACTGGGCTAAAGGG + Intronic
1183675534 22:39297098-39297120 CCAGCTCCCACGGGCCCGCTGGG + Intergenic
1185066272 22:48633133-48633155 GCCGCCCCCACTGGGCAGCAAGG + Intronic
1185080907 22:48708827-48708849 GCTCCTCACACTGGGCTGCAGGG + Intronic
1185274291 22:49943725-49943747 TCAGCTCACGATGGGCTGCATGG - Intergenic
950536776 3:13583472-13583494 CCTGCTCACACTGGGCAGCCAGG - Intronic
950969280 3:17170270-17170292 CCAGCTCCCACTGGGTAGGTGGG + Intronic
951294447 3:20917217-20917239 GCAGCTCCCACTTGGATGGATGG + Intergenic
952408430 3:33026087-33026109 CCAGCTCCTGCTTGGCTCCATGG - Intronic
952788091 3:37176022-37176044 CCTGCTCCCACCGGGCTGGCGGG + Intronic
953195903 3:40732687-40732709 ACAGCTCCCACTTGGATGGATGG - Intergenic
954360861 3:50122179-50122201 CCAACTCCCCATGGGCTGTAGGG - Intergenic
954613503 3:51958233-51958255 ACAGCTCCCCCTGGCCTGCTGGG - Exonic
954614766 3:51964042-51964064 CCAGCCCCCTCTGGTCAGCAGGG + Intronic
954711361 3:52506598-52506620 TCTGCTCTAACTGGGCTGCAGGG + Intronic
961062453 3:123842926-123842948 CTAGCTCCCAATGTGCTGCTGGG + Intronic
961440044 3:126947335-126947357 CCAACTCCCATTGGGCAGCCGGG - Intronic
961494865 3:127284242-127284264 CCACCTCAGGCTGGGCTGCATGG + Intergenic
962851238 3:139309692-139309714 CCAGCTCCCAATCTGCTGAATGG - Intronic
965817121 3:172648209-172648231 GCAGCTGCCACTGGACTGGAGGG + Intronic
966092046 3:176151282-176151304 CCACCTCTGACTGGGCAGCAAGG + Intergenic
966920347 3:184607209-184607231 CCCACTCCCCATGGGCTGCAGGG + Intronic
968688465 4:1977057-1977079 CCAGGCCCCTCTGGGCTGCCAGG - Intronic
968702402 4:2063162-2063184 AAAGCTCCTCCTGGGCTGCAGGG + Intronic
968726515 4:2250403-2250425 CCAGCTGCTGCTGGGCTGCCTGG - Exonic
968830253 4:2929773-2929795 CCAGCTTCCTCTGAGCCGCAGGG + Exonic
969182869 4:5455502-5455524 CCAGATCCTACTGGTTTGCAGGG + Intronic
969258213 4:6017319-6017341 CCAGCTCCCGCTGGGTGGCCTGG - Intergenic
969318464 4:6396008-6396030 CCAGGTCCCACTGGGGTGGCCGG - Intronic
969611857 4:8232061-8232083 CCAGCTCTCCCTGGCCTGCAAGG + Exonic
970438120 4:16055382-16055404 CCAGCTCTCATTTGGCTGCAGGG + Intronic
972563786 4:40251392-40251414 CCAGCTTCTACTGGGCTCTAGGG + Intergenic
972796527 4:42426444-42426466 CCTGCTCCAACTGGGGTCCATGG - Intronic
975557582 4:75680024-75680046 CTAGCCCTCAGTGGGCTGCAGGG + Intronic
978174141 4:105708928-105708950 CCAGCTCGGACTGGGCGGGAAGG + Exonic
981027619 4:140092734-140092756 CAAGCTCCCACAGAGCAGCAGGG - Intronic
982293825 4:153806473-153806495 TGAGCTCCCTCTGGGCTGCCAGG + Intergenic
983417101 4:167471308-167471330 CCAGCTCCCACTGCCCTGAGTGG - Intergenic
983563937 4:169130095-169130117 CCAGTTGTCACTGGGCTGCTTGG + Exonic
984059205 4:174971530-174971552 CCCACTCCCTCTGGCCTGCAAGG + Intronic
985786406 5:1897586-1897608 CCAGCCCCCACAGGCCTGTATGG - Intergenic
985888227 5:2696630-2696652 GTAGCTCCCTCTGGCCTGCAGGG - Intergenic
986526446 5:8683679-8683701 ATAGCTTCCACTGAGCTGCAGGG + Intergenic
986910425 5:12548963-12548985 CCAAGACCCACTGGGCTGCATGG + Intergenic
986934607 5:12867447-12867469 CCAGGTCACACTGGGGTGAATGG - Intergenic
987480830 5:18455173-18455195 CCAGCTACCGGTGGACTGCATGG + Intergenic
988455523 5:31384003-31384025 CCAGATTCCACTGGGCTGGTGGG + Intergenic
988499857 5:31775709-31775731 TCATCTCCCACTTGGCTCCAGGG + Intronic
988620120 5:32814885-32814907 CCAGCAGCCAATGAGCTGCAAGG - Intergenic
991031134 5:62083494-62083516 GCAGAGCCCACTGGGCTGCTGGG + Intergenic
991355772 5:65767398-65767420 CCAGCTCCAGCTGGGCTAAAAGG - Intronic
992891747 5:81210346-81210368 CCAGCTCTCACTTGCCTTCAGGG + Intronic
997429238 5:133826106-133826128 TCAGCTTCCACTGCGCTCCATGG + Intergenic
998043727 5:138969933-138969955 CCAGCTCACACTGGGCACAAGGG + Intronic
998476575 5:142427251-142427273 CCAACTCCAACGGGGCTGGAAGG - Intergenic
998569365 5:143243743-143243765 CCAGTTCCTACTGGGCTTCTGGG + Intergenic
999185310 5:149703101-149703123 CCAGCACCCACAAGGCTGGAGGG + Intergenic
1003092487 6:3115621-3115643 CCAGCTCCCACAGTCCTGCTTGG + Intergenic
1003232820 6:4270088-4270110 CCAGCTCCTAGGGGGATGCAGGG + Intergenic
1006177066 6:32128802-32128824 CCAGTTCCTCCTGGGCTGCCCGG + Exonic
1007119898 6:39371157-39371179 CCAGCTCCCACTGGCTCACAAGG - Intronic
1007239203 6:40413094-40413116 CCATCACCCACTGGGTGGCATGG - Intronic
1007510692 6:42372372-42372394 ACGGCTCTCACTGGGCTACAGGG + Intronic
1013244943 6:108277425-108277447 CCAGCCCACACTGAGCAGCAGGG + Intergenic
1013451173 6:110282595-110282617 GCAACTCCCACTGGGCACCACGG + Intronic
1017770215 6:157638850-157638872 CCATCTCCCACAGCCCTGCACGG - Intronic
1017990836 6:159488658-159488680 CCAGCTGACACTGGGTTGAAGGG - Intergenic
1018437323 6:163774133-163774155 CCAGTACCCACAGCGCTGCAGGG - Intergenic
1018721383 6:166575679-166575701 ACACCTCCCACTGAGCTGAATGG + Intronic
1019589496 7:1823740-1823762 CCTGCTCCCACTGGCCTTCCTGG + Intronic
1019610300 7:1933320-1933342 CCAGGTCCTTCTGGGCTGCTCGG + Intronic
1022176350 7:27875168-27875190 CCAGCCTCCACTCGGCTGCCTGG + Intronic
1023367312 7:39476684-39476706 CCAGGTCTGTCTGGGCTGCAAGG + Intronic
1023862263 7:44223761-44223783 CCAGCCCCCACTAGGCTGCCTGG + Intronic
1024564742 7:50672169-50672191 CCAGCTCCCTTCGGGTTGCATGG + Intronic
1024973981 7:55096639-55096661 GCAGTTCCCACAGGGCTGCGTGG - Intronic
1026885492 7:73940595-73940617 CCTGCTCCCTCTGGCCTTCATGG + Intergenic
1029979270 7:104862855-104862877 CCAGCTCCGACTCGGCAGCTAGG - Intronic
1032714339 7:134492105-134492127 CCAGCCTCCACCGGCCTGCATGG - Intergenic
1033171607 7:139089401-139089423 ACCTCTTCCACTGGGCTGCAAGG - Intronic
1033348369 7:140542448-140542470 CCAGCTCACAGAAGGCTGCAGGG - Intronic
1034901498 7:154910489-154910511 TGAGCTCCTCCTGGGCTGCAGGG - Intergenic
1035356564 7:158279456-158279478 CGAGCTCCCATTGGGCTGCCTGG - Intronic
1035848085 8:2886544-2886566 ACAGGTCCCGCCGGGCTGCAGGG - Intergenic
1036794764 8:11747415-11747437 CCAGCTACCACAAGGCTGCCGGG - Intronic
1038174861 8:25171577-25171599 TCAGCTGCCACTGGGCTGGGAGG + Intergenic
1040068654 8:43170707-43170729 CCTGCACCCACTGTGCTACAGGG - Intronic
1041662876 8:60415942-60415964 CCAGCACCTACTGGGTTGCCTGG - Intergenic
1042270210 8:66947395-66947417 CCTGTTCACACTGGACTGCAGGG + Exonic
1042712430 8:71733533-71733555 CCTCCTCCCACTAGGCTGGAGGG + Intergenic
1045479584 8:102581428-102581450 CCACACCCCACTGGGCTGGAAGG + Intergenic
1045847828 8:106658164-106658186 CCAGGTCCCTCCGGGCTGGACGG - Intronic
1046482372 8:114839087-114839109 CCAGCTTCCACTGGACTTCATGG + Intergenic
1048116094 8:131524825-131524847 CCATCTCCCACTGGAAGGCAGGG - Intergenic
1048281329 8:133107627-133107649 CCAAGCCCCACTGGGGTGCAAGG - Intronic
1049248075 8:141573284-141573306 GGAGCTCCCACTGGCCTGTATGG + Intergenic
1049479711 8:142816095-142816117 TCAGCTCCCAGCAGGCTGCAGGG + Intergenic
1049757028 8:144315327-144315349 CCAGCCCCCACTGGGGTAGAGGG + Exonic
1049780441 8:144426318-144426340 CCAGCTCCCTCTGGGCTCTTTGG - Intronic
1052349901 9:27447821-27447843 CCAGCAGCCAGTGGGGTGCAGGG + Intronic
1053143777 9:35698364-35698386 CCAGCTCCTTGTGGCCTGCAAGG - Exonic
1053311668 9:37024639-37024661 CCAGCCCCCACTGTGCTGCCAGG + Intronic
1055204307 9:73708931-73708953 CCAGCTCCCACAGGGCCTAAAGG - Intergenic
1056932437 9:90890198-90890220 CCACCTCCCACTTGGCTCCCAGG + Intronic
1057270088 9:93645662-93645684 TCAGCTCACGCTGGGCTACATGG + Exonic
1057619027 9:96619134-96619156 CCACCTCCCACCGGGCTGCCCGG - Intronic
1058824069 9:108759300-108759322 CCAGCTCCTCCTGGGGAGCAAGG - Intergenic
1058901477 9:109446241-109446263 CCACTTCCCACTGGGGTGCTGGG - Intronic
1059668172 9:116469007-116469029 GCAGCTTTCACTGGGCTGAAAGG + Intronic
1059948378 9:119436415-119436437 CCAGCTCTCACTGGCCAGCTGGG + Intergenic
1060191587 9:121597371-121597393 CCTTCTCCCACTGACCTGCAGGG + Intronic
1060267371 9:122120199-122120221 CCAGCTCCCACTGGGCTTGGTGG + Intergenic
1061620309 9:131807508-131807530 CCGGCTCCCTCTGGGATGGAGGG + Intergenic
1061764563 9:132873709-132873731 CCAGCACCCACTCGGCCTCAGGG + Intronic
1061881084 9:133569400-133569422 GCAGCTTCCACTGCACTGCAGGG - Exonic
1062132536 9:134907281-134907303 TCAGCCCCCAATGGGCTACAAGG + Intronic
1062207092 9:135343190-135343212 CCAGGTCCCACTGAGCCTCATGG + Intergenic
1062362780 9:136195511-136195533 CCAGCCCCCACTCTGCTCCAGGG + Intergenic
1062726848 9:138078987-138079009 CCAGCGACCTCTGGGCTGGATGG + Intronic
1185457168 X:317037-317059 CCACCTGCCACTCGGCTGCGGGG + Exonic
1187346278 X:18467414-18467436 CCTGCTGCCACTGGACTGGATGG + Intronic
1188055079 X:25531309-25531331 CCAGTCCCCACTGAGCAGCAAGG + Intergenic
1188162752 X:26822498-26822520 CCTGCTCTCTCTGGCCTGCATGG - Intergenic
1190413145 X:50156516-50156538 CCCCCTCCCCCTGGGCTGGAGGG + Intergenic
1190825852 X:54017361-54017383 CCACCTCCTCCTGGGCTCCAGGG - Intronic
1191715931 X:64193548-64193570 CCAGCTCTCTCTGGGCCCCAAGG + Intronic
1192234874 X:69289381-69289403 CCAGCCCAAGCTGGGCTGCAGGG - Intergenic
1193012095 X:76687827-76687849 CTAACTCACAGTGGGCTGCATGG - Intergenic
1198806723 X:140501635-140501657 CCATCCCCCACTGTGCAGCATGG - Intergenic