ID: 1091700634

View in Genome Browser
Species Human (GRCh38)
Location 12:2658283-2658305
Sequence ATTTTTAAGTAGATTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 611}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091700634 Original CRISPR ATTTTTAAGTAGATTTTGGA GGG (reversed) Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
901582544 1:10257047-10257069 AATTTTAAGTTGAATTTTGAGGG + Intronic
901607916 1:10474038-10474060 ATTTTAAATTAAATATTGGACGG - Intronic
901969860 1:12899073-12899095 ATTTTTATTTTGATTTTGTAGGG - Intronic
902015312 1:13302707-13302729 ATTTTTATTTTGATTTTGTAGGG + Intergenic
903844059 1:26266465-26266487 ATTTTAAAGATGTTTTTGGAAGG + Intronic
905391764 1:37640321-37640343 ATTTTTAAGTGGAGATTCGAAGG - Intergenic
906365094 1:45202581-45202603 AATTTTAAGTAGATTTTGACAGG - Intronic
906857899 1:49328161-49328183 ATTCTTAAGTTCATCTTGGAAGG - Intronic
907120928 1:52007337-52007359 ATTTTTAAGGATAATTTGGAGGG + Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908583374 1:65541951-65541973 ATATTTAAGTAGAATTTGATAGG + Intronic
908787413 1:67748965-67748987 TTTTTTAAGGAGAGTTTGTAAGG - Intronic
909185151 1:72478103-72478125 ATTTGTAATAAGACTTTGGAAGG + Intergenic
909871747 1:80748885-80748907 ATATTTAAGAAGATTTTTAAAGG - Intergenic
910404296 1:86870283-86870305 ATTTTGAAATAAATTTTGTAGGG - Intronic
910718056 1:90254679-90254701 ATTTTTAAATAAATTTTAAAAGG + Intergenic
911200104 1:95035977-95035999 ATTTTTAAATGTATGTTGGATGG + Intronic
911429518 1:97766418-97766440 ATTTGCAAGCAGATTTTAGAGGG + Intronic
911642022 1:100299710-100299732 ATTGTTATGTAGTTGTTGGAAGG + Intergenic
913121058 1:115741184-115741206 ATTTGGAAACAGATTTTGGAGGG - Intronic
913446501 1:118955968-118955990 ATCTTCAAGGAGATTATGGATGG - Intronic
913502712 1:119486327-119486349 AGGTTTAAGAAAATTTTGGAAGG - Intergenic
913553951 1:119945180-119945202 ATTTTTTAGTAGTTATTGTAGGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
916139264 1:161679815-161679837 ATTTTTAAGAATTTTTTGGCCGG + Intergenic
916689581 1:167177586-167177608 ATTTTTAAGTAAAATGTTGAAGG - Intergenic
916758556 1:167796499-167796521 ACTTTTAAATATATTTTGTAGGG + Intergenic
916884217 1:169051509-169051531 ATTTCAAAGTGAATTTTGGAAGG + Intergenic
916899834 1:169209517-169209539 GTTTTGAAATATATTTTGGAAGG - Intronic
918452553 1:184673525-184673547 ATTTTTAAGGATAATTTGGTGGG - Intergenic
920422859 1:205847274-205847296 GTTTTTAATTAGATTTAGGAAGG + Intronic
920423597 1:205854463-205854485 GTTTTTAATTAGATTTAGGAAGG - Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
922540788 1:226417665-226417687 TTATTTATGTAGATTTTGGTTGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1063203546 10:3808476-3808498 ATTTTTAAAAAGATTCTGAATGG - Intergenic
1063944374 10:11162730-11162752 ATTGAAAAGTAGATTTTTGATGG + Intronic
1067823409 10:49550650-49550672 ATTTTTAAGGATAGTTTGGTGGG + Intergenic
1068146070 10:53072207-53072229 ATTTTTTGGTAGTTTTTGGGTGG - Intergenic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068280866 10:54867781-54867803 ATTTGTATATAGATATTGGAGGG - Intronic
1068936877 10:62644285-62644307 AATTTTTGGTAGATGTTGGAGGG + Intronic
1071699343 10:87913309-87913331 ATTTTTAAGGACATTTTTGCTGG + Intronic
1071861292 10:89675469-89675491 ATTGTTAAGTAAATTTTCCAAGG - Intergenic
1072767423 10:98106852-98106874 TTTTTTAAGGACACTTTGGAGGG - Intergenic
1074063146 10:109986827-109986849 ATGTTTAAGTTGACTTTGGCTGG + Intergenic
1075036298 10:119071117-119071139 ATATTTAAGTAGATAGTGGAAGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1076277410 10:129214033-129214055 ATTTTTATTTAAATTTTGGGTGG - Intergenic
1077746220 11:4909156-4909178 ATTTTTAAGAACATATTAGAGGG - Intronic
1077937666 11:6805967-6805989 ATTTTAAAGTAGAAATTGAAAGG - Intergenic
1078033522 11:7779350-7779372 ATTTTTATATAGATATTGGATGG - Intergenic
1079232235 11:18658763-18658785 ATTTTTAAGAATAATTTGGTGGG - Intergenic
1079569574 11:21925788-21925810 ATTTCTAAGTAAACTTAGGAGGG - Intergenic
1079839180 11:25373448-25373470 ATGTTTAAACAGATTTTGGCAGG + Intergenic
1079932008 11:26575433-26575455 ATTTTGAAGTAGAAATTGGATGG + Intronic
1080239309 11:30108330-30108352 ATGGTTAAGTAGATTGTGAAAGG - Intergenic
1080254301 11:30271792-30271814 CTATTTTAGTAGATTTTGAATGG - Intergenic
1080888921 11:36391562-36391584 ACTTTTAAGTTGCTTTTGAAGGG + Intronic
1081035875 11:38145906-38145928 ATTTTTAATTAGAGTTTGCTTGG + Intergenic
1081185074 11:40032475-40032497 GTTTTTAAGGATAGTTTGGAGGG + Intergenic
1081548227 11:44087780-44087802 GTTTTTAAGTAGAATTTCCATGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082707829 11:56514712-56514734 AGTTTTAAGATGATTTTGAAAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084690642 11:70723954-70723976 TTTTTTAAGTGGATTTGGCAAGG - Intronic
1085213725 11:74808360-74808382 ATATTTATGTATATATTGGAGGG + Intronic
1085692339 11:78674036-78674058 TTTTTAAAGTATCTTTTGGAAGG + Intronic
1085812686 11:79699254-79699276 AATTACAAGTAGATTCTGGAGGG + Intergenic
1085882679 11:80486320-80486342 AGTCATAATTAGATTTTGGATGG - Intergenic
1085910688 11:80821781-80821803 ATTTTTGATGAAATTTTGGAAGG - Intergenic
1086510056 11:87546972-87546994 ATTTTTAAGTAGATTCTGCAAGG - Intergenic
1086640455 11:89148441-89148463 ATTTTTGAGTACATTTTAAAGGG - Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086742580 11:90386141-90386163 ATTTTCACATACATTTTGGAGGG - Intergenic
1086871238 11:92039417-92039439 ATTATTAAGAAGTTTTAGGATGG + Intergenic
1087422152 11:97943110-97943132 ATTTCTAAGCAGAGTTTTGAAGG + Intergenic
1087482619 11:98720249-98720271 ATTTTAAAGTATATTTTGGATGG - Intergenic
1087604342 11:100358319-100358341 ATTTTTAATTAGCTGATGGATGG + Exonic
1087676863 11:101173569-101173591 ATTTATTAGAAGATTTTGGTAGG + Intergenic
1088072995 11:105812749-105812771 ATATTTTTATAGATTTTGGAAGG + Intronic
1088934280 11:114383396-114383418 ATTTTTCAGCAGATTTTCAAAGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089988939 11:122839695-122839717 ATTTTTGAGTGGATTTGTGAGGG - Intronic
1091423294 12:362608-362630 ATTTTTTAGTAGTTTTTGACAGG - Intronic
1091700634 12:2658283-2658305 ATTTTTAAGTAGATTTTGGAGGG - Intronic
1092372199 12:7926006-7926028 ACTTTTAAGTTTATTTTTGAGGG - Intronic
1092655682 12:10682326-10682348 ATTCTTAAGTAGCTACTGGAAGG + Intergenic
1092765195 12:11846767-11846789 TTTTTTCAGTAGATTTTGCAGGG + Intronic
1092990580 12:13894051-13894073 TTTTTTATTTAGATTTTAGAGGG + Intronic
1093044723 12:14429863-14429885 AAGATGAAGTAGATTTTGGAAGG + Intronic
1094285357 12:28786758-28786780 GTTTTTAAGTAGTTTATGCAAGG + Intergenic
1094296020 12:28905997-28906019 ATTTTTCAATAAGTTTTGGAAGG - Intergenic
1095156773 12:38866274-38866296 TTTCTTTAGTAGATATTGGAAGG - Intronic
1095413863 12:41953945-41953967 ATGTCTAAGAAGATTGTGGATGG + Intergenic
1097136096 12:56857072-56857094 GTTTTTAAGGAGAGTTTGGTGGG + Intergenic
1098397793 12:70040636-70040658 ATTTCTCAATAGATTTTGGAAGG + Intergenic
1098813834 12:75131228-75131250 ATTTCTGGGTAGATTTTGAAAGG - Intronic
1099275072 12:80564407-80564429 ATTTTTAAGTACATAGTGGGAGG + Intronic
1099281808 12:80659253-80659275 ATTTTGAATTACATTTTAGAGGG - Intronic
1099481348 12:83170263-83170285 ATTTTAAAGGACATTTTGCAAGG - Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099799553 12:87440485-87440507 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1100023060 12:90095108-90095130 ATTTTAATTTAGATTTTTGAAGG + Intergenic
1100127805 12:91451786-91451808 ATTTTTAAGTATCTTTTTTAAGG - Intergenic
1100326884 12:93548477-93548499 ATTTTTAAAAAAATTGTGGAAGG - Intergenic
1100964671 12:99999499-99999521 ATTTTTAAGAATAATTTGGTAGG + Intergenic
1101492816 12:105225137-105225159 TTTTTTAAGTAAATTTGGGATGG - Intronic
1102580402 12:113882740-113882762 GCTTTTATGTAGATTTTGGGTGG - Intronic
1102740762 12:115205574-115205596 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1103195556 12:119040745-119040767 ATTTTTATTTTTATTTTGGAGGG + Intronic
1103233971 12:119356518-119356540 ATTCTGCACTAGATTTTGGAAGG - Intronic
1103243080 12:119431269-119431291 GTTTTTAAGGATAATTTGGAGGG + Intronic
1103879735 12:124156967-124156989 ATTTATAAGTTGGTTTTAGATGG + Intronic
1104178705 12:126357407-126357429 ATTGTTAAGTATTTTTTGAATGG - Intergenic
1104197378 12:126554030-126554052 GTTTTTAAGGATATTTTGGTGGG + Intergenic
1104827445 12:131723412-131723434 ATTTTAAAGCTTATTTTGGAAGG + Intronic
1105395277 13:20027408-20027430 ATTTTTACGTAGCTTGTTGAGGG + Intronic
1106148475 13:27074086-27074108 ATTTTTAAGGACAATCTGGAGGG - Intronic
1106264262 13:28096056-28096078 ATTTTTAAGTAGTTTTAGGCTGG + Intronic
1106352862 13:28951049-28951071 ATTTTTAAGTGGAGTTTTTAGGG - Intronic
1106451667 13:29887964-29887986 ATTCTTAGGCAGATTTTTGACGG - Intergenic
1106569013 13:30909983-30910005 TTTTTAAAGTAGGTTTTTGAAGG - Intronic
1106848050 13:33758690-33758712 ATATTACAGTATATTTTGGAGGG - Intergenic
1107262685 13:38514171-38514193 CTTACTAACTAGATTTTGGAGGG + Intergenic
1108420371 13:50242898-50242920 ATATTTAGGAAAATTTTGGATGG - Intronic
1109142446 13:58731411-58731433 ATTTTCAATTACATGTTGGATGG - Intergenic
1109203164 13:59453240-59453262 ATTTTCAAGGAGAGCTTGGAAGG - Intergenic
1109398032 13:61786381-61786403 AATTTTAAGTAGCTTTCAGATGG - Intergenic
1109439114 13:62345634-62345656 ATTATTAAGTGGAGTTTGTAAGG - Intergenic
1109576095 13:64261578-64261600 ATTTTTCAGTTGTTTTAGGAAGG - Intergenic
1109705786 13:66090807-66090829 TTTTTTAAGTTGTTTCTGGATGG - Intergenic
1110006145 13:70272697-70272719 ATTTTAAAATGGATTTTGGAGGG + Intergenic
1110297264 13:73882830-73882852 ATTTTAAAGCAAATTATGGAAGG + Intronic
1110972469 13:81782363-81782385 ATTTTTAAATAGGCTTTGGAAGG - Intergenic
1111172646 13:84548695-84548717 ATTTTTAATTAGGTTTTAGGTGG - Intergenic
1111529425 13:89517846-89517868 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1111553118 13:89842183-89842205 ATTTGCAAGTAGATTTTGTGTGG + Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1111632742 13:90863443-90863465 CTTTTAAAGTGGATTTTGGGAGG - Intergenic
1111851347 13:93579637-93579659 ATTTTAAAGTATAATTTGGGAGG + Intronic
1112071201 13:95852364-95852386 ACTTTTGAGTAAATTTTAGATGG - Intronic
1112104128 13:96221981-96222003 ATTTTATAATAGATTTTAGATGG + Intronic
1112261050 13:97878877-97878899 AGTTTGAAGCAGCTTTTGGATGG - Intergenic
1112291834 13:98150525-98150547 TTTTTTAAGTATCTTTTGAAAGG + Intronic
1112338619 13:98534812-98534834 ATTTTTAAGGATAATTTGGTGGG - Intronic
1112480748 13:99773199-99773221 ATTTTAAAATATATTTTGGTGGG - Intronic
1112523127 13:100116524-100116546 ATTTTGAAGAACATGTTGGAGGG - Intronic
1112750004 13:102572971-102572993 TATTTTAAGTACATTTTGAAAGG + Intergenic
1112780818 13:102898754-102898776 ATTTTTAGGTAGAATATGTAAGG + Intergenic
1115389420 14:32837887-32837909 ATTTTTAAATATAGTTTGCATGG - Intergenic
1115704811 14:35988033-35988055 ATTTTTAAGGATAATTTGGTGGG - Intergenic
1115748608 14:36464541-36464563 ATTTTAAATGAGATTTTGTATGG - Intergenic
1115767717 14:36640861-36640883 ATTTGTAATTAGTTTTTGCATGG + Intergenic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1116318068 14:43423363-43423385 ATTTTTAAATATTTTTTGAAAGG - Intergenic
1116485243 14:45440990-45441012 ATTTTTATTTAAATTTTGAAAGG + Intergenic
1116655435 14:47647238-47647260 CTTTTGAAGTTGATTTTGTAAGG - Intronic
1116771916 14:49136249-49136271 ATTTCCAAGTAGATATTTGAAGG + Intergenic
1117465287 14:55987360-55987382 ATTTATTAGTAGTGTTTGGATGG + Intergenic
1117569274 14:57030177-57030199 ATTTTTAATTATTTTTTGTAAGG + Intergenic
1118421354 14:65608391-65608413 ATTATTAAGTGCATTTTTGATGG + Intronic
1118833656 14:69459467-69459489 AATTTTAAGTGATTTTTGGATGG + Exonic
1119915935 14:78401622-78401644 ATTTTAACATAAATTTTGGAAGG + Intronic
1120298271 14:82672972-82672994 ATTTTGATGTAGATTTTTGATGG + Intergenic
1120401760 14:84041366-84041388 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1121183972 14:91950562-91950584 TTTATTAAGGATATTTTGGAGGG - Intergenic
1121811443 14:96894675-96894697 TGTTTTAATAAGATTTTGGAGGG + Intronic
1125291204 15:38149307-38149329 ATTTTTAATTTGATTATTGAAGG + Intergenic
1125377902 15:39052985-39053007 ATTTTCAAGTAAATTCTTGAGGG + Intergenic
1126376261 15:47999955-47999977 ATTTCAATTTAGATTTTGGATGG - Intergenic
1126607683 15:50495467-50495489 TTTTTTTAGTAGAGATTGGAGGG + Intronic
1126845393 15:52755327-52755349 ATTTTTTAGTAAATCTTGAAGGG + Intergenic
1126939185 15:53747166-53747188 ATTTTCAAATAGATTTTGGGTGG - Intronic
1127213885 15:56803799-56803821 ATTTTTAAGGAGATTGAGAAAGG - Intronic
1127383275 15:58447705-58447727 TTTTAAAAGTAGATTTGGGATGG + Intronic
1127471191 15:59292094-59292116 ATTGTTAAGTAAATTTTGTTTGG + Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1129168724 15:73794789-73794811 ATTTTTAAGCAGATGTTGTAGGG + Intergenic
1129288751 15:74546956-74546978 TTTTTTTAGTATATTTTAGAAGG + Intronic
1129438777 15:75563684-75563706 AATTCTTAGTATATTTTGGAGGG - Intronic
1129637227 15:77332821-77332843 ATTTATCAGTAGATTTTAAAAGG + Intronic
1130433440 15:83872897-83872919 ATTTTTAAAAATAATTTGGAAGG + Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131821297 15:96277136-96277158 AGTTTAAAGTAGATTGTGTAAGG + Intergenic
1131946105 15:97623648-97623670 ATTTATTAGAACATTTTGGACGG - Intergenic
1132742548 16:1422371-1422393 ATTTTTAAAGATAATTTGGAGGG - Intergenic
1133580664 16:7141543-7141565 ATTTTTATTTTTATTTTGGAAGG + Intronic
1133653534 16:7835977-7835999 GTTTTTAGGAAGATTTTGGAGGG + Intergenic
1134137347 16:11686365-11686387 ATGTTTAAGTAAATTATGGCTGG - Intronic
1134266067 16:12693542-12693564 ATTTTTAAGTAAAATTTAAAAGG + Intronic
1134373352 16:13646655-13646677 AATTTTAAGTAGGTTTTCAAGGG + Intergenic
1134794232 16:17020061-17020083 ATATTTGAGGAGATTCTGGAAGG - Intergenic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1135579544 16:23613691-23613713 ATGTTTAAGTAGCCTTAGGAAGG - Intronic
1135651096 16:24207583-24207605 ATTTTTAAGAATGTTTTGCATGG + Intronic
1136571897 16:31103126-31103148 ATTTTTAAAAAAATTTTGTAAGG - Intergenic
1137014246 16:35358484-35358506 ATTTTAACATAAATTTTGGAGGG - Intergenic
1137267402 16:46880566-46880588 ATGTTGAAGTAGATTCTGTACGG - Intergenic
1138426252 16:56934219-56934241 ATTTTTAAGTACAATTTAGACGG + Intronic
1138611210 16:58126281-58126303 ATGTTTAAGTTGAGATTGGAAGG + Intronic
1138765107 16:59592516-59592538 ATTTTTAATTTTATTTTAGATGG - Intergenic
1138783908 16:59822764-59822786 ATATTTAATTATTTTTTGGATGG - Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1139108904 16:63864546-63864568 CATTTTAAGAACATTTTGGAAGG + Intergenic
1140265487 16:73416927-73416949 ACTGTTAAGTATATTTTGGGAGG - Intergenic
1140561825 16:75991801-75991823 AATTTTAAGTAAATTTGGCACGG + Intergenic
1140575775 16:76166821-76166843 ATTTTAAGGTATATTTTGAATGG + Intergenic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1142937322 17:3346076-3346098 ATTTTAAAATATATTTTTGAAGG + Intergenic
1142951045 17:3480356-3480378 ATTTTTAAGGATAATTTGGTGGG + Intronic
1144001667 17:11060764-11060786 ATTTTAAAGTAAATTATGGTAGG - Intergenic
1144422560 17:15111512-15111534 ATGTTTAACTTGATTTTGGAGGG - Intergenic
1145178345 17:20721669-20721691 ATTTTAAAGTTGAGTGTGGATGG + Intergenic
1148065196 17:44864108-44864130 TGTTTTAAGTAGATGTTAGATGG - Intronic
1148333148 17:46824105-46824127 ATTTTGAAGTGGGTCTTGGAAGG - Intronic
1149195917 17:54120443-54120465 ATTTTTTGGAAGATTTTGTATGG + Intergenic
1150951364 17:69805468-69805490 ATTTTCAAGTAGAGTTTTAATGG + Intergenic
1152164122 17:78690507-78690529 TTTTTTAAGTAGAGATGGGATGG - Intronic
1152327986 17:79653039-79653061 ATTTTTACCTAGAATTTCGAAGG - Intergenic
1152646759 17:81472703-81472725 ATTTTTTTGTAGAGTTTGGCGGG + Intergenic
1153170798 18:2313703-2313725 ATGTTCAAGTTTATTTTGGAGGG - Intergenic
1153453203 18:5252491-5252513 ATTTCAAAGTAAATTTTGAATGG + Intergenic
1153854019 18:9127197-9127219 ATTTTTAGGTAGAAATTAGAGGG - Intronic
1153938071 18:9949344-9949366 ATTTTTAAATAGATTTTACATGG + Intronic
1155076937 18:22366322-22366344 ATTTTTAAGTAACTTTTTCATGG - Intergenic
1155124675 18:22860741-22860763 ATTTTTGAATAGATTTTGTATGG - Intronic
1155435609 18:25809645-25809667 ATTTTTGAGTAGAGTTAGAAGGG - Intergenic
1155636088 18:27957146-27957168 ATTTTTAATGAGCTTTTGGATGG - Intronic
1156315789 18:35967596-35967618 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1156686402 18:39652661-39652683 ATAGATAAGTAGATTATGGAAGG + Intergenic
1156767517 18:40675494-40675516 ATTTTGAAATAAACTTTGGATGG + Intergenic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1156978166 18:43251267-43251289 TGTTTTAGCTAGATTTTGGAAGG - Intergenic
1157939954 18:51917699-51917721 ATTTTGAAGTTGATGTTTGAAGG + Intergenic
1158013458 18:52756001-52756023 ACTTTTAAGAAAATGTTGGATGG - Intronic
1158630150 18:59106223-59106245 ATTTTTAAGAAGTTCCTGGAAGG + Intergenic
1158864224 18:61621950-61621972 AAGTTTAAGAACATTTTGGAAGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159071919 18:63633671-63633693 ATTTTTAAAGAAATTTTGGTAGG - Intergenic
1159084379 18:63771773-63771795 TTTTTTAAGCAGATTTTGTGGGG + Intronic
1159153744 18:64555150-64555172 CTTTTTAAGGATTTTTTGGATGG + Intergenic
1159190062 18:65029711-65029733 ATTTTGAAGCAGATCATGGAGGG - Intergenic
1159411164 18:68076390-68076412 ATTTTTAATTAGATTTCTGTTGG - Intergenic
1159508610 18:69366649-69366671 TTTATTAAGTAGATTGTGGTTGG + Intergenic
1159903880 18:74073295-74073317 ATTTTTAAGTTAATGTTTGAAGG - Intergenic
1160674664 19:383459-383481 ATATTTAAGGAGAATCTGGAAGG - Intergenic
1163992947 19:21016319-21016341 ATAAATAAGTAGATTTTTGATGG + Intergenic
1164042826 19:21508555-21508577 ATTTTTTAGTAGAGCTTGAAAGG + Intronic
1164077328 19:21832417-21832439 ATTTTTAAAAAAACTTTGGAAGG + Intronic
1164744742 19:30602871-30602893 ATTTTTAAGCAGCTTTTCAAAGG - Intronic
1166235843 19:41455715-41455737 ATTTTTATGGATAATTTGGAAGG + Intergenic
1166332978 19:42089420-42089442 CTTTTTCAGTTGATTTGGGAGGG + Intronic
1166441589 19:42820024-42820046 ATTATTAAGTAGATTTTTTAAGG - Intronic
1166449723 19:42888014-42888036 ATTATTAAGTAGATTCTTTAAGG - Intronic
1166478311 19:43148296-43148318 ATTATTAAGTAGATTTTTTAAGG - Intronic
1167412083 19:49350500-49350522 ATTTTTTAGTAGAGGTTGGGGGG + Intronic
1167580882 19:50341837-50341859 ATTTTTAAGTAGATCTGGGATGG + Intronic
926489993 2:13513300-13513322 ATTTTTAAGAATAATTTGGCAGG - Intergenic
926781535 2:16476890-16476912 ATTTTTAATTATATGATGGATGG - Intergenic
928756503 2:34532083-34532105 ATTTTGAAAGAGACTTTGGAAGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930428652 2:51245093-51245115 AGTTTTAAGTTAATTTTTGATGG - Intergenic
930450728 2:51534043-51534065 GTTTTTAAGCATATTTGGGAAGG + Intergenic
930490961 2:52071315-52071337 AAGTTTAACTAAATTTTGGAGGG + Intergenic
931141952 2:59469404-59469426 ATTTTTAAGAATATTTTTGCTGG - Intergenic
931504907 2:62914783-62914805 ATTTTTATTTAGATTTTTAAGGG - Intronic
931803069 2:65777689-65777711 ATTATTAAGCTGATTTGGGATGG + Intergenic
931891704 2:66680126-66680148 ATTCTTATGTAGATGTTTGAAGG + Intergenic
932360205 2:71098671-71098693 ATTTGTAAGTGGATAATGGAGGG + Intergenic
932757720 2:74420399-74420421 ATTTGGAAGTACATTTTGGAAGG - Intronic
932908887 2:75784685-75784707 ATTATAAAATAGCTTTTGGATGG - Intergenic
932959813 2:76399411-76399433 ATTTTTATTTGGAATTTGGATGG + Intergenic
933073256 2:77889281-77889303 GTTTTTAAGGATAATTTGGAGGG - Intergenic
933440839 2:82311762-82311784 AATTTTAAGTAGATTTTTTCAGG - Intergenic
933631057 2:84658573-84658595 ATTTTTAAGTTAATTTTTCAGGG + Intronic
934689884 2:96350473-96350495 ATTTTTAGGTATTTTTAGGATGG + Intronic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
937556426 2:123163615-123163637 ATTATTAAGCAGATTCTGAAGGG - Intergenic
937666628 2:124495393-124495415 ATTAAAAAGTAGATTTGGGAGGG + Intronic
937823513 2:126339084-126339106 ATTTCTAAGTATTTTTGGGAGGG - Intergenic
938411954 2:131072462-131072484 ATTTTTATTTATTTTTTGGAGGG + Intronic
938706494 2:133933372-133933394 ATTTATAAGTAAATTTGGCATGG - Intergenic
938956294 2:136301810-136301832 CTTTTTCAGTAGATTCTGCAGGG - Intergenic
939111799 2:138017413-138017435 ATTTTTAAGAGAATTTTTGATGG - Intergenic
939255692 2:139742489-139742511 ATTTTTAAGGATAATTTGGTGGG - Intergenic
940493080 2:154390138-154390160 AATTTTAAATAGATATTAGATGG - Intronic
940944671 2:159601978-159602000 ATTTTTCAGTTGATTTTCTAGGG - Intronic
940963381 2:159810726-159810748 ACATTGAAGTAGATTTTGAAAGG - Intronic
941021278 2:160409352-160409374 ATTTTTACGTAAATTTTGTCTGG - Intronic
941272129 2:163443204-163443226 ATTTTCACATACATTTTGGAAGG + Intergenic
941487256 2:166097745-166097767 ATTTTTAAAAATATTTTGTAGGG + Intronic
941502693 2:166299642-166299664 ATTTTTAAGTAGATAGAGAATGG - Intronic
941657860 2:168163775-168163797 ATTCTTAAAGAGGTTTTGGAAGG - Exonic
942099874 2:172569690-172569712 ATTTTAAAAAAGATTTTGTAAGG - Intronic
942236481 2:173912843-173912865 ATATTTAAGTAGACTTTGGGTGG - Intronic
942643727 2:178088700-178088722 ATTTTTAAATATATTTTTGTGGG + Intronic
942925138 2:181422877-181422899 GTTTTTAAGTAGATTTATTAAGG - Intergenic
943454889 2:188093389-188093411 ATTATTAAGTAGATAAAGGAGGG + Intergenic
943618945 2:190125793-190125815 ATACTTAATTAGGTTTTGGAAGG + Intronic
943625331 2:190192137-190192159 AGGTATAAGTAGATTTTGGTGGG + Intronic
943693254 2:190891702-190891724 AACTTAATGTAGATTTTGGAAGG + Intronic
943717674 2:191170202-191170224 ATTTCTCAGTGGATTTTAGAAGG + Intergenic
944028304 2:195199070-195199092 ATTCATAAGAAGGTTTTGGAAGG + Intergenic
944198275 2:197078214-197078236 TGTCTTAAGTATATTTTGGAAGG + Intronic
944363019 2:198880942-198880964 ATTTTTTAGTAGTTTTTGGTTGG - Intergenic
945617746 2:212094361-212094383 ACTGTTAAGTAGATTTTGTCTGG - Intronic
945620764 2:212133790-212133812 ATTTTTAAAAAGGTTTTGTAGGG - Intronic
945869494 2:215211459-215211481 ATTTATAATTTGATTTTGGAAGG - Intergenic
946453714 2:219803330-219803352 ATTTTTAGTTTGAGTTTGGAGGG - Intergenic
946833796 2:223751462-223751484 ATATTTAAATAGTATTTGGATGG + Intergenic
947304675 2:228730933-228730955 ATTTTTAAGAATAATTTGGTGGG - Intergenic
947956934 2:234200297-234200319 TTTTTTTAGTTTATTTTGGAGGG - Intergenic
1169000642 20:2165383-2165405 ATTTTCAGGTAGATTTTAGCCGG + Intronic
1169640324 20:7743927-7743949 ATTTAGAACTTGATTTTGGAAGG - Intergenic
1169842555 20:9955935-9955957 ATTTTTTAGTTGTTTTTTGAGGG - Intergenic
1170429662 20:16264534-16264556 ATTTTACATTAGATTTTGAATGG + Intergenic
1171006306 20:21468539-21468561 AATTTTAAAAAGTTTTTGGAAGG + Intergenic
1171096555 20:22337521-22337543 TTTTTAAGGTCGATTTTGGAAGG + Intergenic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1173058947 20:39643610-39643632 AGGTTTTAATAGATTTTGGAAGG - Intergenic
1173769069 20:45641487-45641509 ATTTTTTGGAAGATTTTGGAAGG + Intergenic
1174174749 20:48637574-48637596 AGTTTCAAGTAGCTCTTGGAGGG + Intronic
1175009533 20:55721384-55721406 ATGTCTAAGTTGATTTTGGGGGG - Intergenic
1175578829 20:60082959-60082981 ATATGTAAGGAGATTATGGAAGG + Intergenic
1177058096 21:16334551-16334573 ATTGTTACGTATATTTTGGTGGG - Intergenic
1177067178 21:16454372-16454394 ATTTTTAATTAAAAATTGGAAGG + Intergenic
1178200586 21:30398834-30398856 AATTTAAATTTGATTTTGGAAGG - Intronic
1178329010 21:31670727-31670749 ATTTGTAAGGAGATTTTGCTGGG - Intergenic
1178773033 21:35523097-35523119 ATTTTTAAGTCTATTTTTAATGG + Intronic
1179140896 21:38724027-38724049 GTTTGTAAGCAGAATTTGGAGGG + Intergenic
1179160801 21:38896105-38896127 ATTTTAAATTATATTTTGCAAGG - Intergenic
1179215489 21:39363624-39363646 ATATTTGAGTAGGTTTTGGGGGG - Intergenic
1179443813 21:41417475-41417497 ATTTATAAGTGGATTTTTAAAGG + Intergenic
1179455433 21:41496598-41496620 ATTTTTAAGTAGGCTGAGGAAGG - Intronic
1180250640 21:46584991-46585013 ATTTTTAAGAATATTTTGTGAGG - Intergenic
1180580417 22:16830671-16830693 AATTTAAATCAGATTTTGGATGG - Intergenic
1180691806 22:17722915-17722937 ATTTTTAAGTCCAATGTGGAAGG - Intronic
1181600173 22:23947065-23947087 ATTTTAAAGTATACTTTGAAAGG + Intergenic
1181608333 22:23994259-23994281 ATTTTAAAGTATACTTTGAAAGG - Intergenic
1182255661 22:29036000-29036022 ATTTTAAACTACATTTTGGTGGG + Intronic
1182685403 22:32119204-32119226 ATTTTTAACTCAGTTTTGGATGG + Intergenic
1183003492 22:34880758-34880780 TTTGTAAAGGAGATTTTGGAGGG + Intergenic
1183768500 22:39901837-39901859 ATGTTGAAGTGTATTTTGGAAGG + Intronic
1184984826 22:48123066-48123088 ATTTTTACGTAATTTTGGGAGGG + Intergenic
1184997407 22:48218755-48218777 ATTGTTAAATATTTTTTGGAAGG - Intergenic
949314664 3:2738978-2739000 ATTTTTAAGTATATTTGTTATGG + Intronic
949651864 3:6168961-6168983 ATTCTTAAGGAGATTATGGTAGG - Intergenic
951479923 3:23149246-23149268 CTTGGTATGTAGATTTTGGAAGG - Intergenic
951555101 3:23913298-23913320 AATTTTAAGCATTTTTTGGAAGG + Intronic
951993693 3:28703834-28703856 ATTTATATGTAGATTTTTGGGGG + Intergenic
952363463 3:32653856-32653878 AATTTTGAGTTGATTTTGGCTGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952603263 3:35110569-35110591 AACTTTAAGTAGATTGTGAAAGG - Intergenic
953673694 3:44983492-44983514 AGATTTAAGTATAATTTGGAAGG + Intronic
954085143 3:48238606-48238628 ATTTTTAAGGATAATTTGGTGGG + Intergenic
954740473 3:52745708-52745730 CTTTATAAGAAGGTTTTGGAGGG + Intronic
955549054 3:60063521-60063543 TTTTTTAGGTAGATTTTGTTTGG - Intronic
955939030 3:64130488-64130510 AGTTTTGGGTAGATTTTGGTAGG + Intronic
956033738 3:65067646-65067668 TTTTTTAAATAGATTTTGTTAGG + Intergenic
956050802 3:65246123-65246145 ATTTTAAAGTAGCATATGGACGG + Intergenic
956120528 3:65961506-65961528 ATTTTTCAGTGGATTTTTGGGGG - Intronic
956602873 3:71041385-71041407 ATTATTAAGGAGGTCTTGGAAGG + Exonic
957325461 3:78687232-78687254 AATTTTAAGTGCATTTTAGAAGG - Intronic
957588060 3:82158267-82158289 TTTTTTAAGGAAAATTTGGAGGG - Intergenic
957651033 3:83004606-83004628 AATTTAAATTAGATTTTGAAAGG + Intergenic
957903142 3:86523318-86523340 TTTTTTAAATAGAATTTGCATGG - Intergenic
958779126 3:98520749-98520771 TTTTTTGAGTTGATTTTCGATGG + Intronic
958859228 3:99425299-99425321 AATTTTAAGTGGTATTTGGAAGG + Intergenic
960102826 3:113762753-113762775 ATTATTAAGTACATTTTGTGGGG + Intronic
961491343 3:127258473-127258495 ATTTCTAAGCAGATTCTAGATGG - Intergenic
962027616 3:131565202-131565224 ATTTTTAAAGAGATTTTTGCTGG - Intronic
962182764 3:133225668-133225690 ATCTTAAAGTCAATTTTGGAGGG + Intronic
962421027 3:135229422-135229444 ATTTTTAAATAGCTGTTGGAGGG + Intronic
962514411 3:136136744-136136766 GATTTTAAGTTGTTTTTGGAGGG - Intronic
962700668 3:137996779-137996801 ATTTTTTAATAGATTATTGAGGG + Intergenic
963025542 3:140915227-140915249 TATTTTAAGTAGAATTTTGAAGG + Intergenic
963294383 3:143529482-143529504 ATTTGCCAGTGGATTTTGGAAGG + Intronic
964491143 3:157237620-157237642 AATTTAAAGTAGTTTTGGGAAGG - Intergenic
964859240 3:161182524-161182546 ATTTATAATTTGATTTTGGAAGG + Intronic
965232386 3:166070915-166070937 ATTTTTGAGTTGATACTGGAAGG - Intergenic
965680421 3:171245483-171245505 ATTATAAAGTAGATTTGTGAAGG + Intronic
966199462 3:177346752-177346774 ATTGTTAATTATATTGTGGAGGG - Intergenic
966327730 3:178775984-178776006 ATTTTTAAGAAAATTCTGCAGGG - Intronic
966381107 3:179346519-179346541 ATTTTTAAGGACAATTTGGTGGG - Intergenic
966436937 3:179897395-179897417 ATATTTATGTAGATTTTACAGGG + Intronic
966996723 3:185289071-185289093 AATTTTTAGAAGACTTTGGAAGG + Intronic
967463528 3:189775673-189775695 ATTTTTAAGTATCTTTTTTAAGG + Intronic
968414709 4:420913-420935 ATTTTAACGTGAATTTTGGAGGG + Intergenic
968806648 4:2777482-2777504 ATTTATCATTGGATTTTGGAAGG + Intergenic
969646205 4:8430934-8430956 ATTTCTAGGTAGACATTGGAAGG + Intronic
969940909 4:10730386-10730408 ATTTTCAGATATATTTTGGAGGG - Intergenic
970154006 4:13123052-13123074 GTTTATAGGTATATTTTGGATGG + Intergenic
970440056 4:16072998-16073020 GTTTTTAAGTATAATTTGGTGGG - Intronic
970559308 4:17267391-17267413 GGTTTTAAGTACCTTTTGGAGGG - Intergenic
971350688 4:25853239-25853261 ATTTTTATTTTTATTTTGGAGGG - Intronic
971663888 4:29457220-29457242 ATTTAAAAGTAGATTTTGGCCGG + Intergenic
972256859 4:37365381-37365403 ATTTTAAAATACATTTTGGTTGG - Intronic
972436696 4:39042176-39042198 ATTTAAAAGTAGAATTTGGCCGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
973125949 4:46584993-46585015 CTTTTTAAATATATTTTAGAGGG + Intergenic
973155854 4:46951193-46951215 ATTGTTAATTAGCTTTTTGAGGG - Intronic
974146696 4:57956809-57956831 AATATTAAGTGGATATTGGATGG + Intergenic
974164312 4:58181343-58181365 ATTTTCAAGTTTATTTTTGATGG + Intergenic
974317696 4:60303838-60303860 ATTTTTAAGTAGGTTGGAGAAGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974519356 4:62961665-62961687 ATTTTTAAAAAAATTTTTGATGG + Intergenic
975051963 4:69876588-69876610 ATTTTTCAGTAGTCTATGGAAGG - Intergenic
975265913 4:72367018-72367040 ATTTTTAAATATGTTTTTGAAGG - Intronic
975571858 4:75826030-75826052 AATTTTAATTTGATTATGGAGGG - Intergenic
975901677 4:79160922-79160944 GTGTTTAAGTAAATTTGGGATGG + Intergenic
976044884 4:80933667-80933689 ATTTTTAAGTTTGTTTTTGAGGG + Intronic
976386393 4:84464333-84464355 ATTTTTTAGTAGGTTTTCTAGGG - Intergenic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977098534 4:92777405-92777427 ATTTTTAAGTGGATTTGGACTGG - Intronic
977520281 4:98073838-98073860 TATTTTAAGTAAAATTTGGAAGG + Intronic
978322446 4:107512954-107512976 ATTTGTAAGTACATTTTTGCTGG + Intergenic
978495398 4:109354332-109354354 ATATTGAAGCAGATTATGGATGG + Intergenic
979093232 4:116514861-116514883 AGTTTTAAGCACATTGTGGAAGG - Intergenic
979358911 4:119738654-119738676 ATTTTTTGGCAGATGTTGGAAGG + Intergenic
979502762 4:121459099-121459121 ATCTTTAAGTAGCATTTGGGAGG + Intergenic
979672943 4:123380498-123380520 ATTTTTATGTCTTTTTTGGATGG - Intergenic
979784031 4:124692525-124692547 ATTTTAAAGTGAATTTTGGGAGG - Intronic
979874949 4:125876735-125876757 ATTCTTAATCACATTTTGGAAGG - Intergenic
979918201 4:126466032-126466054 ATTTTTAATTTTATTTTAGATGG - Intergenic
980860695 4:138496347-138496369 ATTTTTTAATAGGTTTTGGGTGG + Intergenic
981020692 4:140024911-140024933 TTTTTTCAGAATATTTTGGATGG - Intronic
981863197 4:149381771-149381793 ATTTTTAGATGGAGTTTGGATGG + Intergenic
981893372 4:149765986-149766008 ATTTTTAAGGATAATTTGGCGGG - Intergenic
982408884 4:155050263-155050285 ATTTTTTAGTTGATTTTGGATGG - Intergenic
982483889 4:155944242-155944264 ATTTTTAAGTAAATTATTGCTGG + Intronic
982601898 4:157461905-157461927 ATTTTTACATAGATTTCTGAAGG - Intergenic
982760932 4:159282171-159282193 ATTTTTAAATAGAATGTTGATGG + Intronic
983031233 4:162804442-162804464 ATTTTTAATTAGATTTAGAAAGG - Intergenic
983152723 4:164304616-164304638 ATTTTGAAATAGATTGTGGCAGG + Intronic
983362171 4:166740414-166740436 ATTTTTAAGTTGAATTTCAATGG + Intronic
984500818 4:180556494-180556516 ATTCTTATTTAGATTTTGCATGG + Intergenic
984570776 4:181390389-181390411 ACTTTTAGAGAGATTTTGGAGGG + Intergenic
984774048 4:183465035-183465057 ATTTTTAAATTGATTATGGGTGG - Intergenic
984797338 4:183674509-183674531 AATTTTAAATGGCTTTTGGATGG + Intronic
984834189 4:184004017-184004039 ATTTTCAAGTAGAATTTAAAGGG - Intronic
985522557 5:384258-384280 ATTTTTTAGTAGTTGTTGTAAGG + Intronic
986209349 5:5655996-5656018 ATTTTTATTTATATTTTGGGGGG + Intergenic
986808499 5:11331475-11331497 ATTTTTAATAAAATTTTGGCAGG + Intronic
987023914 5:13904361-13904383 ATTTTTATGTAGATTGTACATGG + Intronic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987336234 5:16900383-16900405 GTTTTTAATTAGAGTTTGCAGGG + Intronic
987608314 5:20167999-20168021 ATATTTAAGTATATTTTGAATGG + Intronic
987682387 5:21154502-21154524 ATTTTTAAGTAAATTCTGATGGG + Intergenic
987748020 5:22002519-22002541 AATTTTAATTATATTTTAGAAGG - Intronic
987813281 5:22867572-22867594 TTTTTTAAATACATTTTGAAGGG + Intergenic
987914086 5:24189077-24189099 ATTTTTAAATAAATATTGCATGG - Intergenic
988019705 5:25607428-25607450 ATTTTTAAATGGATGTTGGGAGG + Intergenic
988237972 5:28571502-28571524 ATTTTTGAGCAAATTTTAGAAGG + Intergenic
988346041 5:30039233-30039255 ATTTTTATGTAAATTTTTGTAGG - Intergenic
989182457 5:38592355-38592377 AATTTTAAGTACATTATGTAAGG + Intronic
989304014 5:39930538-39930560 ATTTTTAAGGAGATCCTTGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990841470 5:60084526-60084548 AATTGTATGTAAATTTTGGAGGG - Intronic
991372892 5:65938152-65938174 ATTTCTAAAAACATTTTGGAGGG + Intronic
991706710 5:69365447-69365469 ATTTTTTATTAGATATTGCAAGG - Exonic
992599278 5:78381605-78381627 ACTTTTGGGTAAATTTTGGAGGG + Intronic
992692158 5:79251398-79251420 ATTTTTAACTTAATTTTGGGGGG + Intronic
992732531 5:79687842-79687864 ATTTTTAATTAAATGATGGAAGG + Intergenic
992835002 5:80631432-80631454 ACCTTGAAGTAGGTTTTGGATGG - Intronic
993566245 5:89479193-89479215 ATTTCTTAGTAGAAGTTGGAAGG - Intergenic
993669701 5:90745680-90745702 ATTTTTAAGTTGAACTTTGAAGG - Exonic
993803672 5:92376228-92376250 GCTTTAAAGTAGCTTTTGGAAGG + Intergenic
993864679 5:93178260-93178282 ATTTTTAAGTATATTGTGGTAGG - Intergenic
994499296 5:100554895-100554917 ATTTTTTTTTAAATTTTGGATGG + Intronic
994776792 5:104044862-104044884 ACTTTTAAATACATTTTTGATGG + Intergenic
994847378 5:105006721-105006743 ATTGTTAAGTAGATTATAGGAGG - Intergenic
994898480 5:105738277-105738299 ATTTTTACGTGGATTTTATATGG - Intergenic
995163962 5:109015405-109015427 TTTTTTAAGTAGTAGTTGGAGGG + Intronic
995285319 5:110381926-110381948 ATTTTCAGTTAGTTTTTGGAAGG + Intronic
995380315 5:111524393-111524415 ATCTTTAGGTAGGATTTGGAGGG + Intergenic
995756945 5:115515805-115515827 ATTTTCAACTATATTTTGAAGGG - Intergenic
995833738 5:116380409-116380431 ATTTTGAATAAAATTTTGGAAGG + Intronic
996069511 5:119119151-119119173 ATTTTTATCTAGATTTTGTCTGG + Intronic
996230400 5:121057163-121057185 ATTTATAAGTACATGCTGGATGG - Intergenic
996285732 5:121789819-121789841 ATCTTTAATGAGATTTTAGATGG + Intergenic
996319499 5:122198618-122198640 ATTTTGAAGTCCATTTAGGATGG + Intergenic
997065328 5:130553209-130553231 AGTTCTAAGTACATTTTGGGAGG + Intergenic
998883303 5:146667558-146667580 TTTTTTAAGTAAGTTTAGGAAGG - Intronic
999592116 5:153159545-153159567 ATTTCTAAATAGCTTCTGGATGG - Intergenic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000091640 5:157934681-157934703 GTTTTTAAGGAGAATTTGGTGGG + Intergenic
1000481368 5:161779511-161779533 ATTTTTATATTGATTTTGAATGG - Intergenic
1000655906 5:163877497-163877519 AATTTTTACTTGATTTTGGAAGG + Intergenic
1000734031 5:164875796-164875818 ATTTTTAATTAGATTTGGAAAGG + Intergenic
1001675470 5:173509724-173509746 ATTAATAAGTGAATTTTGGAAGG - Intergenic
1002819311 6:709961-709983 ATTTTTAAAAAGATTTAGAATGG - Intergenic
1003252055 6:4437654-4437676 ATTTTCAAGCATATTTTGCAGGG - Intergenic
1003634491 6:7820230-7820252 TTTTGTAAGTAGATTTTTAAAGG + Intronic
1003639672 6:7866025-7866047 ATGTTTGAGTAGATTTTGGTGGG - Intronic
1004310826 6:14543419-14543441 TTTTTTAAGTAGAGTTGGCAAGG - Intergenic
1004468085 6:15904409-15904431 ATTTTTAAGTATAATTTGGTGGG + Intergenic
1004921627 6:20381439-20381461 ATTTTTAAGGATAATTTGGTGGG + Intergenic
1005210977 6:23462601-23462623 CTTTTTCAGTAGATTCTGTAGGG - Intergenic
1005253924 6:23979439-23979461 ACTTTTAAGTGGATTTTGTAAGG - Intergenic
1005421208 6:25652935-25652957 ATTTTCAAGTAGTTTTTTGGTGG - Intronic
1006355916 6:33557739-33557761 ATTTTTAAGGATAGTTTGGTGGG + Intergenic
1006605767 6:35256746-35256768 ATTTTTAAGTGGATGATGGTAGG + Intergenic
1007149534 6:39675025-39675047 ATCTCTAAGTAGATTTTAGAAGG - Intronic
1007896669 6:45369102-45369124 CATTTTAAGTGGACTTTGGAAGG + Intronic
1009395748 6:63198138-63198160 AATCTTAAGTAGACTTTGAAGGG - Intergenic
1010052959 6:71529840-71529862 ATTTCCAAAAAGATTTTGGATGG + Intergenic
1010440132 6:75884653-75884675 ATTTTTAAGGATAATTTGGTAGG + Intronic
1010921769 6:81691099-81691121 ATTTTTAAGTAGAATTTTCTAGG - Intronic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012204777 6:96447727-96447749 ATTTTTATGTTCATTTTGAAAGG + Intergenic
1012215857 6:96582819-96582841 TTTTTTAAGTAGCATTTGGGAGG + Intronic
1012834746 6:104251436-104251458 ATTTTTAAGTAAAATATTGAAGG + Intergenic
1012942644 6:105431765-105431787 ATTTTTAAGTTAAATGTGGAAGG + Intergenic
1013095546 6:106941406-106941428 GACTTTAAGGAGATTTTGGAGGG + Intergenic
1013482879 6:110567239-110567261 CTTTTTAAGTGAATTTTGGTGGG - Intergenic
1013617036 6:111853091-111853113 CTTTTTAAGTACATTTGGAAAGG - Intronic
1013818034 6:114122346-114122368 ACTTTTCAGTAGATTTTGTCTGG + Intronic
1014206485 6:118661375-118661397 ATTTTTAAGTTGGTTTTTCAAGG - Intronic
1014915367 6:127140662-127140684 ATTTCTAAGTAAATATTAGAAGG - Intronic
1015259148 6:131214832-131214854 ATTTTAAAGTAAATAATGGAGGG + Intronic
1015700624 6:136032417-136032439 CTTTGTAAGTGCATTTTGGAGGG - Intronic
1016164048 6:140917583-140917605 ATTTTTAAGGATAATTTGGTGGG - Intergenic
1016347751 6:143133239-143133261 ATTTTTAAGTATTGTTTGGGTGG + Intronic
1016490816 6:144599475-144599497 ATCTCTAAGTTGATTTTGTAAGG + Intronic
1016591675 6:145752562-145752584 CTTTTTAAAGACATTTTGGAGGG + Intergenic
1016830920 6:148432284-148432306 ATTTTTAAGTAGAGTTTATCTGG + Intronic
1016910701 6:149195933-149195955 ATTGTTAAGAAGATTTAAGAAGG - Intergenic
1017338977 6:153297998-153298020 ATTTTTAATTATTTTGTGGAGGG + Intergenic
1017538562 6:155375456-155375478 ATTTTAAAATCTATTTTGGAAGG - Intergenic
1017893428 6:158658230-158658252 ATTTAAAAGTATATTTTGCAGGG - Intronic
1018498316 6:164373528-164373550 ATTTTTAAGTATAATTTTGTTGG + Intergenic
1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG + Intergenic
1021115998 7:16747343-16747365 AGTTTTAAGGAGATTTGGCAAGG - Intergenic
1023970728 7:44988828-44988850 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1024221318 7:47289655-47289677 ATATGTAAGTAGTTTTTGGGAGG - Intronic
1024409725 7:49026413-49026435 CTTTTTAAGGAAATTTTGGCAGG - Intergenic
1025711621 7:63915714-63915736 GTTTTAAAGTAAATTTGGGAGGG + Intergenic
1025962569 7:66236230-66236252 ATTTTTTAGTAGATTTTATAGGG + Intronic
1025963930 7:66250118-66250140 AATGTTCAGTAGATGTTGGATGG - Intronic
1026156451 7:67830135-67830157 ATTTTTTAATAGCTTTTGGTTGG - Intergenic
1026372053 7:69709923-69709945 ATTTTTAAGAAAATTTTTGAAGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027192997 7:76008691-76008713 ATTTTTAAGTGGAAATTGAAAGG - Intronic
1027717055 7:81685806-81685828 ATTTTTAAGTATATATTTCAAGG - Intergenic
1027992766 7:85384058-85384080 ATTTATCAGTAGAATTTGTATGG + Intergenic
1028249026 7:88517882-88517904 AATTTTTAGTAGATTTTAGTTGG + Intergenic
1028956951 7:96704230-96704252 ATTTATAAATACATTCTGGAAGG + Intronic
1029446274 7:100614603-100614625 ATTTTTAAGTTGTTTGTAGATGG - Intronic
1030478586 7:110072297-110072319 ATTTTCAGATAGATTTTAGATGG - Intergenic
1030543953 7:110869229-110869251 ATTTTTAATTAGAAATTGGATGG - Intronic
1030737722 7:113069337-113069359 TTTTTTAACTAGATTTTTAATGG - Intergenic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031215946 7:118891436-118891458 TTTTATGATTAGATTTTGGAAGG + Intergenic
1031262824 7:119544176-119544198 ATTTTCATTTACATTTTGGAGGG - Intergenic
1032281046 7:130501707-130501729 ATTTTGAAGTAGATGTCGGCTGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033860869 7:145625185-145625207 TGTTTTAAATAGATTTTTGAAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1033978265 7:147129427-147129449 AGGTTTCATTAGATTTTGGAAGG + Intronic
1034517902 7:151595299-151595321 ATTTTTTGGTATTTTTTGGATGG - Intronic
1034580667 7:152039289-152039311 ATTTATAAATAGGTTTTTGAGGG + Intronic
1034762170 7:153683006-153683028 ATAATTAAGTGGATTTGGGAGGG - Intergenic
1035116922 7:156532569-156532591 AGTTTCATGTACATTTTGGAAGG - Intergenic
1035627898 8:1087712-1087734 AATGTCCAGTAGATTTTGGAAGG - Intergenic
1036530256 8:9578482-9578504 ATTTTTAAGGATATTTTCTACGG + Intronic
1036728418 8:11240740-11240762 ATTTTTAAGTTGAGTGTGAATGG + Intergenic
1036972463 8:13370093-13370115 GTTTTTGAGTAAAGTTTGGAAGG - Intronic
1037010636 8:13838205-13838227 ATTTTTAAGGATAATTTGGCAGG - Intergenic
1037325597 8:17686517-17686539 ATTTTTAAGTAAGTTTCGGTAGG - Intronic
1037463549 8:19137019-19137041 ACTTTTTAATAGATTTTGGTTGG + Intergenic
1038069505 8:23998228-23998250 ATTTTCTATTAGATTTTTGAAGG + Intergenic
1038097728 8:24334276-24334298 CTTGTAAAGTAGATGTTGGATGG + Intronic
1038559557 8:28560196-28560218 TTTTTTATGTTGACTTTGGAAGG + Intronic
1038839232 8:31164521-31164543 TTTGTTAAGTAGATTTTGTCTGG + Intronic
1039365749 8:36926339-36926361 ATTTTCAAGTTTATTTTAGAGGG + Intronic
1039874648 8:41575337-41575359 ATGTTAAAGTTGACTTTGGAAGG + Intergenic
1040503930 8:48029942-48029964 ATTTCTAAGTAAAATTAGGATGG - Intronic
1040702439 8:50083264-50083286 ATTTTGCAGTTGATTTTTGAGGG + Intronic
1040873484 8:52125262-52125284 ATTTTTATAGAGATTCTGGAAGG - Intronic
1040930496 8:52729841-52729863 AATTTTAAATAGAATTTGAAAGG - Intronic
1040988292 8:53320537-53320559 ATTTTTAAGTAGTTTTTCTATGG + Intergenic
1041159387 8:55023003-55023025 TTTTTTTAATAGATTTTGGGGGG - Intergenic
1041526992 8:58817404-58817426 AGTTTTAAGTAGATTTTTTTTGG + Intronic
1041623031 8:59995495-59995517 ATTTTTCAGTAGTTTGTGGAAGG - Intergenic
1041638480 8:60171174-60171196 ATTTCAATGTGGATTTTGGAGGG - Intergenic
1041740596 8:61152721-61152743 CATTTTAACTAAATTTTGGAGGG + Intronic
1041878406 8:62716947-62716969 ATGTTTAGGTAAATTTTGGTTGG - Intronic
1042452468 8:68964228-68964250 ATTTTTTACTATATTTTAGAGGG - Intergenic
1042662138 8:71166338-71166360 ATTTTGAAATAAATTTTGGTTGG + Intergenic
1042763903 8:72300000-72300022 ATATTTAAATAGATCTTAGATGG + Intergenic
1043468820 8:80541183-80541205 ATTTGTAATTGGTTTTTGGATGG - Intergenic
1044158991 8:88888480-88888502 TTTTCAAAGTATATTTTGGAGGG - Intergenic
1044413128 8:91906808-91906830 ATTTTTAAGAACATTTTGCATGG + Intergenic
1045133088 8:99179589-99179611 ATTTTAAAGCATATTTTAGAGGG - Intronic
1045531619 8:102990402-102990424 TCTTTTAAGGAGGTTTTGGAGGG + Intergenic
1046113326 8:109753398-109753420 ATCTTTAAGTAGATTTTAAAAGG - Intergenic
1046668436 8:117031758-117031780 ATTATTAAGAAGATTTCGGCTGG - Intronic
1046937434 8:119898373-119898395 ATTTATAAATTGATTTTGAAAGG + Intronic
1050748044 9:8900611-8900633 ATATTTAAGTAGGTTGGGGATGG + Intronic
1051144730 9:14014865-14014887 ATTTTTAAATAGATTTCTTAAGG + Intergenic
1051427086 9:16943114-16943136 ATTATTAAGTTGATTTCTGAAGG + Intergenic
1051450129 9:17188176-17188198 ATTTTTAAGAAGAATTCTGAAGG + Intronic
1051490974 9:17664726-17664748 ATTCAAAAGTACATTTTGGAGGG + Intronic
1052052895 9:23867848-23867870 AATTCTAAGTAGATTGAGGAGGG + Intergenic
1052077573 9:24161894-24161916 ATTCTTAATTATGTTTTGGATGG + Intergenic
1052211443 9:25908840-25908862 ATTTTTTTGTATATTTTAGAAGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052382570 9:27787916-27787938 ATTTTTAAGTTGATATGGGTTGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052810740 9:33056919-33056941 ATGTTTAAGGAGATTTGAGAGGG - Exonic
1054885042 9:70187436-70187458 ATTTTTAAATAGTTTTGAGATGG + Intronic
1056080754 9:83092239-83092261 ATTTTTATCTGGAATTTGGAGGG - Intergenic
1056197669 9:84244209-84244231 ATTTTCACTTAGAATTTGGAAGG + Intergenic
1056340112 9:85620948-85620970 GTTTTTAGGTAGATTTTTAATGG - Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056420226 9:86417835-86417857 ATGGTTCAGTAAATTTTGGAGGG - Intergenic
1056543749 9:87595927-87595949 AGTTTAAAATAGTTTTTGGAGGG + Intronic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057308468 9:93926276-93926298 ATCTTCAAGTAGAGTGTGGAAGG + Intergenic
1057529708 9:95833142-95833164 ATTTTTAAATTGATTTTAAATGG - Intergenic
1057580458 9:96282843-96282865 AAGTTTAAGGAAATTTTGGAAGG + Intronic
1058817736 9:108701216-108701238 ATTTTTTAGTTGATTTTTGTTGG + Intergenic
1059129656 9:111733268-111733290 ATTATAAACTACATTTTGGAAGG - Intronic
1059823681 9:118002449-118002471 ATTTTAAAGTAGATTTAAGAAGG + Intergenic
1060127550 9:121063904-121063926 AAAGTTAACTAGATTTTGGAAGG - Intergenic
1060391798 9:123283910-123283932 ATTTTTAAATATTTTTTGTAGGG - Intergenic
1060431996 9:123558311-123558333 ATTTGTAAGTAGCTTTAAGAGGG - Intronic
1060448739 9:123717030-123717052 ATTTCTCAGTATATTTTGGGTGG - Intronic
1185793675 X:2946871-2946893 ATTTTTAAATAGATTTCAGAAGG - Intronic
1185807085 X:3067919-3067941 ATTTTTAAATTGATTTTCCAAGG - Intronic
1186062603 X:5726345-5726367 ATTTTTAAGAATAATTTGGTGGG + Intergenic
1186188394 X:7043878-7043900 ATTATTAAGTAGATTTTTTAAGG - Intergenic
1186205341 X:7194153-7194175 ATTTTTAAGGACAGTTTGGCGGG + Intergenic
1186236558 X:7517251-7517273 ATTTTTAAGTAAATGTTGGTGGG - Intergenic
1186468505 X:9803319-9803341 ATTTTTAAGAAGTCTTTGTATGG - Intronic
1186951610 X:14632234-14632256 ATTTTTTAGTTGATTCAGGATGG + Intronic
1187091262 X:16099277-16099299 GTTTTTAAGTGTATTTTGGTGGG - Intergenic
1187130008 X:16493689-16493711 ATTTTTAAGTAGTCTTTCAAAGG + Intergenic
1187166470 X:16808945-16808967 ATTTTTCATAAGATGTTGGAGGG - Intronic
1187364784 X:18657517-18657539 ATTTTGAAATATATTTTGGCTGG - Intronic
1187476164 X:19612998-19613020 ACTGTTCAGTAGATGTTGGAGGG - Intronic
1187931253 X:24295416-24295438 AGTGTTAAGTAGATGTTGCAGGG + Intergenic
1187942606 X:24396550-24396572 TTTTTTAAGAAAAATTTGGAGGG - Intergenic
1188106200 X:26150191-26150213 ATTTTTAAGTGAATTTAGAAAGG - Intergenic
1188286292 X:28328898-28328920 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1188376395 X:29434730-29434752 ATTTTTAAGTATACTCTGTAAGG - Intronic
1188446842 X:30262567-30262589 ATTCTTAAATATATTTTTGAAGG + Intergenic
1188537713 X:31215830-31215852 ATATTTAAGTTGAATTTGGTGGG + Intronic
1188732299 X:33664888-33664910 ATTTTCAAGGAGATTTGTGAAGG + Intergenic
1188919517 X:35955367-35955389 ATTTTTAGATATATTTTTGAGGG - Intronic
1189170256 X:38902493-38902515 ATTTTTAAGCAGATTTTCTTTGG - Intergenic
1189758980 X:44301330-44301352 TTTTTTAAGTATAATTTGGTCGG - Intronic
1191675741 X:63790619-63790641 ATGATTAAGTAGATGTGGGATGG - Intergenic
1192199791 X:69059731-69059753 ATGTTTCAGTGGATTTTTGAAGG + Intergenic
1192636224 X:72821623-72821645 ATTTTAAAGCAGATATTGGCAGG - Intronic
1192645490 X:72899191-72899213 ATTTTAAAGCAGATATTGGCAGG + Intronic
1192840119 X:74846334-74846356 AAATTCAAGTAGAATTTGGAAGG - Intronic
1193013459 X:76705298-76705320 TATTTTAAGTTGATTTTGGTAGG - Intergenic
1193688901 X:84614777-84614799 ATATTTAAGTAGATTTTATTTGG + Intergenic
1194003689 X:88464182-88464204 ATTTATATGTAGATTGTGAAAGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195755574 X:108195729-108195751 ATCTTTAAATAGATTATGGGAGG + Intronic
1196678778 X:118448852-118448874 AGTTTTAAGTTGATTTTTAAAGG - Intronic
1196773000 X:119314240-119314262 ATTTATAATTTGATTTTGGAAGG - Intergenic
1198001188 X:132438791-132438813 ATTTGTGAGTATATTTTGTAAGG - Intronic
1199082504 X:143592350-143592372 GTTTTTAAGAATATTTTGGTGGG - Intergenic
1199313390 X:146347905-146347927 ATTTTTAATTTTTTTTTGGAGGG + Intergenic
1199699853 X:150366990-150367012 ATTTTTAAGGAGATCTTGTAAGG - Intronic
1199823934 X:151478784-151478806 ATTTTTCTGTATATTTTGCAGGG - Intergenic
1200950946 Y:8899732-8899754 ATATTGAGATAGATTTTGGAAGG - Intergenic
1201511365 Y:14768190-14768212 ATTTTTAGGTTCATTTTGGTAGG - Intronic
1202097780 Y:21271573-21271595 ATTTTTCAGTAAATTTTGACAGG + Intergenic
1202161958 Y:21943510-21943532 ATATTTAGATAGATTTTGGAAGG + Intergenic
1202229398 Y:22642863-22642885 ATATTTAGATAGATTTTGGAAGG - Intergenic
1202313757 Y:23553302-23553324 ATATTTAGATAGATTTTGGAAGG + Intergenic
1202557045 Y:26117293-26117315 ATATTTAGATAGATTTTGGAAGG - Intergenic