ID: 1091703656

View in Genome Browser
Species Human (GRCh38)
Location 12:2679752-2679774
Sequence TGCCATCCGGGTGCAGGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091703643_1091703656 -2 Left 1091703643 12:2679731-2679753 CCACGGGCCCCCCTTGTCCCCTG 0: 1
1: 0
2: 2
3: 28
4: 290
Right 1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG 0: 1
1: 0
2: 3
3: 16
4: 191
1091703635_1091703656 25 Left 1091703635 12:2679704-2679726 CCCCAGCACGGTCAGCACTGTGG 0: 1
1: 0
2: 0
3: 20
4: 139
Right 1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG 0: 1
1: 0
2: 3
3: 16
4: 191
1091703645_1091703656 -10 Left 1091703645 12:2679739-2679761 CCCCCTTGTCCCCTGCCATCCGG 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG 0: 1
1: 0
2: 3
3: 16
4: 191
1091703638_1091703656 23 Left 1091703638 12:2679706-2679728 CCAGCACGGTCAGCACTGTGGAG 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG 0: 1
1: 0
2: 3
3: 16
4: 191
1091703644_1091703656 -9 Left 1091703644 12:2679738-2679760 CCCCCCTTGTCCCCTGCCATCCG 0: 1
1: 0
2: 3
3: 29
4: 389
Right 1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG 0: 1
1: 0
2: 3
3: 16
4: 191
1091703637_1091703656 24 Left 1091703637 12:2679705-2679727 CCCAGCACGGTCAGCACTGTGGA 0: 1
1: 0
2: 0
3: 5
4: 158
Right 1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG 0: 1
1: 0
2: 3
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091703656 Original CRISPR TGCCATCCGGGTGCAGGAGG TGG Exonic
900625135 1:3604511-3604533 TGTCTTCCTGGTGCAGGAAGAGG - Intronic
901445186 1:9304142-9304164 TGACATCCGAGTGCAGGAGAAGG - Intronic
910516316 1:88064751-88064773 TGGCATGGGGGTGGAGGAGGTGG + Intergenic
911074845 1:93863141-93863163 AGCCATCTTGGAGCAGGAGGTGG - Intergenic
912827971 1:112923732-112923754 TGCCCTCCTGGTGCAGCTGGTGG - Intronic
913210902 1:116581640-116581662 TTCCAGATGGGTGCAGGAGGTGG - Intronic
915215435 1:154337395-154337417 TGCCATCTGGGAGCACGAGGTGG + Exonic
916501013 1:165386956-165386978 TGCCAGCCATGTGGAGGAGGTGG + Intergenic
916806763 1:168267516-168267538 TGCCATCCCAGTCCAGGGGGTGG + Intergenic
918455068 1:184702847-184702869 TGCCATCCGGGAATATGAGGAGG - Exonic
921048115 1:211491602-211491624 GGCCATCTGGGTCCCGGAGGTGG + Intronic
922554707 1:226523851-226523873 TGGCCTGCGGATGCAGGAGGAGG + Intergenic
922566840 1:226606645-226606667 TGCCGCTCGGGTGCAGGGGGTGG - Exonic
922591782 1:226782916-226782938 TGCCACCCTGGAGCAGGAGCTGG + Intergenic
922894573 1:229090138-229090160 TACCATCTGGGGGCAGAAGGAGG + Intergenic
923009066 1:230073899-230073921 TGCCAGCCATGGGCAGGAGGAGG - Intronic
1063295105 10:4797295-4797317 TGGCTTCTGGGTGCAGGTGGCGG + Intronic
1067544202 10:47181180-47181202 TGCCGTCCGAGGGCTGGAGGAGG + Intergenic
1069510634 10:69040015-69040037 TGCCATCCAGGTGGAGCAGCTGG + Intergenic
1069598463 10:69687761-69687783 TGACATCCGGCTTCAGCAGGTGG + Intronic
1072252685 10:93593955-93593977 TGCCATCGAGGTTCAGGAGGCGG + Exonic
1073218417 10:101849880-101849902 TGTCCTCCAGGTGCTGGAGGTGG - Exonic
1074118215 10:110473731-110473753 TGCAATGAGGGTGCAAGAGGTGG - Intergenic
1075440244 10:122474469-122474491 TGCCCCCCTGGTGCAGGAGGAGG - Intronic
1075534734 10:123261113-123261135 TTCCATGAGGGTGGAGGAGGTGG - Intergenic
1076036904 10:127206614-127206636 TGCCATCCAGGAGGTGGAGGGGG - Intronic
1076545281 10:131240980-131241002 TGCTTTCCCGGTGAAGGAGGAGG - Intronic
1076646876 10:131959899-131959921 TGCCCTGGGGGTGGAGGAGGTGG - Intergenic
1076724380 10:132406730-132406752 GCCTATCCGCGTGCAGGAGGAGG - Intronic
1076873539 10:133205058-133205080 AGCCCCACGGGTGCAGGAGGAGG + Intronic
1076904192 10:133354279-133354301 TACCATCTGGGAGCAGCAGGCGG + Intergenic
1079920423 11:26427289-26427311 TGCCATCAAGGTGCAGGTGGAGG - Intronic
1080098027 11:28430355-28430377 TGCCATCCGGGAGGAGGTGGGGG + Intergenic
1083748874 11:64750395-64750417 TGGCATGCGGGTGGAGGATGTGG - Exonic
1083889904 11:65590494-65590516 TGCCAACAAGCTGCAGGAGGAGG + Exonic
1089261906 11:117229490-117229512 GGCCATCCGGCAGCAGGTGGAGG - Exonic
1089502368 11:118940165-118940187 TGCCCTAAGGGTGCAGGAGATGG - Intronic
1090189354 11:124758468-124758490 CGCCAACCGGTTGCAGGCGGTGG - Exonic
1090748210 11:129723843-129723865 TGCCTGCCGGCTCCAGGAGGTGG - Intergenic
1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG + Exonic
1093073668 12:14734648-14734670 TGCCATCCAGATGCAGATGGAGG - Intergenic
1096647328 12:53045975-53045997 TGCCACCCTGGAGCAGAAGGTGG - Intergenic
1103363608 12:120368154-120368176 GGCGAGCCGGGAGCAGGAGGAGG + Intronic
1104090731 12:125514883-125514905 TGCCAGCCAGGAGGAGGAGGAGG - Intronic
1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG + Intronic
1113456935 13:110456047-110456069 TGCCATCTCGTGGCAGGAGGAGG - Intronic
1113694689 13:112336069-112336091 TGCCTTCTGAGTGCAGGGGGTGG - Intergenic
1122789897 14:104179757-104179779 TGCCATCCCGGGGCCGCAGGAGG + Exonic
1125818615 15:42608303-42608325 TGCCAGCCGGATGCGTGAGGTGG + Intronic
1126340305 15:47634378-47634400 TGCCACCTGGGAGAAGGAGGAGG + Intronic
1127248640 15:57206672-57206694 AGCCTTCCGAGTACAGGAGGTGG - Intronic
1128523040 15:68388018-68388040 GGCCATCCAGGTGCAGGGGAGGG - Intronic
1129428485 15:75481468-75481490 TGCCGTCCGGGAGGAGGTGGGGG + Intronic
1129717973 15:77862876-77862898 TGCCATCAGGCTGCAGCCGGGGG + Intergenic
1129790799 15:78339720-78339742 CGCGTTCCGAGTGCAGGAGGGGG - Intergenic
1131067140 15:89441779-89441801 TGACATTCTGGTGGAGGAGGTGG + Intergenic
1132501013 16:284714-284736 TGCCATGCGGCTGGAGGACGAGG + Exonic
1132844399 16:1993193-1993215 CGCCATCCGGGGCCAAGAGGGGG + Exonic
1132951753 16:2566754-2566776 AGCCACCCGCGTGCAGGATGTGG + Intronic
1132962597 16:2633416-2633438 AGCCACCCGCGTGCAGGATGTGG - Intergenic
1134247886 16:12553506-12553528 TGCCATCACAGTGCTGGAGGAGG + Intronic
1137553951 16:49458534-49458556 TGCCATCCTTGGGCAGCAGGTGG - Intergenic
1138492123 16:57382846-57382868 TGCCACCCGGAGGCAGGCGGTGG + Exonic
1139583087 16:67884757-67884779 TCCCATCTGGGTGTTGGAGGCGG + Intergenic
1139955125 16:70689531-70689553 TGCCATCTGGGGCCCGGAGGCGG + Intronic
1141805629 16:86339579-86339601 TGCAACACGGGTGCAGGTGGAGG - Intergenic
1142076505 16:88121002-88121024 TGCCATCCCAGTGAAGGAGAGGG - Intergenic
1142107250 16:88310980-88311002 TGTGGTCCTGGTGCAGGAGGAGG - Intergenic
1142848861 17:2694782-2694804 CGCCATCTGGGAGCAGGTGGTGG + Intronic
1143370043 17:6433942-6433964 CTCCATGCGGGTGCACGAGGTGG - Exonic
1143446358 17:7012550-7012572 TCCCATCCGGGGGCGGCAGGCGG - Exonic
1143592624 17:7894681-7894703 AGCCATCTGGGGGCAGGAAGAGG - Intronic
1145123878 17:20284414-20284436 TGCTGTCCGTGTGCAGGACGAGG + Intronic
1145218017 17:21066760-21066782 TGCCATCTGGGTGCAGAGGAGGG - Intergenic
1145960168 17:28882626-28882648 TGCCAAGCTGGTGCGGGAGGTGG - Exonic
1145964325 17:28906251-28906273 TGCCAGCCTGCTGCAGGATGGGG - Exonic
1146573593 17:33973343-33973365 TCCCATTCAGGTGCAGGCGGAGG + Intronic
1146938345 17:36826300-36826322 TGCCATCCTGGGGCAGGAGGGGG + Intergenic
1147382285 17:40062973-40062995 TCACACCCGGGCGCAGGAGGCGG + Exonic
1149491025 17:57085364-57085386 TACCATCGGGGTGCGGGATGCGG - Intronic
1151407244 17:73896586-73896608 TGCCCTCTGGGTGCTGGAGTCGG + Intergenic
1152311863 17:79556351-79556373 TTCCATTCGGTGGCAGGAGGAGG + Intergenic
1152719210 17:81914690-81914712 TGCCTTCCAGGTGCAGCATGTGG - Exonic
1153952966 18:10072360-10072382 TGTCATCCAGGAGCAGGAGCTGG + Intergenic
1159714425 18:71804229-71804251 TGTAATCCCAGTGCAGGAGGCGG - Intergenic
1159742390 18:72188600-72188622 TGCCATCAAGGTTCAGGATGTGG - Intergenic
1159917344 18:74198900-74198922 TGAGGTCCGGGTGCTGGAGGTGG + Intergenic
1160371824 18:78378520-78378542 TGCCTTCCTGCAGCAGGAGGTGG - Intergenic
1161421276 19:4177051-4177073 TGCCACCTGGGTGCAGGGGTGGG - Intronic
1164595761 19:29529866-29529888 TGCCGTGCGGCTGCAGGACGAGG + Exonic
1165058691 19:33194624-33194646 TGCGGCCCGGGTGCAGGCGGCGG - Exonic
1166820275 19:45574990-45575012 TCTCATCCAGGTGCAGGTGGAGG - Intronic
927254665 2:21029810-21029832 ACCCATCAGGGTGCAGGAGAGGG + Intronic
927970969 2:27306328-27306350 TTCCAGCCAGGTGAAGGAGGTGG + Exonic
932099746 2:68887625-68887647 TGCCAGCGGGATGCTGGAGGGGG + Intergenic
932188276 2:69717131-69717153 CGCCCTGAGGGTGCAGGAGGTGG + Intronic
932887552 2:75560974-75560996 AGCCAAGCGGGTGGAGGAGGGGG - Intronic
938080489 2:128367463-128367485 TGCCTGCTGGGTGCAGGAAGTGG + Intergenic
938339790 2:130527787-130527809 GCGCATCCGGGCGCAGGAGGCGG - Exonic
938350046 2:130592963-130592985 GCGCATCCGGGCGCAGGAGGCGG + Exonic
940228330 2:151423961-151423983 TGATGTCTGGGTGCAGGAGGAGG - Intronic
941842870 2:170106698-170106720 TGCTATCCTGGAGGAGGAGGAGG + Intergenic
942920295 2:181364992-181365014 TGCAATCCGGTTGCCGGAAGTGG + Intergenic
946000316 2:216476775-216476797 TGCCATCAGGCTGCATGGGGAGG - Intronic
946410011 2:219511098-219511120 TGTCCTCTGGGTGCAGGGGGAGG + Intergenic
948157968 2:235799936-235799958 TGCCCTCGGGGTGGAGGTGGGGG + Intronic
948166477 2:235866539-235866561 TGCCATCAGTGTGCTGGAGGGGG + Intronic
1168893638 20:1309540-1309562 TGCCATGTGGGGGCAGGGGGAGG - Intergenic
1171796206 20:29568230-29568252 TGCCATGTGGATGCAGGTGGAGG - Intergenic
1171852030 20:30315937-30315959 TGCCATGTGGATGCAGGTGGAGG + Intergenic
1171944540 20:31364948-31364970 GGCCATGCGGATGCAAGAGGTGG + Intergenic
1173751404 20:45479738-45479760 TTCCATTTGGGAGCAGGAGGAGG + Intronic
1173883974 20:46440521-46440543 TCCCATCCAGGTGCAGGGCGAGG + Intergenic
1175291895 20:57881568-57881590 TGCCATGCGGGGAGAGGAGGTGG - Intergenic
1176032962 20:63022627-63022649 TCCCATGCGGCTGCAGGGGGTGG + Intergenic
1176382641 21:6120875-6120897 AGCCATGGGGGTGCAGCAGGCGG + Intronic
1176672743 21:9750129-9750151 TGCCAACTGGGTGCAGATGGTGG - Intergenic
1179406788 21:41132782-41132804 TGCAATCCTGTGGCAGGAGGAGG + Intergenic
1179485175 21:41705448-41705470 AGCCATGAGGGTGGAGGAGGAGG + Intergenic
1179626875 21:42653907-42653929 TGTCACCCGGGGGGAGGAGGGGG - Intronic
1179740828 21:43417364-43417386 AGCCATGGGGGTGCAGCAGGCGG - Intronic
1180147178 21:45928133-45928155 GGCCCTGCGGGGGCAGGAGGAGG - Intronic
1181165327 22:20980101-20980123 TGCCATCCGGAAGCGGGAGGTGG + Exonic
1182515623 22:30857204-30857226 AGGCATGTGGGTGCAGGAGGTGG + Intronic
1183696561 22:39426961-39426983 TGCCATCTGGGGGCCAGAGGTGG + Intronic
1185371340 22:50462281-50462303 TGCTGTCCAGGGGCAGGAGGAGG + Exonic
950449746 3:13058957-13058979 TGAGCTCTGGGTGCAGGAGGTGG + Intronic
950801011 3:15551869-15551891 TGCCATCCGGGAACAGGATCTGG + Intergenic
950966744 3:17152050-17152072 TGCCATTCAGGTGCTGGGGGAGG + Intergenic
952149847 3:30577584-30577606 TGCCACCTGGGTGAAAGAGGAGG - Intergenic
952378787 3:32788423-32788445 TGCTATCCAGGAGGAGGAGGAGG - Intergenic
954442239 3:50528135-50528157 TGGGGTCCGGGTGCAGGAAGAGG - Intergenic
954446854 3:50551478-50551500 TGCTAGCAGGGTGCGGGAGGAGG + Intergenic
958147984 3:89652079-89652101 TACCATCTGGGTGCAGGGGGTGG - Intergenic
959032918 3:101323091-101323113 TGCTATAGGGGAGCAGGAGGGGG + Intergenic
959419378 3:106111937-106111959 TGCCATCCGGGAGGAGGTGGGGG - Intergenic
959419398 3:106111984-106112006 TGCCATCCGGGAGGAGGTGGGGG - Intergenic
959626429 3:108457267-108457289 TGCCTTCTCCGTGCAGGAGGGGG + Intronic
960593003 3:119383132-119383154 TGCAGTCCGGGTCCAGCAGGTGG + Exonic
962881933 3:139586543-139586565 TGCCATCCCCTTGAAGGAGGGGG - Intronic
968092541 3:195908158-195908180 TGCCATCGGGGGGCAGGTGGAGG + Intronic
969459350 4:7320559-7320581 TGCCAGACGGCTGCAGGTGGGGG + Intronic
969564091 4:7967495-7967517 TGCCATCCGAGAGCAGGAGGTGG + Intronic
974047334 4:56908582-56908604 TGGGACCCGGGGGCAGGAGGAGG - Intronic
976259120 4:83129075-83129097 TTCCATCTGGCTGCAGAAGGTGG - Intronic
977666830 4:99652842-99652864 GGCCATCCGGGCGAAGGAGCTGG - Exonic
978885119 4:113760235-113760257 TGCCAGTCGGGTGAAGGAGGTGG + Intronic
979259499 4:118634256-118634278 TGCCATCAGAGGGCAGGAGCTGG - Intergenic
984498845 4:180532930-180532952 TGCAATCCGGGTTTGGGAGGCGG - Intergenic
994729645 5:103476730-103476752 TGCCATCCTGGGGAAGGGGGTGG - Intergenic
998523403 5:142820492-142820514 TGCCATCCTGGAGCTGAAGGCGG + Intronic
998583958 5:143405765-143405787 TGCCTTCTGGGTCCAGAAGGGGG - Intronic
1000042901 5:157498316-157498338 TGCCATCCAGAGGCAGGTGGAGG + Intronic
1002772784 6:303835-303857 TTCCATGCGGGGGCTGGAGGTGG + Intronic
1004015226 6:11726218-11726240 TGCCATGTGGTTGCGGGAGGAGG + Intronic
1004205670 6:13589662-13589684 TGCCATCTGGGTGAAGGGTGGGG + Intronic
1006540796 6:34738097-34738119 TGCCCTCAGAGAGCAGGAGGAGG - Intergenic
1008660842 6:53665864-53665886 AGCCAGCCGGGGGCAGGGGGCGG + Intergenic
1011329328 6:86186428-86186450 TGCCATGAGGGTGCAGGCAGTGG - Intergenic
1011441422 6:87391266-87391288 AGAGAGCCGGGTGCAGGAGGAGG - Intronic
1016986465 6:149899275-149899297 TGCCACCTGGGAGCAGGAGTGGG - Intergenic
1017159482 6:151351445-151351467 GGCCACTCCGGTGCAGGAGGTGG + Exonic
1017664640 6:156707679-156707701 TGCCAGCCCAGTGGAGGAGGAGG - Intergenic
1019154680 6:170031111-170031133 TGCCCTCAGGCTGCAGGGGGAGG - Intergenic
1019487989 7:1298246-1298268 TGCCAGCCGGGCCGAGGAGGTGG - Intergenic
1019769918 7:2877080-2877102 TTGCATCCTGGTGCAGGAGCAGG + Intergenic
1019773717 7:2899625-2899647 TTCCCTCTGGCTGCAGGAGGAGG - Intergenic
1024268497 7:47624731-47624753 AGCCAGCCAGGTGCATGAGGTGG + Intergenic
1024355728 7:48411750-48411772 TGTCAACCGGGGGCAGGAAGTGG + Intronic
1026045605 7:66903820-66903842 TGCCATCGGGAGGCAGGAGCCGG - Intergenic
1029493402 7:100884405-100884427 TCGCATCCTGGAGCAGGAGGAGG + Exonic
1032120282 7:129150315-129150337 TGCCAGCAGGGCCCAGGAGGTGG - Intronic
1032164306 7:129533578-129533600 TGCTGTCCGAGGGCAGGAGGTGG - Intergenic
1032418069 7:131754054-131754076 GGCCATCCGGCTGCTGAAGGAGG - Intergenic
1034726413 7:153340234-153340256 TAGCATCCCGGTGAAGGAGGCGG + Intergenic
1035036885 7:155901405-155901427 TGTCATCCGGGGACAGGAGTGGG - Intergenic
1037903687 8:22703141-22703163 TGCCACCCGGGGGCAGGGTGCGG + Intergenic
1038503355 8:28063524-28063546 TGCCTTCCTCCTGCAGGAGGTGG + Intronic
1038686562 8:29724242-29724264 TCCCATCCAGGTGCAGCACGGGG + Intergenic
1038729372 8:30113495-30113517 TGGAATCCAGGAGCAGGAGGGGG + Intronic
1039583461 8:38685744-38685766 TGGCACCAGGGTGTAGGAGGAGG + Intergenic
1042229643 8:66542722-66542744 TGCCAGCCCGGAGCGGGAGGGGG - Intergenic
1044660686 8:94590934-94590956 TGCCGTCCGGGAGGAGGTGGGGG + Intergenic
1047779282 8:128098362-128098384 TGGCAGAGGGGTGCAGGAGGGGG + Intergenic
1048170589 8:132102536-132102558 TGCCACACGGGTGCCTGAGGGGG - Intronic
1048899546 8:139024338-139024360 AGCCACCCTGGTGCAGGTGGAGG + Intergenic
1048969239 8:139635057-139635079 AGCCAGCCGGGAGCAGGAGCAGG + Intronic
1049378425 8:142300503-142300525 GGCCATCCGGCTGCGGGAGGAGG - Exonic
1049573599 8:143380608-143380630 TGCCATCCTGGGGCAGGAGGAGG + Exonic
1049600131 8:143503790-143503812 AGCCAGCTGGGTGCTGGAGGAGG - Intronic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053789813 9:41679193-41679215 TGCCATGTGGATGCAGGTGGAGG + Intergenic
1054155327 9:61635563-61635585 TGCCATGTGGATGCAGGTGGAGG - Intergenic
1054178153 9:61890883-61890905 TGCCATGTGGATGCAGGTGGAGG + Intergenic
1054659376 9:67689941-67689963 TGCCATGTGGATGCAGGTGGAGG - Intergenic
1057023461 9:91718575-91718597 TGCCATCCTGGGGCGGGGGGGGG + Intronic
1057172096 9:92969174-92969196 GGCCACCCGGGTGCAGCGGGCGG + Intronic
1058176095 9:101738007-101738029 GGCGAGCCGGGCGCAGGAGGGGG - Exonic
1059452125 9:114377062-114377084 TGCCATCTGGGCTTAGGAGGTGG + Exonic
1061794795 9:133080091-133080113 TGCCAGCCGACTGCAGGAGCAGG - Intronic
1062005277 9:134235670-134235692 TGCTAGGCGGGGGCAGGAGGAGG + Intergenic
1062033349 9:134371953-134371975 TGCCAGCCTGGTGCAGGACTGGG + Intronic
1186888403 X:13937870-13937892 TGCGGCCCGGGTGCAGGTGGAGG - Intronic
1187406918 X:19012744-19012766 TGGCACCAGGGTGGAGGAGGTGG + Intronic
1193082321 X:77417905-77417927 AGCCACCAGGTTGCAGGAGGTGG + Intergenic
1196797780 X:119515995-119516017 TGTCAGCCTGGGGCAGGAGGAGG + Intergenic
1197043603 X:121970071-121970093 AGCCATCCTGGTGCTGGAGGTGG - Intergenic
1197952011 X:131908077-131908099 TCCCAACCAGGTGCAGGAGCTGG + Intergenic
1199839181 X:151626798-151626820 TACTATTCGGGGGCAGGAGGAGG + Intronic
1200103262 X:153698881-153698903 TGTCATCGTGGTGCATGAGGTGG - Intergenic
1200116923 X:153773502-153773524 TGCCATCCTGGTACAGGGGTGGG + Exonic