ID: 1091704711

View in Genome Browser
Species Human (GRCh38)
Location 12:2685972-2685994
Sequence GGAGACAACATTCCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 2, 1: 0, 2: 2, 3: 14, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091704706_1091704711 5 Left 1091704706 12:2685944-2685966 CCCACACAGTGGGGCATTTCCAA 0: 1
1: 0
2: 2
3: 11
4: 131
Right 1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG 0: 2
1: 0
2: 2
3: 14
4: 171
1091704701_1091704711 17 Left 1091704701 12:2685932-2685954 CCTCAAATCAGCCCCACACAGTG 0: 2
1: 0
2: 3
3: 20
4: 275
Right 1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG 0: 2
1: 0
2: 2
3: 14
4: 171
1091704705_1091704711 6 Left 1091704705 12:2685943-2685965 CCCCACACAGTGGGGCATTTCCA 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG 0: 2
1: 0
2: 2
3: 14
4: 171
1091704700_1091704711 21 Left 1091704700 12:2685928-2685950 CCTGCCTCAAATCAGCCCCACAC 0: 2
1: 0
2: 1
3: 13
4: 292
Right 1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG 0: 2
1: 0
2: 2
3: 14
4: 171
1091704707_1091704711 4 Left 1091704707 12:2685945-2685967 CCACACAGTGGGGCATTTCCAAA 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG 0: 2
1: 0
2: 2
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091704711 Original CRISPR GGAGACAACATTCCAAAGGC AGG Intronic
902689415 1:18100769-18100791 GGAGACAAGAGTCCAGAGCCAGG + Intergenic
903161465 1:21492006-21492028 GGAGACAAAATTCCCAAGCAGGG + Intergenic
904276071 1:29385071-29385093 GGAGCCAAGAACCCAAAGGCTGG + Intergenic
905270890 1:36786740-36786762 GGATACACCAATCCCAAGGCTGG - Intergenic
906957226 1:50384652-50384674 GGTGAGAACATTCAAAAGACTGG + Intergenic
908764766 1:67544524-67544546 GGAGACAGCATTCTAATGGAAGG - Intergenic
914339933 1:146751393-146751415 GGAGGCAATATGCCAAAGACTGG - Intergenic
915524924 1:156469854-156469876 TGAGACAAGATCCCACAGGCTGG - Intronic
915984640 1:160452372-160452394 GGAAACAAAATTACCAAGGCTGG - Intergenic
918798618 1:188940440-188940462 GGGGACAACATTCTAAGGGTTGG - Intergenic
919341458 1:196312922-196312944 GATGACAACATTCCAGAGGTAGG - Intronic
919575882 1:199309154-199309176 GGAGACAGGATTCAAAAGGCAGG - Intergenic
920348820 1:205324015-205324037 ACTGAGAACATTCCAAAGGCAGG - Intergenic
920581656 1:207114321-207114343 TGAGACAACTTTCCAAAGATAGG - Intronic
921966518 1:221096369-221096391 GCAGTGAATATTCCAAAGGCAGG - Intergenic
1063172740 10:3524099-3524121 GGAAAAAATAGTCCAAAGGCTGG + Intergenic
1068585797 10:58796847-58796869 GAAGACAATATTGCAAATGCAGG - Intronic
1071344711 10:84681994-84682016 CAAGACAACAGTCCAAGGGCTGG - Intergenic
1071559730 10:86635561-86635583 GGAGACAGCATTCCAATGTAGGG + Intergenic
1071987289 10:91064794-91064816 GGAGATGACATTCCTAAGGATGG - Intergenic
1073675073 10:105637231-105637253 TGAAACAATATTCCAGAGGCAGG - Intergenic
1074370174 10:112894386-112894408 GGGTACAACATTCCAGAGCCAGG - Intergenic
1076940906 10:133607615-133607637 AAAGACAATTTTCCAAAGGCGGG - Intergenic
1077874435 11:6291922-6291944 GAAGACCACAGGCCAAAGGCAGG - Intergenic
1078216093 11:9313109-9313131 GGTGACAATATTCCAAGGTCTGG - Intronic
1080036398 11:27717014-27717036 AGAAACAACATTCCAAAATCAGG - Intronic
1081186769 11:40052564-40052586 GAAGACAGCACTTCAAAGGCTGG - Intergenic
1081479008 11:43466467-43466489 GCAGACAAATTTCCAAAGACAGG + Intronic
1081906764 11:46675164-46675186 GGAGACAACATCCCGGAGGTAGG + Intergenic
1085117414 11:73942087-73942109 AAGGACAACTTTCCAAAGGCAGG + Intergenic
1089133124 11:116227960-116227982 AGAAACCCCATTCCAAAGGCTGG + Intergenic
1090248389 11:125234070-125234092 GGAGAAGGCATTCCAAAGACGGG - Intronic
1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG + Intronic
1091711284 12:2742311-2742333 GGAGACAACATTCCAAAGGCAGG + Intergenic
1091767392 12:3130514-3130536 GGAGGCAACACCCCAAAGTCAGG + Intronic
1094474092 12:30827988-30828010 CGAAACAGAATTCCAAAGGCAGG - Intergenic
1095325658 12:40888881-40888903 GGAGACAACCATTCAAAGGAGGG + Intronic
1100772532 12:97939394-97939416 GGAGAGGACATTCCAAAGCAGGG - Intergenic
1102794566 12:115677347-115677369 GTAGAAAACATTTTAAAGGCAGG - Intergenic
1103240629 12:119410501-119410523 GGAGAGAACATTCCTGAAGCTGG - Intronic
1107288804 13:38828136-38828158 TGGCACAATATTCCAAAGGCAGG + Intronic
1107291594 13:38860332-38860354 GGGGACAACATTGGAAAGACAGG + Intronic
1113416773 13:110134717-110134739 GGAGTCAACATTTCTAAGTCAGG + Intergenic
1113632244 13:111896376-111896398 GAAGACAGCGTTACAAAGGCAGG + Intergenic
1118686517 14:68296814-68296836 GGATACAACATGCCAGATGCTGG - Intronic
1121560453 14:94871174-94871196 GGACACAACATTTCAACGGAAGG - Intergenic
1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG + Exonic
1123954204 15:25316980-25317002 GGAGAAAACAGGACAAAGGCAGG - Intergenic
1125350085 15:38757377-38757399 GGTGTCAACATTCCATAGGTTGG - Intergenic
1126447326 15:48763155-48763177 GTAGACTACATTCAAAAGGGAGG + Intronic
1127312276 15:57763025-57763047 GCAAACAAAAATCCAAAGGCAGG - Intronic
1131437118 15:92431958-92431980 GGACACAAGATGGCAAAGGCTGG - Intronic
1132212670 15:100036032-100036054 GGAGACACCCTCCCATAGGCTGG - Intronic
1133673209 16:8044687-8044709 GGAAACAAAATTCCTAATGCTGG + Intergenic
1133858547 16:9572844-9572866 AAAGTCATCATTCCAAAGGCGGG + Intergenic
1137608206 16:49801038-49801060 GAAGACAACATCGCAAAGGCAGG + Intronic
1137919731 16:52475037-52475059 TGAGAAAAGACTCCAAAGGCAGG - Intronic
1139994359 16:70966017-70966039 GGAGGCAATATGCCAAAGCCTGG + Intronic
1141725929 16:85788293-85788315 GGCGACAACAGCCCAAAGGGTGG - Intronic
1141813097 16:86389706-86389728 GGAAATAACATTACAAAAGCCGG + Intergenic
1144472473 17:15557039-15557061 TGAGACAACATGTGAAAGGCAGG - Intronic
1144924004 17:18787649-18787671 TGAGACAACATGTGAAAGGCAGG + Intronic
1146145953 17:30416656-30416678 GGGAAGAACATTTCAAAGGCAGG - Intronic
1146407720 17:32553718-32553740 GAACATAACATTCCAAAGGTGGG - Intronic
1146470911 17:33124025-33124047 GCAGAAAACAATCCCAAGGCAGG + Intronic
1146581957 17:34046330-34046352 AGTGACAACCTTACAAAGGCTGG + Intronic
1147318656 17:39633083-39633105 GGAGACAAGTTTCCAAAAGATGG - Intronic
1149389092 17:56171583-56171605 GGGGAAAAAAATCCAAAGGCTGG + Intronic
1149432798 17:56607876-56607898 GGATACAACCTTCCTGAGGCTGG + Intergenic
1149485362 17:57038456-57038478 GGAGTCAACATTACAAATGGAGG - Intergenic
1150559479 17:66282291-66282313 GGAGAGAAAATTGCAAAAGCCGG + Intergenic
1151321795 17:73356915-73356937 GGGGCCAACATTCCACAGCCTGG + Intronic
1152550417 17:81027089-81027111 GAAGACAACATTTCAAAATCTGG + Intergenic
1159286099 18:66354547-66354569 TGAGCCACCCTTCCAAAGGCAGG + Intergenic
1163672743 19:18638036-18638058 GGAGATCACACTCCTAAGGCAGG - Intronic
1165065127 19:33224368-33224390 GGAGACAGCATTCTAAGGGGAGG + Intronic
1166885839 19:45960610-45960632 GGTGACAGAATTCCAAAGGGGGG + Intronic
1167135147 19:47611191-47611213 GGGGACAAAATGCCAAAGGGTGG - Intronic
1167136428 19:47618871-47618893 GGAGCCACCTTTCCAGAGGCTGG + Intronic
927090286 2:19705447-19705469 AGAGAGAACATTGCAAAAGCAGG + Intergenic
927482862 2:23468288-23468310 GGAGACACCAGTTCAGAGGCTGG - Intronic
928941250 2:36729790-36729812 TGAGACAACATTTCAATGTCAGG - Intronic
930243672 2:48961746-48961768 GGAGACATCCTTACAAAGACAGG - Intergenic
931549974 2:63432618-63432640 GGAAACAACACTGGAAAGGCAGG + Intronic
931693129 2:64852258-64852280 ACAGACAACATTACAAAGGTAGG - Intergenic
932348099 2:71008734-71008756 GGAGCCACCATCCAAAAGGCTGG - Intergenic
932674930 2:73771395-73771417 GGAGACAACATTCGAGCTGCAGG - Intronic
934109943 2:88733149-88733171 GGAGAGAACATTCCAGAGAGTGG + Intronic
935581616 2:104760700-104760722 GGAGAGAAAACTCCAAAGACAGG - Intergenic
937138110 2:119572886-119572908 GGTGACTCCATTCCAAAGCCAGG + Intronic
941295633 2:163736021-163736043 GGAGCCAGCATGCCAGAGGCTGG + Intergenic
945668470 2:212772143-212772165 GGAGACAACATTTGAAAAACTGG - Intergenic
946180492 2:217946091-217946113 GGAGACAAGGTTGGAAAGGCTGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947421966 2:229949176-229949198 TGAGACAACATCCAAAAGGGTGG - Intronic
948124281 2:235553657-235553679 GGAGGCAACTTTCCAAATGCTGG - Intronic
948513837 2:238490438-238490460 GAAGACAAGATTTCAGAGGCGGG - Intergenic
1168895666 20:1321669-1321691 GGAGAGTACATTCCCAAGGCAGG - Intronic
1169451237 20:5713450-5713472 GGAGACTCCATTCTAGAGGCTGG - Intergenic
1170230183 20:14037821-14037843 AGAGACCACATTGCACAGGCTGG - Intronic
1171126657 20:22608078-22608100 GGAGAAAATATGCCAAAGACTGG - Intergenic
1172382782 20:34510555-34510577 GAAGACAGCATTCCACAGCCTGG + Exonic
1173570623 20:44073433-44073455 GAAGACAACTTTCCCATGGCTGG - Intergenic
1174602886 20:51739127-51739149 GGAGGCAACCTTCCAAGTGCAGG - Intronic
1178212555 21:30553015-30553037 GGACAGAACATTCCAAAGAGTGG + Intronic
1178398283 21:32261641-32261663 GGAGCTAACACTCCAATGGCAGG + Intergenic
1179318914 21:40271205-40271227 GGAGACCACATTACATAGGCTGG + Intronic
1181485646 22:23230116-23230138 GGAGGCAAAATTCCAAAAACTGG + Intronic
1184161182 22:42698284-42698306 GGAGACAGAAGGCCAAAGGCTGG + Intronic
1184528119 22:45037458-45037480 GGTGACAGCATTCCACTGGCGGG + Intergenic
1184528152 22:45037658-45037680 GGTGACAGCATTCCAATGGCAGG + Intergenic
1184528172 22:45037778-45037800 GGTGACAGCATTCCATTGGCAGG + Intergenic
1185117865 22:48948322-48948344 GGAGCCCACCTTCCAAAGGCAGG + Intergenic
950100097 3:10351419-10351441 GGAGAGAACATGTCAAGGGCAGG + Intronic
950590381 3:13932560-13932582 GGAGACACCATTTCAAAGCGAGG - Intergenic
950710460 3:14810134-14810156 GGAGACACCATTTCAAAGCGAGG - Intergenic
951057577 3:18165124-18165146 GGAGACAGCATTCGATAGGAAGG + Intronic
953628479 3:44590813-44590835 GGAGAAAACAGTGCAAAGCCAGG - Intronic
956515217 3:70039176-70039198 GGAGACAAGATTCAAAGGGCTGG - Intergenic
963129274 3:141843184-141843206 GTAGAGACCATTCCAAAGCCTGG - Intergenic
963258562 3:143170523-143170545 TGAGAAAACATTCCAGAGGGAGG + Intergenic
965711604 3:171561361-171561383 GGAGAATATTTTCCAAAGGCTGG + Intergenic
966100908 3:176268050-176268072 GGAGACAGGGTTGCAAAGGCAGG + Intergenic
966164275 3:176999635-176999657 TGACAGAACATTCCAAAGACAGG + Intergenic
968157791 3:196397112-196397134 GGAGACCACATTGAAAAGGCAGG - Intronic
969669946 4:8584356-8584378 GGAAACAACACTGCAAAGGCAGG - Intronic
970223180 4:13831230-13831252 GGAGACACTATTCCTAGGGCAGG - Intergenic
970990277 4:22205162-22205184 TAAGACAACATTCCAAATACAGG + Intergenic
971775825 4:30963292-30963314 GAAGACAACTTACCAAAGGTAGG - Intronic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
972064585 4:34924887-34924909 GAAAACAATATTCCAAAGGAAGG + Intergenic
972552183 4:40144118-40144140 GGAGTCTGAATTCCAAAGGCAGG + Intronic
973709701 4:53616318-53616340 GGAGACAAAAGTGCAAAGGCAGG + Intronic
973760316 4:54109308-54109330 GGAGAGAAAAGTCCAAACGCTGG + Intronic
977428330 4:96898794-96898816 GGAAAAAACATTCCATTGGCTGG - Intergenic
980810548 4:137873110-137873132 GGGGACAACATTCCAAGCACAGG - Intergenic
982743098 4:159078570-159078592 TGAGAGAACCTTCCAAAGCCTGG + Intergenic
985323901 4:188745517-188745539 GGAGAAAAGCTTGCAAAGGCTGG - Intergenic
986560138 5:9052578-9052600 AGAGTCAACATGCCAAAGTCAGG + Intronic
987292625 5:16522974-16522996 GGAGACAGCATTGCCCAGGCTGG - Intronic
989724556 5:44572672-44572694 GGAGACAAAAGACCTAAGGCAGG - Intergenic
991614135 5:68478522-68478544 GGAGCCCACAGTCCACAGGCTGG + Intergenic
994205025 5:97024938-97024960 TAAGACAACATTCCAAGGGGAGG - Intronic
996581361 5:125035469-125035491 GGAGACAACATGGCAAAAGGGGG + Intergenic
998792968 5:145785924-145785946 GCAGACAATATTCCAAAGGCAGG - Intronic
1000878870 5:166673281-166673303 TGCAACAACATTCCAAATGCAGG + Intergenic
1001773876 5:174314496-174314518 GGCGACAACCTGCCACAGGCCGG - Intergenic
1003120410 6:3314787-3314809 GGAGAAGACACTCCAGAGGCTGG - Intronic
1004127134 6:12884695-12884717 GCATACAAAATTCCAAAGGCCGG - Intronic
1005418421 6:25625393-25625415 GGAGACATCACTGCAAAGGTGGG - Intergenic
1006124755 6:31830175-31830197 GGCGAAAACACTACAAAGGCTGG + Exonic
1007785620 6:44277663-44277685 GGAGAAATAATTCCAATGGCAGG + Exonic
1010483128 6:76378796-76378818 GGAGACATCATTCAAGAGGCTGG + Intergenic
1011827644 6:91329216-91329238 AGAGACATCATTCCAAAGGCTGG + Intergenic
1017556345 6:155575055-155575077 GGGCACAACATTCCAAGGACAGG - Intergenic
1018915387 6:168129606-168129628 GAAGACAGCGTTCCAGAGGCCGG + Intergenic
1019261267 7:83408-83430 GGAGAGAACATGCCACAGCCAGG + Intergenic
1021899369 7:25268352-25268374 GGAGACCACATTGCACAGACTGG - Intergenic
1022132961 7:27421055-27421077 GTGGCCAACATACCAAAGGCAGG - Intergenic
1024638957 7:51315011-51315033 AGAGAGAACATTTAAAAGGCCGG - Intronic
1025077769 7:55957828-55957850 GGAGACCACAGTTCAAAGACTGG + Intronic
1027554583 7:79647854-79647876 GGAAACAACACACCAAGGGCGGG + Intergenic
1027634936 7:80659605-80659627 TAAAACAACATTCTAAAGGCAGG + Intronic
1037940796 8:22949317-22949339 GTAGAGAGCATTCCCAAGGCAGG - Intronic
1039159694 8:34603521-34603543 GGAGCAAACATTACAAACGCAGG + Intergenic
1042307732 8:67348884-67348906 GGAGACACCTTTACAAAGCCAGG + Intergenic
1042670327 8:71255763-71255785 GGAAACAACAGTGAAAAGGCAGG + Intronic
1046842188 8:118871875-118871897 GGAGACAGAAATCCACAGGCAGG + Intergenic
1047665683 8:127088406-127088428 CGAGACACTATTCCAAAGTCTGG - Intergenic
1047980869 8:130180565-130180587 TGAGACAACAGTGCAATGGCAGG + Intronic
1049054021 8:140220772-140220794 GTAAACAGCATCCCAAAGGCTGG + Intronic
1051018507 9:12511646-12511668 GGAGACCACATTGTAAAGCCTGG - Intergenic
1051074781 9:13219728-13219750 GGAGACCACATTCTAAAGATTGG - Exonic
1052270713 9:26625515-26625537 GGAGACAGCATTGGAAAAGCAGG + Intergenic
1061297368 9:129684054-129684076 GGAGAGAAGATTCCTGAGGCAGG + Intronic
1061976470 9:134070373-134070395 GGAGCCAACTTTCCCGAGGCTGG + Intergenic
1186541913 X:10409605-10409627 GGATAGAACTTTGCAAAGGCTGG - Intergenic
1187023216 X:15406329-15406351 GGAAACAACAGTCCAGAGTCAGG + Intronic
1187987068 X:24825618-24825640 GGTGACATCATTCACAAGGCTGG + Intronic
1190111857 X:47595057-47595079 GGAGACTTCATTGCATAGGCAGG - Intronic
1190203496 X:48383433-48383455 GGACAGAACCTTCCCAAGGCGGG + Intergenic
1190207040 X:48411971-48411993 GGACAGAACCTTCCCAAGGCGGG - Intergenic
1190872092 X:54433028-54433050 GGAAATAACATGCCCAAGGCCGG - Intergenic
1191722710 X:64248138-64248160 GGCCACAACACTCTAAAGGCTGG + Intergenic
1193369541 X:80677947-80677969 GGAAAGAACATTCCAGAGGAGGG + Intronic
1195968973 X:110454032-110454054 GGGGTCAACATTCCGAAGGATGG - Exonic
1197533482 X:127661418-127661440 GGAGAGAAAATTCCAAAAGTGGG + Intergenic
1198920029 X:141715105-141715127 GGAGACAGTGTTGCAAAGGCAGG - Intergenic
1200377177 X:155795274-155795296 GGAGACTTCATTACATAGGCAGG - Intergenic