ID: 1091704783

View in Genome Browser
Species Human (GRCh38)
Location 12:2686337-2686359
Sequence CAAATCCTGAAGACTTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091704774_1091704783 9 Left 1091704774 12:2686305-2686327 CCAGCAGGCCAGACAGTCCCCAG 0: 2
1: 1
2: 5
3: 44
4: 354
Right 1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG 0: 1
1: 1
2: 0
3: 15
4: 149
1091704781_1091704783 -10 Left 1091704781 12:2686324-2686346 CCAGGGTGACGGACAAATCCTGA 0: 1
1: 1
2: 0
3: 6
4: 136
Right 1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG 0: 1
1: 1
2: 0
3: 15
4: 149
1091704779_1091704783 -8 Left 1091704779 12:2686322-2686344 CCCCAGGGTGACGGACAAATCCT 0: 1
1: 1
2: 0
3: 5
4: 79
Right 1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG 0: 1
1: 1
2: 0
3: 15
4: 149
1091704772_1091704783 22 Left 1091704772 12:2686292-2686314 CCACTGTCACCTGCCAGCAGGCC 0: 2
1: 0
2: 4
3: 37
4: 688
Right 1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG 0: 1
1: 1
2: 0
3: 15
4: 149
1091704773_1091704783 13 Left 1091704773 12:2686301-2686323 CCTGCCAGCAGGCCAGACAGTCC 0: 2
1: 0
2: 2
3: 27
4: 297
Right 1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG 0: 1
1: 1
2: 0
3: 15
4: 149
1091704777_1091704783 1 Left 1091704777 12:2686313-2686335 CCAGACAGTCCCCAGGGTGACGG 0: 1
1: 1
2: 0
3: 6
4: 143
Right 1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG 0: 1
1: 1
2: 0
3: 15
4: 149
1091704780_1091704783 -9 Left 1091704780 12:2686323-2686345 CCCAGGGTGACGGACAAATCCTG 0: 1
1: 1
2: 0
3: 4
4: 60
Right 1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG 0: 1
1: 1
2: 0
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091704783 Original CRISPR CAAATCCTGAAGACTTCAGT GGG Intronic
901636484 1:10672772-10672794 CACATCCTGGAGACTGGAGTGGG - Intronic
908965745 1:69760293-69760315 CACCTGCTGAAGACTGCAGTGGG - Exonic
910506745 1:87958315-87958337 GAAATTCTGAAGACCACAGTAGG - Intergenic
913122090 1:115751761-115751783 CAAATCCTGCAGAGCCCAGTGGG + Intronic
917135377 1:171784079-171784101 CACATCCTGAAGAAAGCAGTGGG + Exonic
917900935 1:179542711-179542733 CGAATCCTCAAGACTTTCGTGGG - Intronic
919560610 1:199114168-199114190 CAAATCCTTCAGAGGTCAGTTGG + Intergenic
919859635 1:201730921-201730943 CCAACCCTGAACACTTCCGTAGG - Intronic
1066080130 10:31922315-31922337 CAGATCCTGAAGACATCAAAAGG + Intronic
1068990652 10:63147113-63147135 CAAACCCTGAAGTCTTCTGCTGG + Intronic
1069598278 10:69686797-69686819 CAGGACCTCAAGACTTCAGTGGG + Intronic
1070844991 10:79514388-79514410 CAAAGCCAGTGGACTTCAGTAGG - Exonic
1070928813 10:80245921-80245943 CAAAGCCAGTGGACTTCAGTAGG + Intergenic
1071460244 10:85887139-85887161 AAAACCCTGTTGACTTCAGTGGG - Intronic
1072839286 10:98753028-98753050 CAGATGCTGAGGACTTTAGTTGG + Intronic
1073973434 10:109072067-109072089 CAAATCCTGAAAAATTCATTGGG - Intergenic
1075628032 10:123977586-123977608 CAAAAACTAAAGAATTCAGTAGG + Intergenic
1076432435 10:130414775-130414797 GAAATCCTGTAGACTTCAAATGG - Intergenic
1079278103 11:19060537-19060559 CACATCCTGATGAATTCATTAGG - Intronic
1079897525 11:26140498-26140520 AAAATCCTAAAGAATTCACTGGG + Intergenic
1081273289 11:41114444-41114466 GATGTCCTGAAGACTTCAGTTGG + Intronic
1082141151 11:48611030-48611052 AGAAACCTGAAAACTTCAGTGGG - Intergenic
1082179285 11:49099105-49099127 CACTTCCTGAAGAATTCAGAGGG + Intergenic
1084249018 11:67881424-67881446 CTATTCCTGAAGATTTCAGGAGG + Intergenic
1084823799 11:71714046-71714068 CTATTCCTGAAGATTTCAGGAGG - Intergenic
1085904197 11:80739894-80739916 CAAATTCTGAAGCATGCAGTTGG + Intergenic
1090942355 11:131398205-131398227 CAAATCTTCATGACTGCAGTTGG + Intronic
1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG + Intronic
1091711351 12:2742676-2742698 CAAATCCTGAAGACATCAGTGGG + Intergenic
1092419302 12:8316846-8316868 CTATTCCTGAAGATTTCAGGAGG + Intergenic
1098850149 12:75586667-75586689 CAAATCATGCTTACTTCAGTGGG + Intergenic
1099925079 12:89007400-89007422 CAAATTCTGAAGGGTTCACTGGG - Intergenic
1104402810 12:128490673-128490695 CAAATCCTGAAGAGTGGAGTGGG + Intronic
1104890763 12:132139070-132139092 CAAGCCCTGAAGTCTCCAGTCGG + Exonic
1104935812 12:132363861-132363883 CAACTCCTGAGGACGTCAGTGGG - Intergenic
1107460806 13:40600130-40600152 CAAAACCTGATGACTTCAGGAGG + Intronic
1108631875 13:52292257-52292279 AACTTCCTGAAGGCTTCAGTAGG - Intergenic
1109760077 13:66816564-66816586 CACATCCTGAAGACAGCAGGAGG + Intronic
1110666801 13:78126504-78126526 CAAAACATGAAGACTTGATTGGG - Intergenic
1112396089 13:99033489-99033511 CAAACCCTCCAGTCTTCAGTGGG + Intronic
1113282091 13:108799675-108799697 CAAATCCTGCAGAGGTCAGTGGG + Intronic
1117200279 14:53383056-53383078 CTAAGCTTGCAGACTTCAGTTGG - Intergenic
1119985480 14:79132389-79132411 CAAATTTTGAAGACTTCATATGG + Intronic
1120522824 14:85544629-85544651 CAAATCATGAAGACTAAAGATGG - Intronic
1123167124 14:106336037-106336059 GGAATCCTGCAGACTTCACTAGG - Intergenic
1123169741 14:106360748-106360770 GGAATCCTGCAGACTTCACTAGG - Intergenic
1123193507 14:106593630-106593652 GGAATCCTGCAGACTTCACTAGG - Intergenic
1123199054 14:106644088-106644110 GGAATCCTGCAGACTTCACTAGG - Intergenic
1123202138 14:106675972-106675994 GGAATCCTGCAGACTTCACTAGG - Intergenic
1123915468 15:25021065-25021087 CAAATGCTTAAGATTTCATTTGG - Intergenic
1126233401 15:46354117-46354139 CTCCTCCTGAACACTTCAGTTGG + Intergenic
1126318167 15:47393002-47393024 CTAATCAAGAAGTCTTCAGTTGG + Intronic
1130142749 15:81243865-81243887 CAAACCCTGAAGACTTCTGAAGG - Intronic
1130845929 15:87745690-87745712 CAACTCCTAAATACTTCAGCAGG + Intergenic
1134463422 16:14450271-14450293 CAAATCCTGAACCCCTTAGTAGG + Intronic
1135794788 16:25431470-25431492 CAACTCCTTAATTCTTCAGTTGG - Intergenic
1136870376 16:33802234-33802256 GGAATCCTGCAGACTTCACTAGG + Intergenic
1139111831 16:63901307-63901329 GAAATACTAAAGTCTTCAGTTGG - Intergenic
1203101796 16_KI270728v1_random:1313816-1313838 GGAATCCTGCAGACTTCACTAGG - Intergenic
1147285463 17:39399910-39399932 CAGATACTGAAGATTTGAGTCGG - Intronic
1149955842 17:61048743-61048765 AAAATGCTGAAGACTGCAGAGGG + Intronic
1153056989 18:955683-955705 GAAATCATGGAGACTTCAATGGG - Intergenic
1157187603 18:45553742-45553764 CAAAACCATAAGGCTTCAGTTGG + Intronic
1157300535 18:46475929-46475951 CAACTCCTGTGGACTCCAGTAGG - Intergenic
1158080191 18:53581161-53581183 CAAATGCAGAAGAACTCAGTTGG - Intergenic
1158380669 18:56926614-56926636 CAAACACTGAAGTTTTCAGTAGG + Intronic
1161215992 19:3095274-3095296 CAAATCCTGAAGAGTCCTGGAGG - Intronic
1161675320 19:5644221-5644243 CAATTCCTGAAGAATTTACTAGG + Intronic
925211439 2:2050871-2050893 CAATTCCTGGAGTCTACAGTTGG + Intronic
926545466 2:14234493-14234515 CAAACCCTGTTGACTCCAGTGGG + Intergenic
928636645 2:33253344-33253366 AAACTCCTGAAAACTTCTGTGGG + Intronic
931409967 2:62019796-62019818 CAAATTCTGAAGAACTGAGTTGG - Intronic
931434077 2:62232084-62232106 CACAACATGAAGACTGCAGTGGG + Intergenic
932775561 2:74526261-74526283 CAAATCCTGAAGCCTGCTTTTGG + Exonic
938442413 2:131347753-131347775 CAAATCTTAATGACTTAAGTTGG + Intronic
939550918 2:143614444-143614466 CAAATACTGAAGACATAAGTAGG - Intronic
943674470 2:190703591-190703613 CACATTCTGAAAACTTCATTAGG + Intergenic
943778821 2:191798644-191798666 CATATCTTGAGGACTTCAGTTGG + Intergenic
943986579 2:194628882-194628904 CATATTTTGAAGAATTCAGTTGG + Intergenic
944394733 2:199253812-199253834 TAAAGCCAGAAAACTTCAGTAGG - Intergenic
945824973 2:214710649-214710671 CACATGCTGAAGATTTTAGTAGG + Intergenic
1168933634 20:1644892-1644914 CAGAACCTGGATACTTCAGTTGG + Intronic
1173603692 20:44313987-44314009 CAAATCCTGAACCTTTCAGAAGG - Intergenic
1175553604 20:59832434-59832456 CAAGTCTTGAACACTTCAGGGGG + Intronic
1176925391 21:14743354-14743376 CAGATCGTGTAGACTTCAATTGG - Intergenic
1178254490 21:31039516-31039538 CTTATCATGAACACTTCAGTGGG - Intergenic
1178434113 21:32542311-32542333 CATATCCTCAATAATTCAGTAGG + Intergenic
1180410957 22:12607892-12607914 CAAATCCTGAGGACTGCATGTGG - Intergenic
954789042 3:53117294-53117316 GAACTCCTGAAGTCTTCAGAGGG + Intronic
955857235 3:63286379-63286401 CACATCCTGGAGAATTCAGTTGG - Intronic
961896986 3:130176045-130176067 CTATTCCTGAAGATTTCAGGAGG + Intergenic
961920974 3:130426155-130426177 TAAAGACTAAAGACTTCAGTTGG + Intronic
964785115 3:160387861-160387883 ACAATTCTAAAGACTTCAGTAGG - Intronic
969746447 4:9076462-9076484 CTATTCCTGAAGATTTCAGGAGG - Intergenic
969805795 4:9607857-9607879 CTATTCCTGAAGATTTCAGGAGG - Intergenic
970460393 4:16269261-16269283 CAAATCCTGAACAGTGCAGAGGG + Intergenic
972445743 4:39141889-39141911 CAAATCATTTAGAATTCAGTGGG + Intergenic
972761426 4:42108965-42108987 CATATCCTGAAGAATGAAGTTGG - Intergenic
972921524 4:43948275-43948297 CAAAGCTTGTAGAGTTCAGTAGG + Intergenic
973972236 4:56224999-56225021 CAAAGAGTGAAGACTTCAGGTGG - Intronic
975401400 4:73943760-73943782 CAGAACCTAAAGACATCAGTAGG - Intergenic
976461655 4:85319620-85319642 CAAGTCCTGGTGACCTCAGTAGG + Intergenic
977397273 4:96486375-96486397 CAAATTCTGGAGACATCAGATGG + Intergenic
978069897 4:104454217-104454239 CAATTGCTGAAGATTTCACTGGG + Intergenic
978327186 4:107572786-107572808 CAAATCCTGGAGATTAAAGTGGG + Intergenic
978898523 4:113920634-113920656 CAAATCTTAAAGAATTCAGAAGG + Intronic
979733645 4:124055227-124055249 CAAATACTTAATACATCAGTGGG - Intergenic
981102878 4:140849832-140849854 AAAATCCTGCTGACTTCAGAGGG - Intergenic
985162346 4:187057721-187057743 CAAATCCTGATACCTTCAGCTGG + Intergenic
988688217 5:33546431-33546453 CAAATCCTGAAGATATAAGGAGG + Intronic
990222164 5:53604848-53604870 CTAATCCTGAGGACTTCATCCGG + Intronic
991220328 5:64207036-64207058 TAAATCCTGAAAACTTCATAAGG - Intronic
1004050012 6:12067825-12067847 CAATTCCTCAAGACTACATTGGG - Intronic
1005872693 6:29986887-29986909 CAAATGCTGCAGACTTGGGTGGG - Intergenic
1008496222 6:52137030-52137052 CACATCCTAAACACCTCAGTGGG + Intergenic
1010931054 6:81803687-81803709 TAAATCTTGAAGACTACATTGGG - Intergenic
1011315969 6:86031690-86031712 CAAATGTTAAAGAATTCAGTAGG + Intergenic
1011707852 6:90020808-90020830 CAAATCCTGAAATCTGCAGCAGG + Intronic
1014003096 6:116386794-116386816 CCAGTCCTGAAGACTTCTCTTGG + Intronic
1014963727 6:127720470-127720492 CAAAAAGTGAAGACTTCAATTGG + Intronic
1018401866 6:163430923-163430945 CAAATCCTGGAGACTTAATATGG - Intronic
1020327668 7:6987717-6987739 CTATTCCTGAAGATTTCAGGAGG + Intergenic
1021575324 7:22101011-22101033 CAAGTCCTGAAGATAACAGTGGG - Intergenic
1022625330 7:32030501-32030523 GAAAAACTGAAGACATCAGTAGG + Intronic
1023631694 7:42171289-42171311 AAAATCCTGAAGTTTTCACTTGG - Intronic
1024387650 7:48771683-48771705 TACATCCACAAGACTTCAGTTGG + Intergenic
1025760823 7:64389594-64389616 CAAAGCCAGTGGACTTCAGTAGG + Intergenic
1026394787 7:69940541-69940563 CAAATCATGAAGTCCTCCGTAGG + Intronic
1027607806 7:80322060-80322082 CAAATTCTGGAGGCATCAGTAGG - Intergenic
1028910623 7:96203466-96203488 CAAATCCAGAAAACTTCTTTAGG + Intronic
1030309235 7:108052916-108052938 CAAATCTTGAAGTGTACAGTTGG + Intronic
1031786585 7:126040931-126040953 CCAGTCCTGCAGACTGCAGTGGG + Intergenic
1031990634 7:128196654-128196676 CAAGTCCTTCAGACTACAGTTGG - Intergenic
1034364487 7:150534479-150534501 CAAATTCTGAAGACTTGGTTGGG + Intergenic
1035434442 7:158848984-158849006 CAAATACAGAAGACTTGTGTGGG - Intergenic
1035869814 8:3125611-3125633 CAATTCCTAAAGACTTCTGAAGG + Intronic
1036368946 8:8146380-8146402 CAATTCCTGAAGATTTCAGGAGG - Intergenic
1036881946 8:12519262-12519284 CAATTCCTGAAGATTTCAGGAGG + Intergenic
1037243285 8:16802761-16802783 CAAATCAAGAAAAATTCAGTAGG + Intergenic
1039679598 8:39715967-39715989 CAAAACCAGAAGACTTCACGAGG + Intronic
1041679332 8:60571780-60571802 CAAAACATGAAGACCACAGTTGG + Intronic
1042271417 8:66960578-66960600 CAAAAACTGAATACTGCAGTAGG + Intronic
1042664463 8:71190753-71190775 AAAAACCTGAAAAATTCAGTGGG - Intergenic
1042767230 8:72336857-72336879 CAAAGCTAGAGGACTTCAGTAGG + Intergenic
1044702127 8:94974550-94974572 CAAATCCTGAGGGCTTGAGCTGG - Intronic
1045862854 8:106832254-106832276 AAAATTCTGAAGACTTGAGAAGG - Intergenic
1045887555 8:107116959-107116981 CAAAATCTGAAGAGTTCATTAGG + Intergenic
1046560087 8:115825285-115825307 CAAATGCTGAAGAATTGAGAAGG - Intergenic
1047539048 8:125746371-125746393 CCCACCCTGAAGACATCAGTGGG + Intergenic
1047629037 8:126685792-126685814 CAAGACCTGAAGACTTGAATGGG - Intergenic
1048807715 8:138255892-138255914 CAAAGCCTGCAAACTGCAGTGGG + Intronic
1049400869 8:142426642-142426664 CAAAGACTAAAGACTTCAGTAGG + Intergenic
1051652273 9:19340280-19340302 CAAATCCTGAACATCTTAGTAGG - Intronic
1052174303 9:25438973-25438995 CACAGACTGAAGGCTTCAGTTGG - Intergenic
1053193949 9:36100332-36100354 CAACTCCTGAAAAGTTCTGTTGG - Exonic
1055977450 9:81968897-81968919 GAATTCCTGAAGATGTCAGTTGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1190685361 X:52868222-52868244 CACATTCCGAAGTCTTCAGTGGG - Intergenic
1193187980 X:78536151-78536173 CAGATCCTGAAGAATTTAGCAGG - Intergenic
1194140844 X:90207101-90207123 GACATCCTGAAGACTTCTGTGGG + Intergenic
1195573708 X:106425569-106425591 AAAATACTGAGGACTTCAGGAGG + Intergenic
1196225803 X:113165207-113165229 GAAGTCCTGAAAACTTCAGATGG + Intergenic
1197934811 X:131729254-131729276 CAAATCCTGTAAACTTCCCTTGG - Intergenic
1197941253 X:131792760-131792782 CAAATCCTGTAAACTTCCCTTGG + Intergenic
1200486611 Y:3776226-3776248 GACATCCTGAAGACTTCTGTGGG + Intergenic
1201587142 Y:15573574-15573596 TGAATCCTGTAGATTTCAGTAGG - Intergenic