ID: 1091705962

View in Genome Browser
Species Human (GRCh38)
Location 12:2693551-2693573
Sequence AGGCTGCTCCAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 362}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091705962_1091705972 14 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705972 12:2693588-2693610 CCCTAATGTTTGGGCTGCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 61
1091705962_1091705978 25 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705978 12:2693599-2693621 GGGCTGCCGGGGAGGGGGCCAGG 0: 1
1: 1
2: 17
3: 164
4: 1329
1091705962_1091705976 19 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705976 12:2693593-2693615 ATGTTTGGGCTGCCGGGGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 186
1091705962_1091705969 12 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705969 12:2693586-2693608 TGCCCTAATGTTTGGGCTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 83
1091705962_1091705970 13 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705970 12:2693587-2693609 GCCCTAATGTTTGGGCTGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1091705962_1091705977 20 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705977 12:2693594-2693616 TGTTTGGGCTGCCGGGGAGGGGG 0: 1
1: 0
2: 3
3: 39
4: 297
1091705962_1091705968 5 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705968 12:2693579-2693601 TCAGGCTTGCCCTAATGTTTGGG 0: 1
1: 0
2: 0
3: 3
4: 99
1091705962_1091705975 18 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705975 12:2693592-2693614 AATGTTTGGGCTGCCGGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
1091705962_1091705974 17 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705974 12:2693591-2693613 TAATGTTTGGGCTGCCGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 124
1091705962_1091705967 4 Left 1091705962 12:2693551-2693573 CCTTCCTCACTCTGGAGCAGCCT 0: 1
1: 0
2: 4
3: 37
4: 362
Right 1091705967 12:2693578-2693600 TTCAGGCTTGCCCTAATGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091705962 Original CRISPR AGGCTGCTCCAGAGTGAGGA AGG (reversed) Intronic
900344186 1:2203321-2203343 AGGCTTCTCCATAGTGGGGCAGG + Intronic
900648921 1:3721673-3721695 GGGCTGCTGGAGAGTGAGGGCGG - Intronic
901458382 1:9376883-9376905 AGGCCTCCCCAGAGTGAGGAGGG - Intergenic
902460972 1:16576352-16576374 TGGCTCATCCGGAGTGAGGAGGG + Exonic
902461753 1:16582629-16582651 TGGCTTATCCGGAGTGAGGAGGG + Exonic
902462533 1:16588934-16588956 TGGCTTATCCGGAGTGAGGAGGG + Exonic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903024699 1:20419013-20419035 GGGGGGCCCCAGAGTGAGGAAGG + Intergenic
903159028 1:21471676-21471698 CGGCTCATCCGGAGTGAGGAGGG - Exonic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904560549 1:31394564-31394586 AAGCTGGCCCAGAGAGAGGAAGG + Intergenic
904623704 1:31790531-31790553 AGCCTGTTCCAGAGAGAGGTGGG - Exonic
904927048 1:34057554-34057576 AGGCTGAGCCAGAGAGAGGTGGG + Intronic
904928455 1:34066805-34066827 GGGCTTCTCCACAGTCAGGATGG + Intronic
905091211 1:35432829-35432851 AGACTGCTGCAGAGCGAGCAAGG + Intergenic
905810913 1:40912502-40912524 AGAGTTCACCAGAGTGAGGAGGG + Intergenic
905851244 1:41276761-41276783 AGTCTGTTCCCGAGTGAGGTAGG + Intergenic
905875913 1:41432032-41432054 AGGGGGCTCCAGAGCCAGGAAGG - Intergenic
906500921 1:46341410-46341432 AGGCAGCTCGAGGTTGAGGAAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907550865 1:55303668-55303690 GGGCTGTTGCAGACTGAGGAAGG + Intergenic
908162814 1:61427671-61427693 ACCCTGCTTCAGTGTGAGGAAGG - Intronic
910259124 1:85278869-85278891 AGACTCCTCCAAAGTGAGCAGGG - Intergenic
910344912 1:86225490-86225512 AGGCAGCTCCAGAGGCAAGAGGG + Intergenic
910847478 1:91617357-91617379 AGGCTCCTTCAGAGCCAGGAGGG - Intergenic
912007946 1:104927601-104927623 AGGCTGGTCCAGGGTCAGGTGGG - Intergenic
912220239 1:107665751-107665773 AGCCTGATCCAGAGGGAGGAGGG + Intronic
912389039 1:109289023-109289045 AGGCTGCTCCAAGGGGAAGAAGG - Intergenic
912822737 1:112880852-112880874 AAGCAGCTTCAGAGTGGGGAGGG + Intergenic
913118987 1:115722170-115722192 AGGCTGTTCCAGAACGGGGAGGG + Intronic
913334480 1:117696460-117696482 AGGCTGTTCCAGATTGAGAGTGG - Intergenic
913602938 1:120439583-120439605 CGGCTCATCCAGAGTGAGGAGGG - Intergenic
913603686 1:120445936-120445958 CGGCTCATCCAGAGTGAGGAGGG - Intergenic
913604448 1:120452224-120452246 CGGCTCATCCGGAGTGAGGAGGG - Intergenic
913640551 1:120808652-120808674 CGGCTCATCCGGAGTGAGGAGGG - Exonic
913641323 1:120814936-120814958 CGGCTCATCCGGAGTGAGGAGGG - Exonic
914084092 1:144436980-144437002 CGGCTCATCCGGAGTGAGGAGGG + Exonic
914211971 1:145587972-145587994 TGGCTCATCCGGAGTGAGGAGGG + Intergenic
914277926 1:146141689-146141711 CGGCTCATCCGGAGTGAGGAGGG + Exonic
914364116 1:146963202-146963224 CGGCTCATCCGGAGTGAGGAGGG - Exonic
914364880 1:146969489-146969511 CGGCTCATCCGGAGTGAGGAGGG - Exonic
914365642 1:146975784-146975806 CGGCTCATCCGGAGTGAGGAGGG - Exonic
914486801 1:148117657-148117679 CGGCTCATCCGGAGTGAGGAGGG + Exonic
914487562 1:148123938-148123960 CGGCTCATCCGGAGTGAGGAGGG + Exonic
914538207 1:148586340-148586362 CGGCTCATCCGGAGTGAGGAGGG + Exonic
914587129 1:149072803-149072825 CGGCTCATCCGGAGTGAGGAGGG + Exonic
914587910 1:149079092-149079114 CGGCTCATCCGGAGTGAGGAGGG + Exonic
914627708 1:149478987-149479009 CGGCTCATCCGGAGTGAGGAGGG - Intergenic
914672681 1:149883642-149883664 AGGATGTTATAGAGTGAGGAAGG - Intronic
914844497 1:151274456-151274478 TGGCTTCTCCAGAGTTGGGATGG - Intergenic
914940776 1:152021277-152021299 AGGCTCATCCGGAGTGAGGAGGG - Intergenic
915243105 1:154537785-154537807 CGCCTGCTCCAGAGTGATGCTGG - Intronic
915594096 1:156886707-156886729 GGGCTGCCCAAGAGCGAGGAAGG + Intergenic
915738990 1:158103824-158103846 GGGATGCTACAGAGTGAGGCGGG - Intergenic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917130628 1:171738890-171738912 AGGCTTCTGCAGAGTTGGGACGG + Intronic
918177916 1:182061380-182061402 AGGCTTCTGCAGAGTGTTGATGG - Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
919879651 1:201893311-201893333 AGGCAGCTCCAGAGGTAGGGGGG - Intergenic
920022445 1:202966532-202966554 AGGCAGCCCCAGAGTGTGGTGGG + Exonic
920246619 1:204592667-204592689 ACACTGCTCCAGACTTAGGAAGG + Intergenic
920870315 1:209788780-209788802 AGGATGGTCCAGAGAGATGAAGG - Intronic
921273011 1:213489562-213489584 GAGCTCCTCCAAAGTGAGGATGG - Intergenic
924262594 1:242247387-242247409 AGGCTGTACCAGAGTCAGGTTGG + Intronic
1064954128 10:20888092-20888114 ACACAGCTCCAGAGTGAGGTAGG - Exonic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1068314165 10:55320069-55320091 AGGAGGCTCCAGTCTGAGGAGGG - Intronic
1068369755 10:56096726-56096748 AGGCAGCAACAGAGTGAGGGAGG + Intergenic
1069661398 10:70126007-70126029 AGTCTGCCCCAGACAGAGGAGGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1071563901 10:86661917-86661939 AGGCTGCTCCAGAGTGTCCCTGG + Intronic
1071887718 10:89969094-89969116 GGGCAGCTCCAGAATGTGGATGG + Intergenic
1072528500 10:96296167-96296189 AGGATGCTCTAGAGTTAGGCTGG + Intergenic
1073261191 10:102191738-102191760 TGGCTGCTTCATAATGAGGAGGG - Intergenic
1075031529 10:119027869-119027891 TGCATGGTCCAGAGTGAGGAAGG + Intergenic
1075122171 10:119672312-119672334 AGGCTGCTCCTGCCGGAGGAAGG - Exonic
1075510102 10:123065316-123065338 AGGCTGCTCCAGAAAGGGGCTGG - Intergenic
1075970840 10:126650855-126650877 AGGCTGGACCAGGGTCAGGAGGG - Intronic
1076787793 10:132759706-132759728 GGGCTCCTGCAGGGTGAGGAGGG - Intronic
1076839114 10:133036909-133036931 AGGCTGCACCAGAGTCAGGCTGG - Intergenic
1077232200 11:1462882-1462904 AGGCTGCCCCAGCCTGAGGCGGG + Intergenic
1077285770 11:1764549-1764571 AGGCTGTGCCAGTGTGAGGCTGG - Intergenic
1078820193 11:14872267-14872289 AAGCTGCTCTAGAGTGTGTAGGG + Intergenic
1078860681 11:15243553-15243575 AGGCTGCTGCACACTGAGGAGGG + Intronic
1078916311 11:15781961-15781983 AGGCTGCTCCAGCCTAAGAAGGG - Intergenic
1080067637 11:28037727-28037749 TGACTTCTCCAGAGTGATGAGGG - Intronic
1081712771 11:45227936-45227958 AAGCTGCTCCAGGGTCAGGCGGG - Intronic
1083387452 11:62322065-62322087 AGGCTGCTCCAGGGTGTGTCAGG + Intergenic
1083459799 11:62803467-62803489 GAGCTCCTCCAGAGAGAGGAGGG - Exonic
1084094400 11:66901342-66901364 AAGCTGGTAGAGAGTGAGGAAGG - Intronic
1084468148 11:69339350-69339372 TGGCTGCTGCAGAGTTAGGGAGG - Intronic
1084595743 11:70116037-70116059 GGGATGCTCCACAGTGAGAAGGG + Intronic
1085277648 11:75310246-75310268 AGCCTGCTCCAGGGTGTTGAGGG + Intronic
1085704143 11:78770943-78770965 AGGCGGCTCCAGAGGGTGGGAGG - Intronic
1086910170 11:92463028-92463050 AGGCTGCTCCACGCTGAGCATGG - Intronic
1089109277 11:116042254-116042276 GAGAGGCTCCAGAGTGAGGATGG - Intergenic
1089283576 11:117391453-117391475 AGGCTCCTCCAGGGTCAGGCTGG + Intronic
1089287557 11:117417444-117417466 AGGCTGCTGGAGAGAGAGTAAGG - Intergenic
1090870009 11:130735843-130735865 GGGCTGCTCCAGAGGGTGGGTGG + Intergenic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1092128750 12:6093696-6093718 AGCCTGTTCCACAGTGGGGAGGG + Intronic
1092395514 12:8122260-8122282 AGACCCCTCCAGGGTGAGGAGGG + Intergenic
1096526206 12:52211831-52211853 ATGCTCCTGCAGAGGGAGGAGGG + Intergenic
1097591392 12:61579945-61579967 GGTCTGCTCTAGAGTAAGGAAGG - Intergenic
1099971745 12:89507235-89507257 AGCCTGCTCCAGACAGAGCAAGG + Intronic
1102001637 12:109561248-109561270 ACGCTGCTCCAGAGTGGGCAGGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102308734 12:111827120-111827142 ATGCTGCACCTGAGTGAGGCTGG + Intergenic
1103419898 12:120771946-120771968 TGGCTCTTCCAGAATGAGGATGG - Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1104806961 12:131595735-131595757 AGGCTGCTGAGAAGTGAGGATGG + Intergenic
1106003844 13:25750432-25750454 AGGCTGCTTCAGTGTGGGGGTGG - Intronic
1106522101 13:30506959-30506981 AGTCGCCTTCAGAGTGAGGATGG - Intronic
1106901330 13:34357485-34357507 AAGCTGCTCCAGCGTGAGTTAGG - Intergenic
1108597947 13:51965713-51965735 AGGATGCTCGAGGGAGAGGAGGG + Intronic
1108855664 13:54789751-54789773 TGGCTGCTTCACACTGAGGAGGG + Intergenic
1112602287 13:100868642-100868664 AGACAGCTCCAGTGTGTGGAAGG + Intergenic
1113869571 13:113550619-113550641 TGGGTCCTCCAGAGGGAGGAAGG + Intronic
1114266294 14:21074519-21074541 AGGCCTCTCCAGAGTCCGGACGG + Exonic
1114416186 14:22546160-22546182 AGGCTGCCCAAGCATGAGGAGGG + Intergenic
1114459755 14:22878891-22878913 AAGCTGCCCCAGAGTTTGGAAGG + Exonic
1115203107 14:30874553-30874575 CGGCTGCGCCCGAGTGCGGAAGG - Exonic
1119090436 14:71775874-71775896 AGGCTTCTCCAGGGGAAGGATGG + Intergenic
1119473452 14:74913101-74913123 AGGCTGCTGGGCAGTGAGGAAGG + Intronic
1119749637 14:77068203-77068225 AGGGTGCCCCAGAGTGGGGCCGG - Intergenic
1121395817 14:93622371-93622393 AGGGTCTTCCAGAGTGATGAGGG - Exonic
1122061513 14:99139446-99139468 ACACAGCTCCAGGGTGAGGATGG - Intergenic
1122144253 14:99679793-99679815 TGTCTGCGACAGAGTGAGGAGGG + Exonic
1122278164 14:100605794-100605816 AGCCTGCCCCAGAGGCAGGAAGG - Intergenic
1122692910 14:103539538-103539560 AGGCTGCTCTGGGATGAGGAGGG - Intergenic
1122902503 14:104787623-104787645 AGGCTTCTCCTGAGAGTGGAAGG + Intronic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124096326 15:26651756-26651778 ATGCTGTACCAGAGTGAGGTTGG - Intronic
1124405105 15:29385020-29385042 AGGCTCTTCGTGAGTGAGGAGGG - Intronic
1124891816 15:33740705-33740727 AAACTGCTTCAGAGTGAGCAGGG + Intronic
1126657712 15:50997640-50997662 AGGCTGCAGTAGATTGAGGAGGG - Exonic
1127816078 15:62610049-62610071 ACCCTGCTCCAGACTTAGGAGGG + Intronic
1127978782 15:64018625-64018647 AGGTTGCACCAGGCTGAGGAAGG + Intronic
1129207414 15:74045265-74045287 AGGGAGGTCCTGAGTGAGGAAGG + Exonic
1129518898 15:76173336-76173358 AGGCTTCTGAAGAGTCAGGAAGG + Intronic
1130677843 15:85969462-85969484 AGGCTGTTCATGTGTGAGGAAGG - Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131981939 15:98003030-98003052 AGACTGTGCCTGAGTGAGGAAGG - Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132469644 16:94864-94886 AGGCTGCTGCAGGGAGAGGCAGG - Intronic
1133218214 16:4306388-4306410 AGGCTGCACCAGGCTGGGGAAGG + Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1138487804 16:57358000-57358022 TGGCTGCTGCAGGGTGGGGATGG + Intergenic
1139517280 16:67459460-67459482 AGGCTGCACCAGACTCAGGCTGG + Intronic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139650933 16:68361739-68361761 AGGGTCCTGGAGAGTGAGGAGGG - Exonic
1139749827 16:69102865-69102887 ATGTTGCTGCTGAGTGAGGACGG + Intergenic
1141860358 16:86712270-86712292 AGGGTGCTCGGGAGGGAGGAGGG - Intergenic
1141898448 16:86973942-86973964 ATGCTGCTCTGAAGTGAGGATGG - Intergenic
1142607586 17:1090678-1090700 AGTCTTCTCCAGCGTGAGAAAGG + Intronic
1143593193 17:7898306-7898328 AGGATGTTCAAGAGTGGGGAGGG + Intronic
1143726381 17:8849728-8849750 AGCCTGCTGCCGAGTGGGGAAGG - Intronic
1145991084 17:29079856-29079878 CAGCTGCTCCAGTGTGAAGAAGG - Intronic
1146927802 17:36757171-36757193 AGGCTCCTCTGGAGTGAGGAAGG - Intergenic
1147652210 17:42069126-42069148 AGGCTGCTGCAGAGAGGGTAGGG + Intergenic
1148145784 17:45364061-45364083 ACAGTGCTCCAGAGTAAGGATGG + Intergenic
1148221239 17:45863884-45863906 AGTGTGCTGCAGAGTGGGGAGGG - Intergenic
1148776327 17:50097456-50097478 AGGCAGCTCCTGCCTGAGGAAGG - Exonic
1148842991 17:50511038-50511060 AACATGCACCAGAGTGAGGAGGG + Intronic
1149848578 17:60021781-60021803 AGGCAGCCTCAGGGTGAGGAAGG + Intergenic
1149861591 17:60124743-60124765 AGGCAGCCTCAGGGTGAGGAAGG - Intergenic
1150004814 17:61463081-61463103 AGGTGGCTCCAGAAGGAGGAAGG - Intronic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151291695 17:73155461-73155483 TGGCTGCTGGAGAGTGAGGTGGG + Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1152660674 17:81540509-81540531 AGGCTGCCCAGCAGTGAGGAAGG + Exonic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1156372372 18:36483072-36483094 TGGCTGCTCCAGAGCCAGGATGG - Intronic
1156850849 18:41724576-41724598 AGGCTTGTTAAGAGTGAGGAAGG - Intergenic
1157089042 18:44613670-44613692 AGGCAACTCCAGAGGGAAGACGG - Intergenic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157984572 18:52422514-52422536 AGGTTGCCCCAGAGTAAGGAAGG + Intronic
1160548946 18:79680803-79680825 AGGCTGCTTCAGGGTGACGTGGG + Intronic
1160554088 18:79714923-79714945 AGGCTGCCCCAGAGGGAGCCGGG + Exonic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161318011 19:3627246-3627268 AGGCAGCTCCAGAGGGCAGAGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161409852 19:4111085-4111107 AGGCTGATCCAGAGACAGGAAGG + Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161768015 19:6217426-6217448 AGCCTGCCCCAGAGTGGGGAGGG - Intronic
1161770469 19:6228178-6228200 TGCGTGCTCCAGAGTGTGGAGGG - Intronic
1161806520 19:6446629-6446651 ATGCTGCACCAGAGAGATGAGGG - Intronic
1162056713 19:8068839-8068861 AGGCTGCTTCTGAGAGAGGCAGG + Intronic
1163103341 19:15110054-15110076 AGGCGGCCCCAGAGTGCGGCCGG - Exonic
1163405498 19:17119516-17119538 TGGCAGTTCCAGAGTAAGGATGG - Intronic
1163722106 19:18903236-18903258 AGCCTGTCCCAGAGTGGGGACGG - Intronic
1163830671 19:19545803-19545825 CGGCTTCTCCAGAGAGATGAAGG + Exonic
1163843844 19:19627957-19627979 AGGCGTCTCCAGACTGGGGAAGG + Exonic
1164700545 19:30281224-30281246 AGGCTGCTGGGGAGCGAGGAGGG - Intronic
1165335762 19:35168624-35168646 TGGCTGCTCCAGAGTGAGGGAGG - Intronic
1167807111 19:51795390-51795412 ACGCTACTCCAGAGTTAGAAGGG - Intronic
1202677403 1_KI270711v1_random:20092-20114 TGGCTCATCCGGAGTGAGGAGGG + Intergenic
926036395 2:9639147-9639169 AGGATCCTTCAGAGTGAGGCTGG - Intergenic
926605871 2:14897950-14897972 TGGCTGGGCCAGAGTGAGGTGGG + Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927597481 2:24409294-24409316 AGGCTGCTCCTGAGGGCAGAGGG - Intergenic
928120412 2:28580031-28580053 AGGCTGCTGGAGACTGGGGAAGG - Intronic
929234308 2:39590270-39590292 AGGCTGGCCCAGAGTCAAGATGG + Intergenic
929481747 2:42314751-42314773 AGGCTGCATAAGAGAGAGGATGG - Intronic
932582330 2:72999969-72999991 GGGCTGCTCCTGAGTGGGGAGGG - Intronic
932659964 2:73643247-73643269 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932666532 2:73702906-73702928 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
933777635 2:85780527-85780549 AGGCTGCTCACCAGAGAGGAGGG - Intronic
935178203 2:100667914-100667936 AGCATGGTCCAGAGTGATGATGG + Intergenic
935573459 2:104686765-104686787 TGGCTGCTCCTGAATGAGCAGGG - Intergenic
935671403 2:105559928-105559950 AGTCTGGTCCTGAGTCAGGATGG - Intergenic
935812075 2:106808308-106808330 ATACTGCTCCAGAGTCAGCAAGG + Intronic
936286037 2:111182142-111182164 AGGAGGCTCAAGAGGGAGGAGGG - Intergenic
936406508 2:112209539-112209561 TGGCATCTCCAGAGTGAGAAAGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937292604 2:120790622-120790644 AGGGTCTTCCAGAGTGTGGACGG - Intronic
937835805 2:126469308-126469330 AGGCTGCTGCAAAGTGATGAGGG - Intergenic
938615176 2:132990313-132990335 AGGATGCTCGGGAGTGGGGAAGG - Intronic
939573919 2:143873565-143873587 AGGCTGTTCCATAGCAAGGAGGG + Intergenic
940339381 2:152563865-152563887 AAGCTGCTCCAGAGGCAAGAGGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
948586116 2:239020774-239020796 AGCCTGCCCCAGAGGGAGGCAGG - Intergenic
948695290 2:239730085-239730107 AGGAAGCTCCAGAGTGAGCCCGG - Intergenic
948821536 2:240551715-240551737 TGGCTGCTCCATGCTGAGGAGGG - Intronic
948965988 2:241380939-241380961 AGCCAGCTACAGAGTGGGGATGG - Intronic
1168776230 20:449784-449806 ATGTTGTTTCAGAGTGAGGAGGG - Intronic
1168895472 20:1320737-1320759 GCACTGCTCCAGAGGGAGGAGGG + Intronic
1169977176 20:11342812-11342834 AGGCTGCTCCTGGGGGAGGAGGG + Intergenic
1170439107 20:16359760-16359782 AGGCTGCCCTAGATTGAGGTAGG - Intronic
1170829679 20:19829442-19829464 AGAGAGCTCTAGAGTGAGGAGGG + Intergenic
1170832825 20:19858274-19858296 AGGCTACATCTGAGTGAGGAAGG + Intergenic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1172518711 20:35553709-35553731 AGCTTCCTCCAGAGTGAAGAGGG - Intronic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1173996974 20:47345984-47346006 TGGCTGCTGAAGGGTGAGGATGG + Intronic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1175690512 20:61062464-61062486 TGGCTGCTACAGATTGAGGTGGG - Intergenic
1175721704 20:61291494-61291516 AGTCTCCTCCAGAGTAAGGGGGG + Intronic
1176146015 20:63565876-63565898 AGGCTGCCCCAGAGCCAGTAGGG - Exonic
1176958832 21:15136922-15136944 AGACAGCTCAAGAATGAGGATGG + Intergenic
1178900290 21:36592888-36592910 AGTCCGCTGCAGAGTGAGTAGGG - Intergenic
1179362212 21:40720879-40720901 AGGGAGCTCCAGAGAGCGGAAGG + Intronic
1181041733 22:20195532-20195554 AGGCTGGGGCAGGGTGAGGACGG - Intergenic
1181895718 22:26105826-26105848 AGGCTGCTCAAGACAGAGAAGGG - Intergenic
1182516483 22:30861913-30861935 ATGCCGCTCCAGGGAGAGGAAGG - Intronic
1182517659 22:30868191-30868213 AGGCTGATCCAGAGAAAGGGAGG + Intronic
1182632248 22:31695652-31695674 AGGCTGCTGCAGACGGAGGTAGG - Intronic
1183278587 22:36918801-36918823 TGGTTGCTCCAGAGTGAGAGTGG + Intronic
1183465765 22:37979742-37979764 TGGCTGCCCCAGGGTGAGGAGGG + Intronic
1183704967 22:39470576-39470598 TGGCTGCTGCAGAGGCAGGAGGG + Intronic
1184288749 22:43487004-43487026 AGGATGGTGCAGAGTGAAGAGGG + Intronic
1184714454 22:46273033-46273055 AGGCTGCAGCAGGGTGAGAAGGG - Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1185076402 22:48685495-48685517 ATGCTGCACCAGAGTCAGGTTGG + Intronic
1185139157 22:49090626-49090648 AAGGTGCTGCAGAGTGAGGCTGG + Intergenic
950484609 3:13265635-13265657 TGGCTGCACCAGAGGGATGAGGG - Intergenic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
952591647 3:34962478-34962500 AGGCTGCTCTAGAGGGAGATTGG + Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
956373394 3:68588260-68588282 ATGTTGCTCCAAAGTGGGGAGGG - Intergenic
959664130 3:108902646-108902668 TGGCTGCTGCAGTGTGGGGAAGG + Intergenic
959993049 3:112649697-112649719 AGGCAGATCCAGAGTGAAGAGGG - Intergenic
961372384 3:126439647-126439669 GGGCAGGTCCACAGTGAGGAAGG + Exonic
961601914 3:128068801-128068823 TGGCTGCTTCTGAGTGACGATGG - Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
961829642 3:129616899-129616921 AGGCTGCTCTTGAGTAAGGAGGG - Intergenic
962187022 3:133270910-133270932 AAGCTGCACCAGAGTGAGTGAGG - Intronic
962464914 3:135649188-135649210 AGGAAGCTGCAGTGTGAGGAAGG + Intergenic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
964203884 3:154148824-154148846 AGGCTGACCCAGGGTCAGGATGG + Intronic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964956553 3:162365569-162365591 GGGCTGCTCCCCAATGAGGAGGG - Intergenic
968138305 3:196235324-196235346 AGGCTGCACCTGAGTGATGGTGG - Exonic
968182177 3:196603977-196603999 AGGCAGCTCAAGAGTGTGGCCGG + Intergenic
968486801 4:866816-866838 AGGCTGCTCCTGGGGGAGGTGGG + Intronic
968804694 4:2764401-2764423 AGACTGCTCGAGAGCGAGGGTGG - Intergenic
968949976 4:3685465-3685487 AGGCAGCTGGAGAGTGAGGCTGG + Intergenic
969138297 4:5048799-5048821 AGTCTCCTCCAGAGTGGGGATGG + Intergenic
969239538 4:5889459-5889481 ATGTTGCTCCAGAGGGAGGTGGG + Intronic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972947898 4:44280523-44280545 AAGCTGCTCCAGAGTGAAGAAGG + Intronic
974957620 4:68662219-68662241 TGCCTTCTCCAGATTGAGGAAGG - Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
978770446 4:112451182-112451204 AGGCTGCTTCTCAGTGAGAAAGG + Intergenic
981328297 4:143477611-143477633 AGGGTACTCCAGAGAGAGGTTGG - Intergenic
983578937 4:169288351-169288373 AGGCTCCTCCAGAGTTGGGGTGG + Intergenic
983877328 4:172892840-172892862 GGGCTGCCCCTGAGGGAGGAGGG - Intronic
985946893 5:3192599-3192621 AGGCTGCACCACAGTGAAGATGG - Intergenic
989326256 5:40199221-40199243 GAGCTGCTCCAGAGTCATGAGGG + Intergenic
989920780 5:49800077-49800099 AAACTGCTCCAGAATAAGGAAGG - Intergenic
990476289 5:56164351-56164373 AGGCAGCTCCAGGGACAGGAAGG - Intronic
992380756 5:76234730-76234752 AGTCTGCACCAGAGGGAGGCAGG - Intronic
992828648 5:80572861-80572883 AAGGTCCTCCAGAGTGAGGCAGG - Intergenic
993973290 5:94445841-94445863 TGGCTGTTCCAGAGTGTGGATGG - Intronic
997476006 5:134142925-134142947 AGGCTGCACCAGGCTGAAGATGG - Intronic
997554847 5:134787025-134787047 AGGAGGCTCAAGAGGGAGGACGG - Intronic
998302614 5:141039683-141039705 ATGCCCCTCCAGAATGAGGAGGG + Intergenic
998406916 5:141879027-141879049 CGGGGGCTCTAGAGTGAGGATGG + Intronic
998424874 5:142018085-142018107 AGGCTGCTCCAGTGTGGAAATGG - Intergenic
999566819 5:152873114-152873136 TGTGTGCTTCAGAGTGAGGATGG - Intergenic
999736499 5:154517280-154517302 AGGCTGAGCCACAGTGGGGAGGG - Intergenic
1000117321 5:158165970-158165992 AGGCTCCTGGAGAGAGAGGAGGG - Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1001282533 5:170397367-170397389 AGCCAGCTAGAGAGTGAGGAGGG + Intronic
1001577529 5:172773861-172773883 ATGCTGCTTCTGACTGAGGATGG + Intergenic
1002065194 5:176648178-176648200 AGGCTCCTGCAGAGTGGGGTGGG + Intronic
1002160094 5:177309945-177309967 AGGCAGCTCCAGGGACAGGAGGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002450866 5:179317840-179317862 GGGCTGGTCCACAGTGAGGGAGG + Intronic
1003421643 6:5963582-5963604 AGGCTCATCTAGAGTGAGGCTGG + Intergenic
1004019178 6:11761019-11761041 TGGCTGGTTCAGATTGAGGAGGG - Intronic
1004110140 6:12709623-12709645 AGGTTGATCCAGAGAGAGGGAGG + Intergenic
1005478353 6:26231303-26231325 AGGGTCCTCTAGAATGAGGAAGG + Intergenic
1006444137 6:34069444-34069466 CGGCTGCTCCAGAGTGAGCTGGG + Intronic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006728485 6:36217342-36217364 GGGCTAATCCAAAGTGAGGATGG - Intronic
1007282455 6:40722571-40722593 AGGCAGTCCCAGAGTGGGGAGGG + Intergenic
1009622102 6:66090678-66090700 AATCTGCTCAAGAATGAGGAGGG - Intergenic
1014669027 6:124276807-124276829 TGTCTGCTCCAGAGTCAGAAAGG - Intronic
1015101808 6:129490460-129490482 AGGCTACACCAGAAAGAGGAAGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015765211 6:136708939-136708961 AGGATGCTGCACAGAGAGGACGG - Intronic
1019137934 6:169922721-169922743 TGGCTCCTCCAGAGAGAGGGGGG + Intergenic
1019165827 6:170097071-170097093 GGGCTGGTTCAGAGTGGGGAAGG - Intergenic
1019621599 7:1995192-1995214 AGGCTTCTCCACAGAGTGGAAGG - Intronic
1020324012 7:6960650-6960672 AGCCAGATCCAGTGTGAGGAGGG + Intergenic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023822548 7:43988156-43988178 AGGCTGCTCCAGCGTGAAGGTGG + Intergenic
1024704937 7:51946861-51946883 AGGCTGTTCGAGACTGAAGATGG - Intergenic
1027132024 7:75597956-75597978 AGGCTGCTCCTGGGTGTGGTGGG + Intronic
1029121421 7:98270676-98270698 GGGCTGGGCCAGAGAGAGGATGG + Intronic
1029224477 7:99014884-99014906 TGCCGGCTCCAGAGTGAGGAGGG + Intergenic
1029750811 7:102541571-102541593 AGGCTGCTCCAGCGTGAAGGTGG + Exonic
1029768766 7:102640682-102640704 AGGCTGCTCCAGCGTGAAGGTGG + Exonic
1030335292 7:108318790-108318812 AGGCTGTTCCAGGGCTAGGATGG - Intronic
1034228712 7:149502175-149502197 AGGGAGGTCCAGGGTGAGGAGGG - Intergenic
1034535096 7:151721306-151721328 AGGCAGCTCCAGAGTGACCGAGG - Intronic
1034816759 7:154178730-154178752 AGGCTGTTGCAGAATGAGGCAGG - Intronic
1035113631 7:156505252-156505274 GGCCTGTTCCAGAGTGTGGAAGG - Intergenic
1035223810 7:157422571-157422593 ATGCTCCTCCAGGGTGTGGAGGG + Intergenic
1035773803 8:2171707-2171729 AGGCTGTGCCTGAGTGAGGCAGG - Intergenic
1036288354 8:7464098-7464120 AGGGGGGTCCAAAGTGAGGAAGG - Intergenic
1036333121 8:7847430-7847452 AGGGGGGTCCAAAGTGAGGAAGG + Intergenic
1036391727 8:8329794-8329816 CTGCTGCTCCACAGGGAGGAGGG + Intronic
1036864448 8:12382363-12382385 AAGATGCTCCACAGTGAGAAAGG + Intergenic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1038579445 8:28734836-28734858 AGGCAGCTCCAGAGCCAGGTAGG - Intronic
1039403957 8:37297079-37297101 AGGGTGCTCCGGGGTCAGGAGGG - Intergenic
1039909280 8:41811449-41811471 TGGCAGCTCCTGTGTGAGGAGGG - Intronic
1041289250 8:56293164-56293186 ACTCTGCTCCAGAGCCAGGAGGG + Intergenic
1042109583 8:65366903-65366925 AGGTTGCTCTGGAGTGAGGTAGG + Intergenic
1043661200 8:82744312-82744334 AGGGTGCGCTACAGTGAGGAAGG - Intergenic
1044492374 8:92834621-92834643 AGCCTTCTCCAGAGTGGAGAAGG - Intergenic
1044722014 8:95160060-95160082 AGGCTCATGCAGGGTGAGGAGGG - Intergenic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1047372907 8:124270813-124270835 AGGGTGGTACAGATTGAGGAAGG + Intergenic
1047401608 8:124553257-124553279 TGGCCGCTCCACATTGAGGAGGG + Exonic
1048262024 8:132953254-132953276 GGGCTGCTCCAGCCTGGGGAAGG - Intronic
1048267353 8:132999195-132999217 AGTCTGGACCAGAGTGAGAAAGG + Intronic
1048938572 8:139377225-139377247 AGGCTGGATGAGAGTGAGGAGGG - Intergenic
1049603337 8:143518132-143518154 AGGCAGCTCCAGGGCCAGGATGG + Intronic
1050498678 9:6271198-6271220 AGCCTGCTGCAGGTTGAGGAAGG + Intergenic
1051154913 9:14131761-14131783 AGGCTGCTACAGACTGAGGAAGG - Intronic
1051369143 9:16343584-16343606 AGGTTGCTCCCGACTGAGCAGGG + Intergenic
1052365758 9:27610734-27610756 AGGCTCCTCCACAGCGGGGAAGG + Intergenic
1053482577 9:38426810-38426832 AGGCTGCTCCAGAGATAGTGAGG + Intergenic
1057011628 9:91607968-91607990 AGGCTTCTCAACAGTGAGCATGG + Intronic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1060040296 9:120294559-120294581 AGACTGCTTGAGAGTGTGGACGG - Intergenic
1060368323 9:123043174-123043196 ATGCTTCTCCAGAATGAGGGAGG + Intronic
1061774146 9:132949397-132949419 AGGCTGGTTCAGTGTGAGGAAGG - Intronic
1062284438 9:135766745-135766767 GGGCTGCTCCACAGTGGGTATGG - Intronic
1185636430 X:1555291-1555313 ATGATGCTCCAGTGTCAGGAAGG + Intergenic
1185721705 X:2387801-2387823 AGCCAGCTCCAGAGTGTGCATGG + Intronic
1187022219 X:15395525-15395547 AGTCTACTCCAGATTGAGCATGG - Intronic
1187448209 X:19375735-19375757 AGGGTGCTGCAGAGTGTAGAGGG + Intronic
1189250032 X:39593628-39593650 AGCATGCTTCAGAATGAGGAGGG + Intergenic
1189310823 X:40016045-40016067 AGGCTGCTCCAGGGTAATTAGGG + Intergenic
1190938124 X:55014856-55014878 CGGCTGCTCAAGGGAGAGGAGGG - Exonic
1192199883 X:69060178-69060200 CGGCTGCTCCAGAAAGAGGGCGG + Intergenic
1192452689 X:71253672-71253694 GGGCTCCTGCAGAGTGGGGAGGG - Intronic
1194430917 X:93803694-93803716 AGGCTGCTCTAGGGTGTGGTAGG + Intergenic
1195952316 X:110287948-110287970 AAGCTCCTGAAGAGTGAGGATGG - Intronic
1197750970 X:129963336-129963358 TGACTCCTGCAGAGTGAGGAGGG - Intergenic
1200898865 Y:8407246-8407268 AGGCTTCTCCAGAGCCAGGATGG + Intergenic