ID: 1091707950

View in Genome Browser
Species Human (GRCh38)
Location 12:2712519-2712541
Sequence AGGAATTATACCAGTGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091707944_1091707950 30 Left 1091707944 12:2712466-2712488 CCTTAGTCATATTTATGGCATCT No data
Right 1091707950 12:2712519-2712541 AGGAATTATACCAGTGGGCTAGG No data
1091707947_1091707950 -8 Left 1091707947 12:2712504-2712526 CCAACACTCAACAGCAGGAATTA No data
Right 1091707950 12:2712519-2712541 AGGAATTATACCAGTGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091707950 Original CRISPR AGGAATTATACCAGTGGGCT AGG Intergenic
No off target data available for this crispr