ID: 1091710464

View in Genome Browser
Species Human (GRCh38)
Location 12:2736572-2736594
Sequence TATAAGGAAGACTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091710464_1091710467 11 Left 1091710464 12:2736572-2736594 CCTGCAGTGGAGTCTTCCTTATA No data
Right 1091710467 12:2736606-2736628 GTTTTTGCAGAGAACTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091710464 Original CRISPR TATAAGGAAGACTCCACTGC AGG (reversed) Intergenic
No off target data available for this crispr