ID: 1091712243

View in Genome Browser
Species Human (GRCh38)
Location 12:2750264-2750286
Sequence CCACCTCCATGGAGACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091712243_1091712252 28 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712252 12:2750315-2750337 CTGGCTTCAGCCCCCTTTCCAGG 0: 545
1: 595
2: 365
3: 259
4: 625
1091712243_1091712253 29 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712253 12:2750316-2750338 TGGCTTCAGCCCCCTTTCCAGGG 0: 544
1: 578
2: 353
3: 262
4: 455
1091712243_1091712247 1 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712247 12:2750288-2750310 ATCTGCTAAGCTAGACCACTTGG No data
1091712243_1091712248 9 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712248 12:2750296-2750318 AGCTAGACCACTTGGCTCCCTGG 0: 296
1: 590
2: 567
3: 309
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091712243 Original CRISPR CCACCTCCATGGAGACCAGC AGG (reversed) Intergenic
No off target data available for this crispr