ID: 1091712243

View in Genome Browser
Species Human (GRCh38)
Location 12:2750264-2750286
Sequence CCACCTCCATGGAGACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091712243_1091712248 9 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712248 12:2750296-2750318 AGCTAGACCACTTGGCTCCCTGG No data
1091712243_1091712252 28 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712252 12:2750315-2750337 CTGGCTTCAGCCCCCTTTCCAGG No data
1091712243_1091712253 29 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712253 12:2750316-2750338 TGGCTTCAGCCCCCTTTCCAGGG No data
1091712243_1091712247 1 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712247 12:2750288-2750310 ATCTGCTAAGCTAGACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091712243 Original CRISPR CCACCTCCATGGAGACCAGC AGG (reversed) Intergenic