ID: 1091712247

View in Genome Browser
Species Human (GRCh38)
Location 12:2750288-2750310
Sequence ATCTGCTAAGCTAGACCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091712240_1091712247 7 Left 1091712240 12:2750258-2750280 CCTTAGCCTGCTGGTCTCCATGG No data
Right 1091712247 12:2750288-2750310 ATCTGCTAAGCTAGACCACTTGG No data
1091712239_1091712247 15 Left 1091712239 12:2750250-2750272 CCAGTGGACCTTAGCCTGCTGGT No data
Right 1091712247 12:2750288-2750310 ATCTGCTAAGCTAGACCACTTGG No data
1091712243_1091712247 1 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712247 12:2750288-2750310 ATCTGCTAAGCTAGACCACTTGG No data
1091712246_1091712247 -10 Left 1091712246 12:2750275-2750297 CCATGGAGGTGGGATCTGCTAAG No data
Right 1091712247 12:2750288-2750310 ATCTGCTAAGCTAGACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091712247 Original CRISPR ATCTGCTAAGCTAGACCACT TGG Intergenic
No off target data available for this crispr