ID: 1091712248

View in Genome Browser
Species Human (GRCh38)
Location 12:2750296-2750318
Sequence AGCTAGACCACTTGGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2022
Summary {0: 296, 1: 590, 2: 567, 3: 309, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091712246_1091712248 -2 Left 1091712246 12:2750275-2750297 CCATGGAGGTGGGATCTGCTAAG No data
Right 1091712248 12:2750296-2750318 AGCTAGACCACTTGGCTCCCTGG 0: 296
1: 590
2: 567
3: 309
4: 260
1091712239_1091712248 23 Left 1091712239 12:2750250-2750272 CCAGTGGACCTTAGCCTGCTGGT No data
Right 1091712248 12:2750296-2750318 AGCTAGACCACTTGGCTCCCTGG 0: 296
1: 590
2: 567
3: 309
4: 260
1091712243_1091712248 9 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712248 12:2750296-2750318 AGCTAGACCACTTGGCTCCCTGG 0: 296
1: 590
2: 567
3: 309
4: 260
1091712240_1091712248 15 Left 1091712240 12:2750258-2750280 CCTTAGCCTGCTGGTCTCCATGG No data
Right 1091712248 12:2750296-2750318 AGCTAGACCACTTGGCTCCCTGG 0: 296
1: 590
2: 567
3: 309
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091712248 Original CRISPR AGCTAGACCACTTGGCTCCC TGG Intergenic
Too many off-targets to display for this crispr