ID: 1091712252

View in Genome Browser
Species Human (GRCh38)
Location 12:2750315-2750337
Sequence CTGGCTTCAGCCCCCTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2389
Summary {0: 545, 1: 595, 2: 365, 3: 259, 4: 625}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091712246_1091712252 17 Left 1091712246 12:2750275-2750297 CCATGGAGGTGGGATCTGCTAAG No data
Right 1091712252 12:2750315-2750337 CTGGCTTCAGCCCCCTTTCCAGG 0: 545
1: 595
2: 365
3: 259
4: 625
1091712243_1091712252 28 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712252 12:2750315-2750337 CTGGCTTCAGCCCCCTTTCCAGG 0: 545
1: 595
2: 365
3: 259
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091712252 Original CRISPR CTGGCTTCAGCCCCCTTTCC AGG Intergenic
Too many off-targets to display for this crispr