ID: 1091712253

View in Genome Browser
Species Human (GRCh38)
Location 12:2750316-2750338
Sequence TGGCTTCAGCCCCCTTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2192
Summary {0: 544, 1: 578, 2: 353, 3: 262, 4: 455}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091712249_1091712253 -10 Left 1091712249 12:2750303-2750325 CCACTTGGCTCCCTGGCTTCAGC 0: 643
1: 640
2: 376
3: 178
4: 406
Right 1091712253 12:2750316-2750338 TGGCTTCAGCCCCCTTTCCAGGG 0: 544
1: 578
2: 353
3: 262
4: 455
1091712246_1091712253 18 Left 1091712246 12:2750275-2750297 CCATGGAGGTGGGATCTGCTAAG No data
Right 1091712253 12:2750316-2750338 TGGCTTCAGCCCCCTTTCCAGGG 0: 544
1: 578
2: 353
3: 262
4: 455
1091712243_1091712253 29 Left 1091712243 12:2750264-2750286 CCTGCTGGTCTCCATGGAGGTGG No data
Right 1091712253 12:2750316-2750338 TGGCTTCAGCCCCCTTTCCAGGG 0: 544
1: 578
2: 353
3: 262
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091712253 Original CRISPR TGGCTTCAGCCCCCTTTCCA GGG Intergenic
Too many off-targets to display for this crispr