ID: 1091714724

View in Genome Browser
Species Human (GRCh38)
Location 12:2768715-2768737
Sequence TGGGCACGTAGTGGTAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091714724_1091714736 8 Left 1091714724 12:2768715-2768737 CCAGTCCTACCACTACGTGCCCA No data
Right 1091714736 12:2768746-2768768 CCTCCAAGCCCGTTGGCCTGAGG No data
1091714724_1091714731 1 Left 1091714724 12:2768715-2768737 CCAGTCCTACCACTACGTGCCCA No data
Right 1091714731 12:2768739-2768761 GGCCCCACCTCCAAGCCCGTTGG No data
1091714724_1091714740 22 Left 1091714724 12:2768715-2768737 CCAGTCCTACCACTACGTGCCCA No data
Right 1091714740 12:2768760-2768782 GGCCTGAGGCGCCTCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091714724 Original CRISPR TGGGCACGTAGTGGTAGGAC TGG (reversed) Intergenic