ID: 1091717360

View in Genome Browser
Species Human (GRCh38)
Location 12:2788577-2788599
Sequence TTTCACAAACATAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091717358_1091717360 -7 Left 1091717358 12:2788561-2788583 CCACGAGATGGATGAATTTCACA No data
Right 1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG No data
1091717357_1091717360 1 Left 1091717357 12:2788553-2788575 CCTGTCTGCCACGAGATGGATGA No data
Right 1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091717360 Original CRISPR TTTCACAAACATAATGTGGA AGG Intergenic
No off target data available for this crispr