ID: 1091719445

View in Genome Browser
Species Human (GRCh38)
Location 12:2801870-2801892
Sequence GGACCATCCAAGACCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091719445_1091719447 -6 Left 1091719445 12:2801870-2801892 CCCTTCAGGGTCTTGGATGGTCC 0: 1
1: 0
2: 2
3: 15
4: 105
Right 1091719447 12:2801887-2801909 TGGTCCAGTGTATTGCGTCAAGG 0: 1
1: 0
2: 0
3: 1
4: 29
1091719445_1091719449 0 Left 1091719445 12:2801870-2801892 CCCTTCAGGGTCTTGGATGGTCC 0: 1
1: 0
2: 2
3: 15
4: 105
Right 1091719449 12:2801893-2801915 AGTGTATTGCGTCAAGGCACAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091719445 Original CRISPR GGACCATCCAAGACCCTGAA GGG (reversed) Intronic
904619743 1:31768013-31768035 AGATCACCCAAGACCCTAAAGGG - Intergenic
905182426 1:36175478-36175500 GGACCAGCCAAGGCCATGACTGG - Intronic
905278141 1:36832479-36832501 TGACAAACCAACACCCTGAAGGG + Intronic
905367109 1:37458586-37458608 GGCCCTTCCCAGACCCTGCAGGG + Intergenic
905773318 1:40652392-40652414 GGACCACCCAAGGCACTGAGAGG + Intronic
910105526 1:83627682-83627704 GGACAATAAAAGACCCTTAAGGG + Intergenic
910690616 1:89961980-89962002 AGAACGTCCAAGACCATGAATGG - Intergenic
911706606 1:101020971-101020993 GGACCATGTAAGACCTTGGAGGG - Intronic
912240082 1:107897446-107897468 GGAGCAACCAGGACCCAGAAAGG + Intronic
917812901 1:178677467-178677489 GAACCATGAAAGACCCCGAATGG + Intergenic
1064872011 10:19947863-19947885 GGACTTTCCTAGACCCTGGAGGG - Intronic
1065832902 10:29631151-29631173 GGGGCATGAAAGACCCTGAAGGG + Intronic
1070597234 10:77841162-77841184 GGCCCATCCAAGCCCCCGCAGGG + Intronic
1070818260 10:79338955-79338977 TCTCCATCCTAGACCCTGAATGG - Intergenic
1072042914 10:91626557-91626579 GGACCATCCAAATCCAGGAATGG + Intergenic
1073591447 10:104761597-104761619 AGAGTATCCAAGATCCTGAATGG + Intronic
1073826871 10:107334055-107334077 GAACCACAAAAGACCCTGAATGG - Intergenic
1075682117 10:124340575-124340597 GGGGGATCCAAGACCCAGAAAGG + Intergenic
1076253262 10:128999604-128999626 AGACCATCCAAGACCCAGCAGGG + Intergenic
1076884258 10:133254411-133254433 AGACCATCCCAGACCCTGCCAGG - Intergenic
1078509306 11:11973780-11973802 GGAAAATCAAAGACTCTGAATGG - Intronic
1083118258 11:60485518-60485540 GGACCATCCATGAACTTGGAAGG + Intergenic
1083132177 11:60634764-60634786 GAACCTTGCAACACCCTGAAAGG + Intergenic
1084916505 11:72432946-72432968 GGAACAACTAAGAACCTGAATGG + Intronic
1091717373 12:2788730-2788752 GGAACATCCAGGAGCCTTAAGGG + Intergenic
1091719445 12:2801870-2801892 GGACCATCCAAGACCCTGAAGGG - Intronic
1094228262 12:28072085-28072107 GATCCACACAAGACCCTGAAGGG + Intergenic
1096579092 12:52573007-52573029 GGATCTTCCAAGAACATGAAAGG - Intronic
1102116836 12:110409418-110409440 TTACCATCCTAGACCCAGAAGGG - Intergenic
1105625651 13:22110340-22110362 GGAGCATCCAAGACCCTTCCTGG + Intergenic
1123879809 15:24666905-24666927 AGACCATCTAAGACCCAGAGGGG - Intergenic
1123936458 15:25196463-25196485 GAACCACCCATGGCCCTGAATGG + Intergenic
1127848512 15:62892452-62892474 GGAACATACAAAACCCTCAAAGG - Intergenic
1133012890 16:2924760-2924782 CTACCATCCAAGAGCCTGAACGG + Intronic
1136042694 16:27593028-27593050 GGACCTCCCAGGACCCTGGAGGG - Intronic
1137450512 16:48569738-48569760 CCACCATCCAAGTCCCAGAATGG - Intronic
1141844948 16:86601945-86601967 CGACCATCTGTGACCCTGAATGG - Intergenic
1148845267 17:50526267-50526289 GGTGCTTCCAAGACCCTGGAAGG + Exonic
1151758089 17:76086177-76086199 GCAGCAGCCAAGACCCTCAACGG + Intronic
1153564846 18:6409411-6409433 GGACCTTCCAAGTTCCTGAAGGG - Intronic
1156003091 18:32407710-32407732 CAACCATCTGAGACCCTGAAGGG + Intronic
1157995244 18:52546967-52546989 GGACCTTCCAAGCCACTGAAGGG + Intronic
1158928701 18:62298839-62298861 AGACCGTCCAAGAGCCTCAAGGG + Exonic
1161381714 19:3968933-3968955 GGACCCTCCAAGGCCCAGACAGG + Intronic
1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG + Exonic
1163073761 19:14869544-14869566 GAACCATCCAAGACCCTACATGG - Intergenic
926465392 2:13180511-13180533 GAACCATTGATGACCCTGAAAGG + Intergenic
931524417 2:63136858-63136880 GCTCCATCCATGTCCCTGAATGG + Intronic
933819422 2:86096443-86096465 GAACCATAAAAGACCCTGAATGG + Intronic
934523636 2:95035129-95035151 GGACCCTCCCAGACCCTGGGCGG + Intronic
939004344 2:136767716-136767738 AGAATATCCAAAACCCTGAATGG - Intronic
940910533 2:159206149-159206171 GGACCACCCAGGATCCTGAAAGG + Intronic
945040939 2:205743388-205743410 GGAACACCCAAGACAGTGAAAGG + Exonic
948798888 2:240421205-240421227 GGAACACCCAGGACCCTGGAAGG + Intergenic
1169574103 20:6939330-6939352 GCACAATCCAAGACCATGTATGG - Intergenic
1170410581 20:16086434-16086456 GAACCACAGAAGACCCTGAATGG + Intergenic
1171110723 20:22479596-22479618 GCTCCATCCATGTCCCTGAAAGG - Intergenic
1173653714 20:44684451-44684473 AGACCATCCAAGGCCATGAGTGG + Intergenic
1175701863 20:61144734-61144756 GAACCACAGAAGACCCTGAATGG - Intergenic
1175817638 20:61891733-61891755 GGAACACCCCAGACCCTGATTGG + Intronic
1182285211 22:29242990-29243012 GGACCATCCAAGCGTCAGAAAGG + Intronic
1183254838 22:36755829-36755851 AGACCATCCTAGTCACTGAAAGG + Intergenic
953268715 3:41418663-41418685 GGACCATTCAGGACCCTAAGAGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
961587665 3:127947281-127947303 GGCCCATCCCAGGCCCTGATTGG - Intronic
962047525 3:131776401-131776423 GGAACTTCCAACACCCTGATGGG + Intronic
962212281 3:133489142-133489164 GGCCCTTCCAAGGTCCTGAAAGG - Intergenic
968653736 4:1769946-1769968 GGTCCAGCCCAGACCCTGAGTGG - Intergenic
968774935 4:2535217-2535239 GGATCATCCAAGACCCTGATGGG + Intronic
972814525 4:42629303-42629325 GGACCATCGAAGAGACTGGATGG + Intronic
974012161 4:56616995-56617017 ATACCTTCCAAGACCCTGAGGGG + Intergenic
974551546 4:63381154-63381176 GGCCCAACCAGGACCCTAAACGG + Intergenic
975889091 4:79003450-79003472 GCTCCATCCATGTCCCTGAAAGG - Intergenic
976050456 4:81006118-81006140 GAACCATTCATGACCCTGTAGGG + Intergenic
979303616 4:119116105-119116127 GGACCAGCCAAGGCCCTTTATGG - Intergenic
980321994 4:131291128-131291150 AGACAAACCAAGACCCTCAAAGG + Intergenic
980906238 4:138951113-138951135 GGAGGAACCAAGAACCTGAAGGG - Intergenic
981193680 4:141893084-141893106 GGACCATCCAAGTCACAGATAGG + Intergenic
990031468 5:51264304-51264326 GGACCACAGAAGACCCTGAAGGG - Intergenic
990682631 5:58262545-58262567 GGATTATTCAAGACCCTGAATGG + Intergenic
994157552 5:96520829-96520851 GCACCATTCCAGACCCTGAATGG + Intergenic
994469344 5:100182826-100182848 AGAGCTTCCAAGAACCTGAAAGG + Intergenic
995754199 5:115485403-115485425 GAACCATGAAAGACTCTGAATGG - Intergenic
996027974 5:118670835-118670857 GAACTATAAAAGACCCTGAATGG - Intergenic
997068372 5:130590046-130590068 GTACCATCCAAGGAGCTGAAAGG + Intergenic
997754534 5:136383693-136383715 GCTCCATCCATGTCCCTGAAAGG + Intronic
1000019121 5:157303703-157303725 GGACCAACCAGGCCCCTGCAGGG - Intronic
1011436156 6:87339487-87339509 GGACAATCCAAGACCCTAAGAGG - Intronic
1011712046 6:90065021-90065043 GGACCACCCAAGACTCTGTAAGG - Intronic
1019088276 6:169502029-169502051 GGGGCATCCAATGCCCTGAACGG + Intronic
1019933055 7:4236267-4236289 GGCCCATGGAAGGCCCTGAATGG + Intronic
1022485555 7:30774774-30774796 GGACCAGCGAAGACCCTGAAGGG - Intronic
1023010131 7:35918570-35918592 GGACCCTCCATCACCCAGAAAGG + Intergenic
1024080694 7:45853009-45853031 GGACCCTCCATCACCCAGAAAGG - Intergenic
1025123759 7:56328671-56328693 GGACCCTCCATCACCCAGAAAGG + Intergenic
1025848048 7:65217851-65217873 GGACCCTCCATCACCCAGAAAGG + Intergenic
1025898286 7:65723716-65723738 GGACCCTCCATCACCCAGAAAGG + Intergenic
1026346775 7:69481342-69481364 GGACCCTGCAGGACCCTAAAAGG - Intergenic
1028586011 7:92452488-92452510 TGACCACCCAAGACCCAGAATGG + Intronic
1029885221 7:103862591-103862613 GAACCATCAGAGAACCTGAAAGG - Intronic
1029972299 7:104801317-104801339 GGACCAGCCAAGACCTGGAAAGG + Intronic
1032340108 7:131063090-131063112 GGTCCATGAAAGACCCTGTAGGG - Intergenic
1034204659 7:149304925-149304947 GGCCAATCCAAGCCCCTGGAGGG - Intergenic
1034211299 7:149365420-149365442 GGTCAATCCCAGGCCCTGAATGG + Intergenic
1034968009 7:155403464-155403486 GGACCCTCCAGGACACTGACAGG + Intergenic
1039107972 8:34009915-34009937 GGCCTATCCAAGGCCCTGAGAGG + Intergenic
1044865057 8:96562826-96562848 GAACCATCCAAGTCCCCAAATGG - Intronic
1044915320 8:97107379-97107401 GCACCATCCCATACTCTGAAGGG + Intronic
1047370788 8:124254111-124254133 TGTCCCTCCAAGACCCTGCATGG - Intergenic
1049393618 8:142385218-142385240 GACACCTCCAAGACCCTGAAAGG + Intronic
1051340110 9:16103089-16103111 GGACCTGCCAAGACCCAAAAGGG - Intergenic
1051587870 9:18746250-18746272 TGACAGTCCAAGAACCTGAAAGG + Intronic
1061993737 9:134173750-134173772 GGACCATCCCAGAGGCTGCAGGG + Intergenic
1188829281 X:34876592-34876614 GGACCATCCTAGAAAATGAAAGG + Intergenic
1189778498 X:44491533-44491555 GCACCTTCCAAGGCCCTGAAAGG + Intergenic
1190421583 X:50290144-50290166 GGCCCCTCCAAGTCCCTGATGGG + Intronic
1190596724 X:52059496-52059518 GGACACTGCAAGACCCTGGATGG + Intergenic
1190612100 X:52194577-52194599 GGACACTGCAAGACCCTGGATGG - Intergenic
1195213601 X:102674445-102674467 GCTCCATCCATGTCCCTGAAAGG + Intergenic
1195735220 X:108005860-108005882 GAACCAAGAAAGACCCTGAATGG + Intergenic
1195746757 X:108126367-108126389 GCCCCTTCCAAGGCCCTGAAAGG + Intronic
1195838023 X:109141690-109141712 GAACCATGAAAGACCCAGAATGG + Intergenic
1196934013 X:120711504-120711526 GAACCACAAAAGACCCTGAATGG + Intergenic