ID: 1091722731

View in Genome Browser
Species Human (GRCh38)
Location 12:2825139-2825161
Sequence CAGCAGGAATACATTTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091722731_1091722735 -4 Left 1091722731 12:2825139-2825161 CCATGTAAAATGTATTCCTGCTG 0: 1
1: 0
2: 0
3: 17
4: 249
Right 1091722735 12:2825158-2825180 GCTGTGGTAAGCTGTGGTCGAGG 0: 1
1: 0
2: 2
3: 15
4: 173
1091722731_1091722733 -10 Left 1091722731 12:2825139-2825161 CCATGTAAAATGTATTCCTGCTG 0: 1
1: 0
2: 0
3: 17
4: 249
Right 1091722733 12:2825152-2825174 ATTCCTGCTGTGGTAAGCTGTGG 0: 1
1: 0
2: 3
3: 37
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091722731 Original CRISPR CAGCAGGAATACATTTTACA TGG (reversed) Intronic
901419534 1:9141454-9141476 CAGCAAGCATGCATTCTACAGGG - Intergenic
908283311 1:62565974-62565996 ACCCAGGAATACAATTTACAAGG + Intronic
909144256 1:71909244-71909266 CAGCAGGAGTCCATTTGAAATGG + Intronic
909208463 1:72791464-72791486 CACCTGGTATAAATTTTACATGG - Intergenic
909539302 1:76772705-76772727 CAGCAAAAATAAATTTTAAAAGG - Intergenic
910806872 1:91197157-91197179 CACCTGGAAACCATTTTACATGG + Intergenic
911841574 1:102688686-102688708 CAGCAGGGAAAGAGTTTACAGGG - Intergenic
912068060 1:105771346-105771368 CAGCAGAAATAAAATTTACTTGG + Intergenic
912203685 1:107486555-107486577 CTGCAGGAAAACATTCTCCAAGG + Intergenic
912619169 1:111138450-111138472 ATGCAGGAATAAATTTCACAGGG + Intronic
912705642 1:111910023-111910045 CAGCAGGAATAAATTTTCAGTGG + Intronic
914044775 1:144082103-144082125 CAGCAGGGTCACATCTTACACGG + Intergenic
914133335 1:144878583-144878605 CAGCAGGGTCACATCTTACACGG - Intergenic
915013115 1:152708312-152708334 CAGCAGGAACACACTTTGTATGG - Exonic
916632871 1:166635821-166635843 CAGCAGGACTACATTTTTTCTGG + Intergenic
917056172 1:170984336-170984358 CAGAAGCAATACATCTAACATGG + Intronic
917620958 1:176795244-176795266 CAGCAGTAGTACAGTTTACTGGG - Intronic
918367247 1:183821424-183821446 AAGAAAAAATACATTTTACATGG - Intronic
918821790 1:189266098-189266120 GAGAAGAAACACATTTTACAAGG + Intergenic
920645227 1:207798335-207798357 CACCAGGATTACTGTTTACAGGG - Intergenic
923388788 1:233492827-233492849 TTGCAGCAATACATTTTAAAAGG - Intergenic
923977651 1:239282154-239282176 CAGCAGGAATTCATTGTGTAGGG + Intergenic
924263300 1:242253744-242253766 CAGCAGGAATAACATTTTCAAGG - Intronic
1062868646 10:879259-879281 CAGCACGAATACATTCTAAGAGG + Intronic
1063765405 10:9134534-9134556 CATTAGGAATACATTTTTGAGGG + Intergenic
1066220037 10:33327915-33327937 CAGCAGGAAGATATTTTCCATGG + Intronic
1066483801 10:35824408-35824430 CAGCAGGTATAGAATTCACACGG + Intergenic
1066956898 10:42181782-42181804 CAGCAGGGTCACATCTTACACGG + Intergenic
1067742442 10:48905820-48905842 CAGAAGGATTACAATTTACTGGG - Intronic
1071737195 10:88314515-88314537 CAGCTGGAAAACATTTTGCCGGG - Exonic
1072055285 10:91749273-91749295 CAACAGGAATACATTGTGAATGG - Intergenic
1073599122 10:104829742-104829764 CAGCAGTATTTCACTTTACAGGG + Intronic
1075601094 10:123769974-123769996 CAGCAGGAGTTTATTTTAAATGG - Intronic
1078116180 11:8453257-8453279 AAGCCAGAATATATTTTACAAGG - Intronic
1078154339 11:8785870-8785892 AAGCAAGAATACAAGTTACATGG + Intronic
1079546974 11:21644126-21644148 GAGCAAGAACACATCTTACATGG - Intergenic
1080473564 11:32569687-32569709 AAACAGGAAGACATTTTACCAGG - Intergenic
1080620018 11:33979503-33979525 CAGGAGGAATACATTTCAGGAGG - Intergenic
1083024322 11:59537139-59537161 AAGAAGGAATACATTTTTTATGG - Intergenic
1083395316 11:62387393-62387415 CAGCAGGCATACATTTGAACTGG + Intronic
1085149483 11:74237929-74237951 CAGTAGTAAAGCATTTTACATGG + Intronic
1085544095 11:77301247-77301269 CAGGAGGAATCGATTTTAGAGGG - Intronic
1086299963 11:85416661-85416683 CCCTAGGAATACATCTTACAAGG - Intronic
1086632321 11:89037896-89037918 CAGAAGAAATATATTTTAAATGG + Intronic
1087932503 11:103994104-103994126 CAGTAGGAATACAGTTTTAAGGG - Intronic
1088786963 11:113190851-113190873 CAACAGGAATCCCTTTAACATGG + Intronic
1089109465 11:116043790-116043812 CAACAGGAATGTATTTTTCATGG - Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1090155794 11:124437465-124437487 CAGCAGGAATTTATTTCTCATGG + Intergenic
1090685628 11:129115278-129115300 CAGCAGAATTACATCTTACATGG + Intronic
1091722731 12:2825139-2825161 CAGCAGGAATACATTTTACATGG - Intronic
1092006258 12:5072968-5072990 CAGTAGGAATAGATTATACATGG + Intergenic
1094337322 12:29374606-29374628 CAGGAGGAACAATTTTTACAGGG - Intronic
1094758285 12:33497367-33497389 TACCAGGAATACAACTTACAAGG + Intergenic
1099686785 12:85899808-85899830 TAGCAAGAAGACATTTTAGAAGG - Intergenic
1101935917 12:109056735-109056757 CAGCAGGAATATATGTTATTTGG + Exonic
1104165506 12:126225412-126225434 CAACAGAAATACATTTCTCATGG + Intergenic
1104547036 12:129721969-129721991 CTGCAGGATTAAAATTTACATGG - Intronic
1105832017 13:24171066-24171088 CAGAAGGAAGACAATTTGCATGG + Intronic
1107617523 13:42185928-42185950 TAGGAGGAATACAATTTCCAAGG + Intronic
1108398719 13:50016743-50016765 CAGCATTAAGACATTTTACGGGG - Intronic
1109789595 13:67229908-67229930 CCGAAGCAACACATTTTACAAGG - Intronic
1112291836 13:98150555-98150577 TATTAGGAAAACATTTTACATGG + Intronic
1113612989 13:111661271-111661293 CTGCAGGAATACAGTGTACTGGG - Intronic
1114512345 14:23272967-23272989 ATGCAGGGATACATTTTCCAGGG - Exonic
1116037522 14:39645330-39645352 CAGCAGGAATCCCTTTCACCTGG - Intergenic
1117212623 14:53516644-53516666 CATCAGAAAAACATTTTACTAGG - Intergenic
1118460564 14:65983445-65983467 CAGAATGAATGCACTTTACATGG + Intronic
1119207020 14:72802032-72802054 CAGCAGGAATTTGTTTTCCATGG - Intronic
1120430721 14:84411258-84411280 TAGAAGAAATACATTTTGCATGG + Intergenic
1121171817 14:91860888-91860910 GGGCTGGACTACATTTTACAAGG + Intronic
1202936214 14_KI270725v1_random:89998-90020 CAGCAGGGTCACATCTTACACGG - Intergenic
1123459560 15:20457184-20457206 CAGCAGGTAGAAATGTTACATGG + Intergenic
1123487160 15:20751509-20751531 AAGAAAAAATACATTTTACACGG + Intergenic
1123543649 15:21320568-21320590 AAGAAAAAATACATTTTACACGG + Intergenic
1123658501 15:22543237-22543259 CAGCAGGTAGAAATGTTACATGG - Intergenic
1124312366 15:28637729-28637751 CAGCAGGTAGAAATGTTACATGG - Intergenic
1125132599 15:36301241-36301263 CAGCAGGTGTACATTAAACAAGG + Intergenic
1126286340 15:47016608-47016630 CAGCAAGAATTCATTTCACTTGG + Intergenic
1127721388 15:61703642-61703664 CAGCAGGAATGAAAATTACATGG + Intergenic
1131499411 15:92947303-92947325 CAGCACCAATCCATTATACAAGG - Intronic
1132418806 15:101646242-101646264 CAGCCTGAAATCATTTTACACGG + Intronic
1202951967 15_KI270727v1_random:47690-47712 AAGAAAAAATACATTTTACACGG + Intergenic
1134805245 16:17118718-17118740 CAGTAAGAGGACATTTTACAAGG - Intronic
1138713905 16:58999677-58999699 CAGCAGTAATACGTTTGAAAAGG + Intergenic
1138873335 16:60919724-60919746 TAACTTGAATACATTTTACACGG - Intergenic
1140257178 16:73347335-73347357 CTGCAGGAATACCTGTTACGGGG - Intergenic
1140299067 16:73738821-73738843 CAGCAGGAATCCAGCTGACATGG - Intergenic
1149068076 17:52504159-52504181 CAGCAGGAAAACACTTTTCCTGG - Intergenic
1150449920 17:65258224-65258246 GGTAAGGAATACATTTTACAGGG + Intergenic
1153397525 18:4641339-4641361 CAACAGGAATTCATTTCTCATGG - Intergenic
1154381846 18:13859009-13859031 AACCAGGAATACAACTTACAAGG - Intergenic
1155357792 18:24970214-24970236 CAGCAGTCATATATTTCACAAGG + Intergenic
1156996387 18:43473097-43473119 CAGCAGAACTACATTTTGCAAGG + Intergenic
1158002369 18:52634223-52634245 CAGCAGTAATAAATTTTAATCGG + Intronic
1158450484 18:57559604-57559626 TAGCAGGAAAACAGCTTACAGGG + Intronic
1159868415 18:73733014-73733036 CAGCAGAAATAAATTATAGAAGG + Intergenic
1162361411 19:10222802-10222824 CAGGAGGAATACATTCGAAAAGG + Intronic
1202684333 1_KI270712v1_random:35507-35529 CAGCAGGGTCACATCTTACACGG + Intergenic
925504229 2:4543111-4543133 GAGCAAAAATACATCTTACATGG - Intergenic
925723861 2:6854288-6854310 CAGCAAGAATAGATTTTTAAAGG + Intronic
927031083 2:19121266-19121288 CAGCAGGGACACATTTTGAAAGG + Intergenic
929482631 2:42325056-42325078 CATCAGGAATACAGTTTTCCTGG - Intronic
929923532 2:46190924-46190946 AATCAGAAATACATTTTTCAGGG + Intergenic
931506360 2:62931732-62931754 CAGCATGGATACATTGGACAAGG - Intronic
931655098 2:64503639-64503661 TAACAGGTTTACATTTTACATGG + Intergenic
932671195 2:73739268-73739290 TAGCCAGAATACATTTTACTAGG + Intergenic
933206820 2:79515863-79515885 TATCCGGAATACATTTTACAGGG - Intronic
933844319 2:86313359-86313381 TAGCAGAAAGACATTTTAAAAGG - Intronic
934154873 2:89188616-89188638 CAGCTGTAATACATTTTTCAAGG - Intergenic
934212444 2:89994107-89994129 CAGCTGTAATACATTTTTCAAGG + Intergenic
934247385 2:90319339-90319361 CAGCAGGGTCACATCTTACACGG - Intergenic
934261940 2:91483264-91483286 CAGCAGGGTCACATCTTACACGG + Intergenic
934304980 2:91814252-91814274 CAGCAGGGTCACATCTTACACGG + Intergenic
934328277 2:92038496-92038518 CAGCAGGGTCACATCTTACACGG - Intergenic
934466657 2:94269037-94269059 CAGCAGGGTCACATCTTACACGG - Intergenic
935206430 2:100900677-100900699 CAAAAGAAAAACATTTTACAGGG - Intronic
935389225 2:102532823-102532845 CAGCAGGAAGATTTTTTCCAAGG + Exonic
937408598 2:121652892-121652914 CAACAGAAGTACATTTTTCAAGG + Intergenic
938476943 2:131624704-131624726 CAGCAGCAAAACTTTTTATATGG - Intergenic
939381648 2:141444149-141444171 CCCCAGGAATACAAGTTACAAGG - Intronic
941339761 2:164292446-164292468 CCCTAGGAATACAATTTACAAGG + Intergenic
942713388 2:178863992-178864014 CAGCAGGAATTCTATTTATAGGG - Intronic
943214150 2:185009138-185009160 AAGCAAGAATACATATCACATGG + Intergenic
943419526 2:187653455-187653477 AAGCAGAAAAACATTTTCCATGG - Intergenic
945965059 2:216178133-216178155 CAACAGGAAGACAATTTTCATGG - Intronic
946478911 2:220034713-220034735 AAGCTGGAAAACATTGTACATGG + Intergenic
947018322 2:225646248-225646270 CAGCAGGAATATTTTTTAAATGG - Intronic
948279500 2:236735994-236736016 CAGCAGTAATGCTTTTTAAAAGG + Intergenic
948885872 2:240884308-240884330 CAACAGCAATCCATTGTACATGG - Intergenic
1169331233 20:4717930-4717952 CAGCAAGAGCAAATTTTACAGGG - Intergenic
1169906524 20:10610169-10610191 CAGGAAGTATACATTTCACAGGG - Intronic
1169919639 20:10721073-10721095 CAGCAAGAACAGATTTTACAAGG - Intergenic
1174706267 20:52659318-52659340 AAGCTGGTATATATTTTACATGG - Intergenic
1175064913 20:56276510-56276532 GAGAAGAAACACATTTTACAAGG - Intergenic
1176587286 21:8599606-8599628 CAGCAGGGTCACATCTTACACGG + Intergenic
1177001665 21:15620939-15620961 CAATAGGAATTCATTTTTCATGG + Intergenic
1177755707 21:25344954-25344976 AACTAGGAATACAATTTACAAGG - Intergenic
1179505472 21:41837027-41837049 CATCAAAAATACATTTAACAGGG - Intronic
1180270117 22:10576603-10576625 CAGCAGGGTCACATCTTACACGG + Intergenic
1180280565 22:10689674-10689696 CAGCAGGGTCACATCTTACACGG - Intergenic
1180587786 22:16908211-16908233 CAGCAGGGTCACATTTTACACGG - Intergenic
1182381034 22:29888177-29888199 AAGAAAAAATACATTTTACACGG - Intronic
949189442 3:1233953-1233975 CAGTAAGAATGCATTTTAAAGGG + Intronic
949846499 3:8376294-8376316 TACCAGGAATACAACTTACAAGG + Intergenic
950733645 3:14986388-14986410 CAGCTGGAATAAATGTTAAATGG + Intronic
950740303 3:15045581-15045603 CAGCAAGAATACAGGTTACGTGG - Exonic
952660110 3:35835428-35835450 CAGCTCCATTACATTTTACAAGG + Intergenic
953828397 3:46274332-46274354 AACTAGGAATACAATTTACAAGG + Intergenic
954210160 3:49092403-49092425 CAGCAGAAATACATGCAACATGG - Intronic
957343544 3:78931653-78931675 CAGCAAGTATAGATTTTAAAAGG + Intronic
957638643 3:82819646-82819668 CAGCAGGAAATTATTTCACAAGG - Intergenic
959029112 3:101277277-101277299 CAGCAGGAATATATTAGTCAAGG - Intronic
960314005 3:116154105-116154127 CAGCAGGAAAGCACTTTACTTGG - Intronic
960773793 3:121225844-121225866 CACGAGGAACTCATTTTACAGGG - Intronic
961100301 3:124192842-124192864 CAACAGCAATTTATTTTACATGG - Intronic
964400093 3:156289801-156289823 CTGCAGGAATAAAATTTTCAAGG - Intronic
964758609 3:160112260-160112282 CAGCAGGCATAAATTTCACAAGG + Intergenic
965842628 3:172924780-172924802 CTGCAGGAATAAATTTAACCTGG + Intronic
965988016 3:174780190-174780212 TTGCAGGAATACAACTTACAAGG - Intronic
968955843 4:3718756-3718778 CACCAAGAATACAGTTTTCAGGG - Intergenic
972807508 4:42545251-42545273 CATCAGGAATACATTTAATTGGG + Intronic
974197250 4:58591614-58591636 CAGCTAGAATATATTTTAAATGG + Intergenic
974373926 4:61051820-61051842 CAGCAGCAGTACATGTTAGAAGG - Intergenic
974697771 4:65397676-65397698 AAGAAGAAACACATTTTACAAGG - Intronic
974758696 4:66247413-66247435 GAGCAGAAACACATCTTACACGG - Intergenic
975347964 4:73315483-73315505 CAAGAGGAATTCATTTTTCATGG - Intergenic
975946941 4:79718376-79718398 CAGTAGGTATACATTTAACTTGG - Intergenic
976424511 4:84886115-84886137 CAGAAAGCAAACATTTTACATGG + Intronic
979872891 4:125848556-125848578 CATTAGGAACACATTGTACAAGG + Intergenic
980926033 4:139139126-139139148 CAGCAGGCAAACATAATACAAGG - Intronic
981366506 4:143910316-143910338 CAGAAGAAGGACATTTTACATGG - Intergenic
982007087 4:151073826-151073848 AATAAGAAATACATTTTACATGG + Intergenic
983228819 4:165109874-165109896 CAGAAGGAAAACACTTAACAAGG - Intronic
984302521 4:177940772-177940794 TAGCAGGAATATTTTTTCCAAGG + Intronic
984551827 4:181170053-181170075 CACCAGGAAAACATTTAAAAAGG - Intergenic
985314764 4:188645200-188645222 CACAAGTATTACATTTTACAAGG + Intergenic
986408486 5:7451142-7451164 CTTCAGAAATACATTTTATAAGG + Intronic
986564891 5:9102390-9102412 CCACAGGAATACATTGTCCATGG + Intronic
988545045 5:32148165-32148187 GAGCAGGCCCACATTTTACATGG - Intronic
990723804 5:58730925-58730947 GAGCAAAAACACATTTTACATGG + Intronic
994003884 5:94815033-94815055 CAGCAGGAATACATGTTATGAGG + Intronic
995022692 5:107383794-107383816 CACAAGGAATAGATCTTACAAGG + Intronic
996074494 5:119174274-119174296 CAGCAAGAATAGAATTTGCAAGG + Intronic
996819312 5:127608505-127608527 CAGCAGGAATGCTTTATACACGG - Intergenic
997170926 5:131719570-131719592 CATCAAGAAAACATTTTAAAAGG - Intronic
999086694 5:148898345-148898367 CCTCAGGAATACATCATACAAGG + Intergenic
1000138121 5:158373673-158373695 ATGCATGATTACATTTTACATGG + Intergenic
1000496726 5:161993359-161993381 GAACAGGAATACATTTTCAAAGG - Intergenic
1004811103 6:19264183-19264205 AAGGAGAAATACATTTTATAAGG + Intergenic
1004872414 6:19920289-19920311 CAGCAGGGTTGCACTTTACAAGG - Intergenic
1007467541 6:42065046-42065068 CAGCCGGAAAACATTTTAATTGG - Intronic
1007917692 6:45576413-45576435 CAGCAGTAATGCTTTTCACATGG - Intronic
1009634330 6:66245418-66245440 CAGCAGGAAGACATTATTCCTGG + Intergenic
1014510570 6:122316828-122316850 CAGCAGAAATACTTATAACATGG + Intergenic
1015424949 6:133054870-133054892 CAGCAATAATACAATTTATATGG + Intergenic
1018102477 6:160453531-160453553 AAGGACAAATACATTTTACAAGG - Intergenic
1018110410 6:160531835-160531857 AAGGACAAATACATTTTACAAGG - Exonic
1018133306 6:160752933-160752955 AAGGACAAATACATTTTACAAGG + Exonic
1018322014 6:162621304-162621326 CAGCAGGAGTGCAATTTCCAAGG - Intronic
1018345001 6:162891179-162891201 CAGCAGCACTGCACTTTACATGG + Intronic
1021377921 7:19931807-19931829 GAGCAAGGACACATTTTACATGG + Intergenic
1022581922 7:31564179-31564201 CTCCAGTAATACATTTTGCAGGG + Intronic
1023276266 7:38521974-38521996 CTGTAGTAATACATTTCACAGGG - Intronic
1023697298 7:42860833-42860855 AATTAGGAATACAATTTACAAGG - Intergenic
1023790681 7:43750665-43750687 ATGCAAGAAAACATTTTACAGGG + Intergenic
1027059270 7:75072996-75073018 CAGCTGGTATACATTTTCAATGG + Intronic
1027885322 7:83897259-83897281 CACCAGGAATACATTTTATGAGG - Intergenic
1028042851 7:86078689-86078711 AAGTAGGAATACATCTAACAAGG + Intergenic
1028242482 7:88438127-88438149 CAGCAGGGATCCATGTTACAAGG - Intergenic
1028256151 7:88600031-88600053 CAGCAGCAATACAATATCCAAGG - Intergenic
1028871538 7:95775942-95775964 CAAGAGGAATAACTTTTACATGG - Intronic
1029032693 7:97485596-97485618 TAGCAGGAAGAGGTTTTACAGGG + Intergenic
1030994654 7:116344522-116344544 CGCCAGGAATACATTTCACTTGG + Intronic
1031142475 7:117959048-117959070 CAGCAGAGTTACATCTTACATGG - Intergenic
1031580836 7:123472989-123473011 CAGCAGGAAGACACATTTCAGGG + Intronic
1032692204 7:134299351-134299373 CAGCAGCAAAAGCTTTTACAGGG - Intronic
1032898358 7:136277822-136277844 CAACAGGAATCCATTTTGAAAGG + Intergenic
1033897368 7:146090501-146090523 CAGCAGGAGAAGCTTTTACAAGG - Intergenic
1034036602 7:147830202-147830224 CAACAGGAATTCATTTCTCACGG + Intronic
1035130117 7:156643681-156643703 CAGCAGGAATGCCTGCTACAGGG - Intronic
1036173089 8:6509321-6509343 CAGCAGGAAAATAAATTACAGGG - Intronic
1036483504 8:9158996-9159018 CAGGAGGAATACTTTTAAAAAGG - Intronic
1040918465 8:52588346-52588368 CAGCAGCCATACATCTTAAAAGG + Intergenic
1040995720 8:53399922-53399944 CAGTTGGATTACATTTTCCATGG - Intergenic
1041312570 8:56531571-56531593 CAAAGGGTATACATTTTACAAGG + Intergenic
1041379004 8:57232773-57232795 GAGCAGGAATACATATAGCAAGG - Intergenic
1041578702 8:59431507-59431529 CAACAAGAATACATTTTGGAAGG - Intergenic
1042845948 8:73169664-73169686 CAGCAGGAATCCAGTTTTCAAGG + Intergenic
1047775648 8:128068105-128068127 GTGCATGCATACATTTTACAGGG + Intergenic
1048803269 8:138214606-138214628 CAACAGGATTATTTTTTACATGG - Intronic
1050459337 9:5864014-5864036 CAACAGAAATGTATTTTACAAGG - Intergenic
1050529120 9:6572794-6572816 CAGCAGAAAAATAATTTACAGGG - Intronic
1051397312 9:16637922-16637944 CAGCAAGAATATATTTTGGAGGG + Intronic
1051965921 9:22829723-22829745 CAGAAGGAATACATTTTTAGTGG - Intergenic
1052574930 9:30280063-30280085 GAGAAGAAACACATTTTACAAGG + Intergenic
1052683923 9:31730572-31730594 CAGCAGGCATACATATGGCATGG + Intergenic
1053611839 9:39721705-39721727 TCACAGGCATACATTTTACATGG + Intergenic
1053943127 9:43276020-43276042 CAGCAGGGTCACATCTTACACGG - Intergenic
1054086417 9:60749450-60749472 TCACAGGCATACATTTTACATGG - Intergenic
1054241682 9:62620688-62620710 TCACAGGCATACATTTTACATGG - Intergenic
1054406691 9:64769061-64769083 CAGCAGGGTCACATCTTACATGG - Intergenic
1054440318 9:65254521-65254543 CAGCAGGGTCACATCTTACACGG - Intergenic
1054490089 9:65767417-65767439 CAGCAGGGTCACATCTTACACGG + Intergenic
1054555808 9:66655211-66655233 TCACAGGCATACATTTTACATGG - Intergenic
1056124957 9:83526981-83527003 CAACTGGAATGCATTTTGCATGG + Intronic
1057695723 9:97321858-97321880 AAGCAGGGATACAGTGTACAGGG + Intronic
1057860519 9:98637171-98637193 CAGAAGGATTAGATTTTACTTGG - Intronic
1058273952 9:103016389-103016411 CAGCAGGCATAGATCTTCCATGG - Intronic
1059516663 9:114902320-114902342 AAGCAGGAATATATTATGCAGGG + Intronic
1059920426 9:119154409-119154431 CACCAGGCATCCATTTTCCAAGG + Intronic
1202779163 9_KI270717v1_random:19477-19499 CAGCAGGGTCACATCTTACACGG - Intergenic
1203586222 Un_KI270747v1:5879-5901 CAGCAGGGTCACATCTTACACGG - Intergenic
1203617245 Un_KI270749v1:77318-77340 CAGCAGGGTCACATCTTACACGG + Intergenic
1185669159 X:1792146-1792168 CAACAGGAATATATTTGGCAGGG + Intergenic
1185715786 X:2341149-2341171 CAGCAGGAAGCCATAATACAAGG + Intronic
1186762701 X:12740007-12740029 CAGCAGGAAGATATTTTAACTGG - Intergenic
1186957660 X:14700943-14700965 CAGAAGGAATACCTTCTACTGGG - Intronic
1187653723 X:21444016-21444038 GAGCAGGAATACATTTAAAAAGG - Intronic
1191051569 X:56198510-56198532 ATGCAGGAATCCAATTTACAAGG + Intergenic
1191163095 X:57356111-57356133 TTCCAGCAATACATTTTACATGG + Intronic
1192240483 X:69324107-69324129 AAGCAGGAATACAGTATACTTGG + Intergenic
1198653448 X:138888750-138888772 CAGCAGGAAGATCTTTTAAAGGG - Intronic
1198685986 X:139228642-139228664 GAGAAGGAATAGATTATACAGGG + Intergenic
1200713258 Y:6508645-6508667 CAGCAGTAAAGCATTTGACAAGG + Intergenic
1201020664 Y:9653396-9653418 CAGCAGTAAAGCATTTGACAAGG - Intergenic
1201194437 Y:11477783-11477805 CAGCAGGGTCACATCTTACACGG - Intergenic