ID: 1091723993

View in Genome Browser
Species Human (GRCh38)
Location 12:2833235-2833257
Sequence GGGGCCAAACACATGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091723986_1091723993 11 Left 1091723986 12:2833201-2833223 CCGGGATGGCAATGTCAGTAGAG 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1091723993 12:2833235-2833257 GGGGCCAAACACATGTAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 117
1091723985_1091723993 16 Left 1091723985 12:2833196-2833218 CCACTCCGGGATGGCAATGTCAG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1091723993 12:2833235-2833257 GGGGCCAAACACATGTAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 117
1091723984_1091723993 20 Left 1091723984 12:2833192-2833214 CCTGCCACTCCGGGATGGCAATG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1091723993 12:2833235-2833257 GGGGCCAAACACATGTAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091723993 Original CRISPR GGGGCCAAACACATGTAGGA TGG Intronic
900353727 1:2249639-2249661 GGGGCCAAAAGCGTGGAGGAGGG + Intronic
902399984 1:16152397-16152419 GGGGCCAAACCTCTCTAGGAAGG + Intronic
903093570 1:20946472-20946494 GGTGCCAAACAAATGTAAAATGG + Intronic
904833699 1:33321321-33321343 GGGGCCAATCACCTGGAAGAGGG + Intergenic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
907603458 1:55792864-55792886 GGGCCCAAACCCATGTAGGATGG - Intergenic
910467786 1:87518608-87518630 GGGGTCAAACAAAATTAGGAGGG - Intergenic
910509189 1:87984747-87984769 TGGGCCACCCACAGGTAGGAAGG - Intergenic
911256042 1:95634709-95634731 GGGGCCAGCCAGATATAGGAGGG - Intergenic
917237280 1:172907856-172907878 GGGGCCTAACAGATGATGGAAGG - Intergenic
922217316 1:223530856-223530878 GTGGCCACACACAGGTAAGAGGG - Intergenic
922796965 1:228345017-228345039 GGAGCCACACACATGTTGGCTGG - Intronic
1067996087 10:51274872-51274894 GAGTACAAACACATGGAGGATGG + Intronic
1068005250 10:51385647-51385669 GGGGCCAATCCCATGAATGAGGG - Intronic
1075474371 10:122720830-122720852 GGGTGCAAACACATGTAGTTGGG + Intergenic
1079520629 11:21322232-21322254 GGGGCCCAAGACATGAAGCAGGG - Intronic
1082200183 11:49357409-49357431 GGGGCCAAACACATCTGGATTGG - Intergenic
1084654099 11:70505335-70505357 GGTGCCAAACACACGTGGGGGGG + Intronic
1086166952 11:83790398-83790420 GGGACCAATCACATGTTGGGAGG - Intronic
1088105590 11:106203596-106203618 TGAGTGAAACACATGTAGGAGGG - Intergenic
1088551195 11:111014091-111014113 GGGGTCAAAAACAGGCAGGAAGG - Intergenic
1088587639 11:111373744-111373766 GGGGACAAGCACTTGTAGGCAGG - Intronic
1089309626 11:117549105-117549127 ATGGGGAAACACATGTAGGAAGG - Intronic
1089500918 11:118930677-118930699 GGTCCCAAACACCTGGAGGAGGG + Intronic
1091723993 12:2833235-2833257 GGGGCCAAACACATGTAGGATGG + Intronic
1092977676 12:13761261-13761283 GGGGCCAAATTCAAGTAGAAAGG - Intronic
1094097597 12:26725056-26725078 GTGGCCCAAGACATGTTGGAGGG - Intronic
1108530856 13:51325700-51325722 AGGGCCACCCACATGCAGGAGGG - Intergenic
1113316225 13:109182285-109182307 CTGGACAAACACATGTAAGATGG + Intronic
1120511894 14:85425404-85425426 GGGGGAAAACACATTTGGGAAGG - Intergenic
1124205697 15:27718181-27718203 GAGGCCAACCAAAAGTAGGATGG + Intergenic
1126582589 15:50254966-50254988 GGGAGCAAACACATCCAGGAGGG - Intronic
1126785709 15:52176498-52176520 AGGGACAAACACACTTAGGAAGG + Intronic
1130546818 15:84862845-84862867 GGGCCCAAACACAAGCAGGCTGG - Exonic
1131160826 15:90103618-90103640 GGGGCCAAAGACAGGAGGGAGGG + Intergenic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1135548152 16:23379329-23379351 GGGGGCAAACATATGTAAAAAGG + Intronic
1136085813 16:27884220-27884242 GGAGCATAACACATGTGGGAGGG - Intronic
1141199669 16:81887514-81887536 GGGGCCCAAAACAGCTAGGAAGG - Intronic
1143180256 17:4980143-4980165 GGGGCCAGACATATGGAGGGGGG - Exonic
1150445822 17:65226276-65226298 GAGGCCAAACACATGTTGATTGG - Intronic
1152005348 17:77676967-77676989 GGGGGCAAAGACATCTAGGCTGG - Intergenic
1158412754 18:57222204-57222226 TGGGCTCAACACATGTTGGAAGG + Intergenic
1159106215 18:64003816-64003838 GGGGCCACCCACATTAAGGAGGG + Intronic
1163028705 19:14529411-14529433 GGGGCGGAACGCCTGTAGGAGGG - Intronic
1163144622 19:15372176-15372198 TGGGCCAGACAGATGTAGGATGG - Intronic
1164150064 19:22542806-22542828 GGGGCCACAGCCATGTTGGATGG - Intergenic
1164206068 19:23059826-23059848 TGGGCCAAACACCTGAAAGATGG - Intergenic
1166658154 19:44627286-44627308 GGGGCCAGAGACCTGGAGGATGG + Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
933647179 2:84822253-84822275 GTGGCCAAAGACATGAAAGAGGG - Intronic
935459086 2:103307485-103307507 GGGTCCTTACACATGGAGGAGGG - Intergenic
935846332 2:107169754-107169776 GGGGACAAGCACATGTAGGGAGG + Intergenic
936620221 2:114088463-114088485 GGGACAAAACACAGCTAGGATGG - Intergenic
937390516 2:121481994-121482016 AGGGCCAAACAAATTTAGAAAGG + Intronic
937738769 2:125323029-125323051 GGAGAAAAAGACATGTAGGATGG + Intergenic
939141348 2:138358233-138358255 GGGGTCAAATACCTGGAGGACGG - Intergenic
942687096 2:178544419-178544441 TGGACCAAACCCATGTACGATGG - Exonic
1169968380 20:11242383-11242405 GGAGCCAAACACATTTGGGATGG - Intergenic
1172222765 20:33285027-33285049 GGGGCCCAAGACATGAAGGTTGG - Intronic
1173121440 20:40293434-40293456 AGGGCCAAACACAAGTTGGTTGG + Intergenic
1176173426 20:63706754-63706776 GAGGCGAAACACATCAAGGAGGG + Intronic
1176661232 21:9636937-9636959 GCGGGCAAAGACATGTGGGAGGG - Intergenic
1177225654 21:18251113-18251135 GGGGCCAAACTCATGAAGTCAGG - Intronic
1178638830 21:34329726-34329748 GGCACCAAGCAGATGTAGGAGGG - Intergenic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1179921889 21:44512021-44512043 GGGCCCAAAGGCATGGAGGACGG + Intronic
1184204172 22:42990527-42990549 GGGGCAAAACACCTGGAGGGAGG + Intronic
1184563464 22:45276896-45276918 GGGGCCAATTACATGTGTGAGGG + Intergenic
1184925886 22:47637015-47637037 GGGGCCAAACCCATTCATGACGG - Intergenic
950190484 3:10973097-10973119 GGGTGCAAACACATATAGGCTGG + Intergenic
953664919 3:44918538-44918560 GTGGCCAAAAATATTTAGGAGGG - Intronic
957112266 3:75978863-75978885 GGAGCGAAGTACATGTAGGATGG + Intronic
957289701 3:78263412-78263434 GGTGCCAAAAACATGCAGTAGGG - Intergenic
957414803 3:79887708-79887730 GAGAACAAACAGATGTAGGAAGG - Intergenic
957885544 3:86282559-86282581 GGGACCAGGCACATGTAGCAGGG - Intergenic
962899294 3:139744754-139744776 GGGGCAAAGCACATGTATGAGGG + Intergenic
964633969 3:158841277-158841299 GAGGCCACACACCAGTAGGATGG + Intergenic
968566585 4:1316670-1316692 GGAGCCACACACATGTGGGTGGG - Intronic
970134057 4:12902920-12902942 GTGGCCACACACATGTATGATGG + Intergenic
970513801 4:16807082-16807104 GGCCACAAACACATGTAAGAGGG - Intronic
971406693 4:26328214-26328236 GGGTCCTAAGACATGTAGGAGGG + Intronic
971919432 4:32917651-32917673 GGGCACAAACACATTTAGAAAGG + Intergenic
973177864 4:47230287-47230309 GGAGCCAAAGGCATCTAGGAGGG + Intronic
975173464 4:71259744-71259766 GAGGCCAAAACCATGTAGGCTGG - Intronic
977444374 4:97110505-97110527 GGGGGCAAACACAAGTTGGTGGG + Intergenic
977766868 4:100808948-100808970 GGGGACAAACTCATATAGGGAGG + Intronic
979928189 4:126594485-126594507 CAGGACAAACTCATGTAGGATGG - Intergenic
984475909 4:180234835-180234857 GTGGCCAAACACATGAAAAATGG - Intergenic
985241389 4:187934184-187934206 GGGGCCAAAAACAGGAAAGACGG + Intergenic
985397335 4:189557907-189557929 GAGACCACACACATGTAAGAGGG - Intergenic
986269228 5:6216901-6216923 GTGGCCAGAAGCATGTAGGAGGG + Intergenic
989007203 5:36828197-36828219 GGAGGCAAAGACATCTAGGAAGG + Intergenic
990734368 5:58844089-58844111 GGAGCAAAACACACGTAGTATGG + Intronic
991269856 5:64767251-64767273 GGCACCAAACACATACAGGATGG - Intronic
1001534495 5:172489106-172489128 GGGCCCTACCACATGTAAGATGG + Intergenic
1002856470 6:1042504-1042526 TTGGGCAAACAAATGTAGGAAGG + Intergenic
1005975138 6:30792265-30792287 GGGTTCAAACCCAAGTAGGAAGG - Intergenic
1005996125 6:30932423-30932445 GGGCCCAGACACCTGCAGGAGGG - Intergenic
1011237227 6:85230815-85230837 TGTGCCAAACATATGTAGGCAGG - Intergenic
1016164852 6:140928263-140928285 GGGGCCAATCAGAGGTTGGAGGG - Intergenic
1017788014 6:157772435-157772457 GGGGCCAAACACAGGGATGAAGG + Intronic
1019968553 7:4521660-4521682 GAGGCCATACTCAAGTAGGATGG + Intergenic
1022122318 7:27321332-27321354 GGGGCCAACATCATGTATGATGG + Intergenic
1022889442 7:34681591-34681613 AGTGCCAAAGACATGTAGGGTGG + Intronic
1028687064 7:93602217-93602239 GGAGGCAAACACAGGTAGGCTGG - Intronic
1030438285 7:109552645-109552667 GGGCCCAAATGCCTGTAGGAAGG - Intergenic
1031250668 7:119376233-119376255 AGGCCCAAACACATTAAGGAGGG + Intergenic
1034695650 7:153050999-153051021 GGAGTCAGACAGATGTAGGATGG + Intergenic
1036619590 8:10415762-10415784 GTGACCAAACACATGGAGGCTGG - Intronic
1037844758 8:22273207-22273229 GGGGCCTAAAACCTATAGGAAGG - Intergenic
1044704315 8:94993938-94993960 GGAGCCAAATTCATGTGGGAAGG + Intronic
1050233658 9:3555659-3555681 GTGGCCACCCACATGGAGGATGG + Intergenic
1052904416 9:33820955-33820977 TGGGCCATATAGATGTAGGATGG + Intronic
1053011394 9:34635790-34635812 GGGGCCAAACACATGGATGGTGG - Exonic
1055474334 9:76646605-76646627 GGGTCCTAACCCATGTAGGAAGG - Intronic
1061869933 9:133515174-133515196 GGTGCCCAACACCTGGAGGAGGG - Intronic
1062158559 9:135067359-135067381 GGGGGGGAACACATGCAGGAGGG + Intergenic
1062616173 9:137396986-137397008 GGGGACACACACCTGCAGGAGGG + Intronic
1203638799 Un_KI270750v1:138781-138803 GCGGGCAAAGACATGTGGGAGGG - Intergenic
1188869843 X:35359858-35359880 GGGGCAAAACACCTAGAGGAAGG - Intergenic
1188914486 X:35892667-35892689 TTGGGGAAACACATGTAGGAGGG + Intergenic
1190160497 X:48028445-48028467 GGGGCCCCCCACATCTAGGAGGG + Intronic
1192783385 X:74316145-74316167 GGAGCCAAGCACATGCAGGTTGG - Intergenic
1197748637 X:129950246-129950268 GGGACCAAAGTCTTGTAGGAAGG - Intergenic
1199029931 X:142985634-142985656 GGGGCCTATCAAATGTTGGAAGG - Intergenic
1199151820 X:144496236-144496258 GTGGCCCAGCACACGTAGGATGG + Intergenic
1201559371 Y:15300106-15300128 GTAGCCAAAGATATGTAGGAGGG - Intergenic