ID: 1091724059

View in Genome Browser
Species Human (GRCh38)
Location 12:2833572-2833594
Sequence CCAACCTGTCAGTACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091724053_1091724059 22 Left 1091724053 12:2833527-2833549 CCCGGGGAGAAGCAGTTGGTGGA 0: 1
1: 0
2: 1
3: 41
4: 242
Right 1091724059 12:2833572-2833594 CCAACCTGTCAGTACAGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 120
1091724056_1091724059 -8 Left 1091724056 12:2833557-2833579 CCTGCAGACATGCTTCCAACCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1091724059 12:2833572-2833594 CCAACCTGTCAGTACAGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 120
1091724054_1091724059 21 Left 1091724054 12:2833528-2833550 CCGGGGAGAAGCAGTTGGTGGAG 0: 1
1: 0
2: 2
3: 32
4: 342
Right 1091724059 12:2833572-2833594 CCAACCTGTCAGTACAGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091724059 Original CRISPR CCAACCTGTCAGTACAGGCC TGG Intronic
900192878 1:1358839-1358861 CCAACCCTTCACCACAGGCCCGG - Intronic
900606054 1:3524035-3524057 CCACCCTCTCAGGCCAGGCCTGG + Intronic
901528468 1:9838935-9838957 TCAACATGTCAGCACGGGCCGGG - Intergenic
902326332 1:15703189-15703211 CGAACCTGCCAGGCCAGGCCGGG + Intronic
905012706 1:34758160-34758182 CCAACCTGCCAGACCAGTCCAGG - Exonic
905456276 1:38090312-38090334 CCAGCCTCTCTGAACAGGCCAGG - Intergenic
906315856 1:44786122-44786144 CCAACCTGGCGGCCCAGGCCCGG - Exonic
908830082 1:68170100-68170122 CCAAGCACTCAGCACAGGCCTGG + Intronic
919839941 1:201601623-201601645 CCAACGTGTGAGGACAGGGCAGG + Intergenic
920115119 1:203615358-203615380 CCAAGCTGTAATTACAGGCATGG - Intergenic
922807139 1:228396191-228396213 CAATCCTGTCAGTAGAGGGCGGG + Intronic
1062902369 10:1156076-1156098 TGATCCTGTCAGGACAGGCCTGG + Intergenic
1064827594 10:19423030-19423052 CCAACCTGACAGCATAGGACAGG - Intronic
1067281258 10:44874984-44875006 CCCACCTGTCAGTGGAAGCCTGG + Intergenic
1070512635 10:77175560-77175582 CCTACCTGTCAGTACAAAGCAGG + Intronic
1073015417 10:100395144-100395166 CCAGCCTGAGAGTTCAGGCCTGG + Intergenic
1077376847 11:2209272-2209294 CCACCCTGTCAGAGCAGGGCAGG + Intergenic
1077393123 11:2308911-2308933 CCACCCGGTCAGCACAAGCCTGG - Intronic
1083230072 11:61311717-61311739 GCAAGCTTTCTGTACAGGCCAGG - Intronic
1083340730 11:61956928-61956950 CCAACCTGTCAATGAAGGCGTGG + Exonic
1083430290 11:62610890-62610912 CCAACCTGTTAGTGCGGTCCGGG - Exonic
1084530954 11:69727488-69727510 CCAGCCTGTCTGTCCAGGCCAGG + Intergenic
1084634641 11:70382959-70382981 AAAACCACTCAGTACAGGCCGGG - Intronic
1089835469 11:121366524-121366546 GAATCCTGTCAGTACAAGCCTGG + Intergenic
1090021004 11:123128358-123128380 CCATGCTGGCATTACAGGCCTGG - Intronic
1091724059 12:2833572-2833594 CCAACCTGTCAGTACAGGCCTGG + Intronic
1099959933 12:89387264-89387286 CCACACTGTGAGGACAGGCCTGG - Intergenic
1104414014 12:128582934-128582956 CCAAAGTGTCTGTACAGGGCTGG - Intronic
1107010893 13:35669918-35669940 CCACCCTGTCTGTTCATGCCTGG - Intronic
1109424308 13:62151178-62151200 ACAACATTTCAGTAAAGGCCAGG - Intergenic
1110475352 13:75907242-75907264 CCCACCTGTCAGTAGGGACCGGG + Intergenic
1113090138 13:106609340-106609362 CCATCATGTCAGCACAAGCCTGG - Intergenic
1115961871 14:38843193-38843215 TCAACTTGGCAGCACAGGCCAGG + Intergenic
1119591513 14:75892646-75892668 CCAACATGTCAGTAGTGGCAAGG + Intronic
1121324261 14:93010770-93010792 CGAGCCACTCAGTACAGGCCCGG - Intronic
1122519368 14:102332612-102332634 CAAAACTGTCAGTTGAGGCCGGG + Intronic
1131913326 15:97233301-97233323 CCAACCTGCCCATTCAGGCCAGG - Intergenic
1135937806 16:26795889-26795911 CCAACCTCACAGTACAGTCCTGG - Intergenic
1140377970 16:74460450-74460472 TGAAACTGTCAGTTCAGGCCGGG - Intronic
1146648786 17:34593442-34593464 CCAACAGGACAGTACAGGGCTGG + Intronic
1147561065 17:41509533-41509555 CCAACCTGTCACCCCAGGCCGGG + Intergenic
1148746739 17:49922539-49922561 CCATCCTCTCAGAAAAGGCCGGG + Intergenic
1148757649 17:49982353-49982375 GCCACCTGTCAGTAAAGCCCTGG + Intergenic
1148838336 17:50478494-50478516 CCAACCGGCCAGGACAGGCAAGG - Intergenic
1151510342 17:74555081-74555103 TCAACCTGTCAGCACAGCCAGGG + Intergenic
1151554775 17:74841162-74841184 CCAACTTGTCAGGACAGCCAGGG + Intergenic
1154218029 18:12429763-12429785 GCGCCCTGTCAGGACAGGCCTGG - Intronic
1155326185 18:24667268-24667290 CCAACCTGGGAGTAAGGGCCAGG - Intergenic
1157496612 18:48161518-48161540 CGAACCAGTCTGAACAGGCCGGG - Intronic
1159016485 18:63105245-63105267 CCTACCTCTCAGGACCGGCCTGG + Intergenic
1161673583 19:5628585-5628607 CCAACCTGTAATTGAAGGCCTGG + Intronic
1161979838 19:7624621-7624643 CCACCCTGGCAGTGCAGGGCAGG - Intronic
1162783012 19:13016854-13016876 CGAAGCTGTCAGTACCTGCCCGG - Intronic
1166553800 19:43684708-43684730 ACCACCTGTCAATACAGGCCAGG - Intergenic
926968653 2:18444270-18444292 CCAACCAGTCCTTAGAGGCCAGG - Intergenic
927497725 2:23562135-23562157 CCACCCTGTCACCACAGGTCCGG + Exonic
927917782 2:26947809-26947831 CCAACCAGACAGCACAGGGCAGG + Exonic
931000392 2:57773782-57773804 GCATCTTGTCAGTAGAGGCCAGG + Intergenic
934119025 2:88822560-88822582 CCTACCTTTCACAACAGGCCAGG + Intergenic
934736895 2:96694154-96694176 CCACCCTGTCAGGAAATGCCTGG + Intergenic
934755727 2:96823410-96823432 CAAACCTGTCAGGCCAGGCCAGG - Intronic
936162476 2:110094912-110094934 CCTACCTTTCACAACAGGCCAGG + Intronic
936182184 2:110276454-110276476 CCTACCTTTCACAACAGGCCAGG - Intergenic
937907866 2:127061118-127061140 CCCACCTGTGCCTACAGGCCAGG + Intronic
938064076 2:128271745-128271767 CCCACCCGTCACTGCAGGCCAGG - Intronic
940748497 2:157597354-157597376 CCAACCTGCAAGTCCAGGCAAGG - Intronic
943889706 2:193271278-193271300 CCAACCTGTTAGAACAGCCATGG - Intergenic
944632814 2:201643603-201643625 CCAACGAGTCTGTGCAGGCCTGG + Intergenic
948502744 2:238407020-238407042 CCAACCAGTGAGGACAGGCGGGG + Intergenic
1169343551 20:4813372-4813394 CCAAGCTGTCTGCACAGGCCTGG + Intronic
1174606960 20:51768215-51768237 CCAACCTGTCAGGCCCGGCCAGG + Intronic
1176523022 21:7838841-7838863 GCAACATGTCAGTACATTCCTGG + Intergenic
1178657042 21:34468853-34468875 GCAACATGTCAGTACATTCCTGG + Intergenic
1183999498 22:41662591-41662613 TCCACCTGTCAATACAGGTCTGG - Intronic
1185165863 22:49261781-49261803 CCATCCTGTCAGTCCAGGCTGGG - Intergenic
1185330251 22:50249164-50249186 CCAACCTGGCAGGACATCCCAGG + Exonic
950440376 3:13006920-13006942 CAAACATGTCAGGAGAGGCCAGG - Intronic
951698814 3:25473617-25473639 CAAACTTGTCAGTACAGTCAAGG + Intronic
954105033 3:48405379-48405401 CCAACATGCAAGTGCAGGCCTGG - Intronic
956609907 3:71112018-71112040 GCATCCAGTAAGTACAGGCCAGG - Intronic
963827392 3:149970520-149970542 CCAGCCTGTCAGCGCAGCCCCGG + Intronic
963900309 3:150727083-150727105 CCAACCTGGCCCTACAGGGCAGG + Intergenic
967188828 3:186967857-186967879 CCACCGTGGCAGTAGAGGCCAGG + Intronic
968121497 3:196129024-196129046 CCAACCGCTCAGTTCAGACCAGG - Intergenic
969317507 4:6390959-6390981 CCAACCTCTGACCACAGGCCTGG - Intronic
971212441 4:24632189-24632211 CCCACCTGTCAACACAGGACAGG + Intergenic
971219019 4:24688051-24688073 GCAATTTGTCGGTACAGGCCGGG + Intergenic
971444059 4:26723468-26723490 CCACCCTGTAAGCACTGGCCTGG - Intronic
972079753 4:35136365-35136387 CCAACCTGTGAGAACAGCCCTGG - Intergenic
974697435 4:65394392-65394414 ACAACCAGTCAGTAAGGGCCTGG - Intronic
975902909 4:79174034-79174056 CTGACCTGTCAGTTCAGGCCTGG + Intergenic
980955617 4:139426197-139426219 CCAACCTGTCTGTCCATTCCTGG + Intergenic
982321846 4:154085013-154085035 CCAGGCTGTCAGTTCTGGCCAGG + Intergenic
985763618 5:1764919-1764941 CCAACCAGCCAGCACAGGGCAGG - Intergenic
991099401 5:62776103-62776125 CCACCCTGACTCTACAGGCCGGG - Intergenic
993968387 5:94386971-94386993 CCCAACTGCCAGTGCAGGCCTGG + Intronic
995382122 5:111547249-111547271 CCAACCTGTCAGGACAGAGCAGG - Intergenic
995694896 5:114867510-114867532 GCAACTTGTCAGTACACCCCTGG + Intergenic
995913544 5:117216082-117216104 AAAACCTGTCAGTCCAGGCCGGG + Intergenic
997426959 5:133809817-133809839 CCAGCCTGACAGTCCAGACCAGG + Intergenic
997759579 5:136432368-136432390 CCTACCTCTCTGTGCAGGCCTGG + Intergenic
998846086 5:146311340-146311362 TCAACCTGAAAGTACAGTCCTGG - Intronic
1003019867 6:2500451-2500473 CCCACCTTTCAGGCCAGGCCTGG - Intergenic
1003080694 6:3018591-3018613 CCCACCTGACAGGGCAGGCCTGG + Intronic
1003755900 6:9119765-9119787 CCTTCCTGTCAGTACATGGCAGG - Intergenic
1004774676 6:18830271-18830293 CCAACTTATCAATAGAGGCCAGG + Intergenic
1007543655 6:42673480-42673502 CCAAGATGCCAGTGCAGGCCGGG - Intronic
1011496990 6:87946597-87946619 GCATCCAGTCAGTAGAGGCCAGG - Intergenic
1011546008 6:88481995-88482017 CCATCCTGTCAGCAGAGGGCAGG - Intergenic
1017753882 6:157513363-157513385 CACACCTGTCAGGACAGGCAGGG + Intronic
1018986757 6:168643578-168643600 CCACCCTGCCAGGACAGGCGTGG + Intronic
1019496146 7:1341499-1341521 CCTGCCCGTCAGTGCAGGCCGGG - Intergenic
1021359803 7:19697745-19697767 CCACACAGTCAGTACTGGCCTGG + Exonic
1023484425 7:40669229-40669251 CTAACCTGCCAGTACAGGGGTGG + Intronic
1023600280 7:41875625-41875647 CCAACCTGTCAGGGCAGACACGG + Intergenic
1024960375 7:54968249-54968271 GGAAGCTGTCAGTACAGCCCAGG + Intergenic
1025004242 7:55342762-55342784 CCATCCTGCCAGGCCAGGCCTGG - Intergenic
1027476852 7:78642841-78642863 GCAGTCTGGCAGTACAGGCCAGG + Intronic
1030867692 7:114719860-114719882 CAAACCTATCATTAAAGGCCGGG + Intergenic
1035288066 7:157818955-157818977 GCCACCTCTCAGGACAGGCCAGG + Intronic
1038147484 8:24912761-24912783 CCAACCTGACAGGCCAGGCTGGG + Intergenic
1041741593 8:61163088-61163110 CCAACCTATGAGTCCAGGCAGGG - Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1042102336 8:65286770-65286792 CCAACCTGACCGTTCAGGCCTGG + Intergenic
1042949062 8:74182316-74182338 CCACCCTGTTAGTCCAGGACTGG + Intergenic
1043361954 8:79483288-79483310 ACAACCTGGCAGTAAAGCCCTGG - Intergenic
1053433450 9:38059189-38059211 CCAGCCTGTAAGTCAAGGCCCGG + Intronic
1056405015 9:86265272-86265294 CCACCCTGACACCACAGGCCGGG - Exonic
1059424893 9:114214859-114214881 CCAACAAGCCAGGACAGGCCAGG - Intronic
1060941147 9:127543545-127543567 CTAACTTGTCACCACAGGCCTGG + Intronic
1062247120 9:135574958-135574980 CCAGCCTGGCAGTGCAAGCCCGG + Intergenic
1062255391 9:135618415-135618437 CCAAACTCCCAGAACAGGCCTGG - Intergenic
1189290675 X:39883445-39883467 CCTAACTATCAGCACAGGCCTGG - Intergenic
1190320452 X:49176669-49176691 CCACCCTGTCAATACAGGGCTGG - Intronic
1199695465 X:150340595-150340617 CCCATTTGTCAGGACAGGCCTGG + Intergenic