ID: 1091725758

View in Genome Browser
Species Human (GRCh38)
Location 12:2845504-2845526
Sequence CTTGGAAAGGGGGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1932
Summary {0: 1, 1: 1, 2: 10, 3: 135, 4: 1785}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091725746_1091725758 30 Left 1091725746 12:2845451-2845473 CCAGCAGCTCAGGAACTTGCGTC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG 0: 1
1: 1
2: 10
3: 135
4: 1785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091725758 Original CRISPR CTTGGAAAGGGGGAGGTGGA GGG Intronic
900015077 1:142767-142789 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900016680 1:155589-155611 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900045344 1:501376-501398 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900046941 1:514181-514203 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900067541 1:743106-743128 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900069144 1:755899-755921 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900369595 1:2325589-2325611 CTTTGGGAGGCGGAGGTGGAAGG - Intronic
900385589 1:2409172-2409194 CTTGGGCTGGGGGAGGTGGCGGG - Intronic
900622608 1:3594183-3594205 CTTTGGAAGGCCGAGGTGGAAGG + Intronic
900828871 1:4949639-4949661 CATGGAAATGGGAAGCTGGAAGG - Intergenic
901232782 1:7650522-7650544 CTGGAAAAGGCGGGGGTGGAGGG - Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901398889 1:9002588-9002610 CTTGGTGAGGGGGATGTGGCAGG - Intergenic
901601633 1:10427412-10427434 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
901657645 1:10779485-10779507 CCTGGCAAGGGGGAGGGGGCGGG - Intronic
901684837 1:10938080-10938102 CTTTGAGAGGCCGAGGTGGATGG + Intergenic
901711076 1:11115588-11115610 CTTGCAGAAGTGGAGGTGGAGGG - Intronic
901732524 1:11290512-11290534 CTTTGAGTAGGGGAGGTGGATGG - Intronic
901768374 1:11518119-11518141 GTTGGGAAGATGGAGGTGGATGG + Intronic
901941517 1:12665982-12666004 CTTGGAAAAGGGCAGGGGAATGG - Exonic
902114810 1:14112628-14112650 CATGGAAAAAGGGAGATGGATGG + Intergenic
902138958 1:14335444-14335466 CTTTGGAAGGCTGAGGTGGACGG - Intergenic
902259483 1:15214092-15214114 CTTGGGGAGGCCGAGGTGGATGG - Intronic
902385050 1:16071737-16071759 CTGGCAGAGGGGGCGGTGGAGGG + Intronic
902435304 1:16394709-16394731 CTTTGAGAGGCCGAGGTGGACGG + Intronic
902490799 1:16779284-16779306 CAAGGAGAGGGGGAGGAGGAAGG + Intronic
902509980 1:16961150-16961172 CAGGGAAGGGGGGAGGTGGGCGG + Intronic
902837818 1:19058183-19058205 GCTGGAAAGGGGGAGGGGGAGGG + Intergenic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903099494 1:21016440-21016462 CTTTGAGAGGTGGAGGTGGAAGG + Intronic
903164366 1:21510037-21510059 CTTGGAATGGGGGGCGTGGCGGG + Intronic
903272813 1:22202191-22202213 CTTGGGGAGGCTGAGGTGGATGG + Intergenic
903290527 1:22311119-22311141 CTTTGGAAGGGCGAGGTGGGTGG + Intergenic
903412208 1:23154429-23154451 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
903506775 1:23841751-23841773 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
903765953 1:25734370-25734392 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
903850904 1:26305492-26305514 CTTGGAAAAGGGGTGGGGGCTGG - Intronic
903902341 1:26657054-26657076 CTTTGAGAGGCCGAGGTGGATGG - Intergenic
904165187 1:28549943-28549965 CTTGGAAAGGCTGAGGCAGATGG + Intergenic
904282981 1:29434313-29434335 CCTGGGAATGGGGGGGTGGAAGG - Intergenic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904414300 1:30346951-30346973 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
904549736 1:31305683-31305705 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
904797526 1:33068456-33068478 CTCGGAGAGGGGGATGTGGCAGG - Intronic
905025127 1:34844582-34844604 CTTGGACAGTGGAGGGTGGAGGG - Intronic
905040122 1:34948705-34948727 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
905123237 1:35698747-35698769 CCTGGAAAGATGTAGGTGGATGG - Intergenic
905464152 1:38140075-38140097 CATGGAATGGGGGAGCTGCAGGG + Intergenic
905616946 1:39408283-39408305 CTTGAGAAGGGGGAGAGGGAAGG + Intronic
905622735 1:39462868-39462890 CTTGGTAAGGGAGAGGTGCTGGG + Intronic
905762615 1:40572778-40572800 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
906334201 1:44914402-44914424 CTTTGAGAGGCCGAGGTGGACGG - Intronic
906402352 1:45514254-45514276 CTCGGAGAGGGGGATGTGGCAGG - Intronic
906564528 1:46789295-46789317 CTTGGAGAGGGGGATGTGGCAGG - Intronic
906991494 1:50744186-50744208 CTTGGATAGTGGCAGGTGCATGG - Intronic
906998747 1:50827582-50827604 CTCGGAGAGGGGGATGTGGCAGG - Intronic
907006876 1:50923173-50923195 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907128447 1:52073607-52073629 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
907436701 1:54454235-54454257 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
907479386 1:54734313-54734335 CTTTGAAAGGCGGAGGTGAGTGG - Intronic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
908543153 1:65140545-65140567 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
909023757 1:70460625-70460647 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909103426 1:71379309-71379331 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
909527147 1:76638070-76638092 CTTTGGGAGGGTGAGGTGGATGG - Intergenic
909773118 1:79451042-79451064 CTTTGAAAGGCTGAGGTGGATGG + Intergenic
909830412 1:80182201-80182223 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910220177 1:84881738-84881760 ATTGGAAAGGGGGAAGAGGAGGG + Intronic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910779571 1:90914433-90914455 CTTTGAGAGGCGGAGGCGGAAGG + Intergenic
910864044 1:91771459-91771481 CTTTGGAAGGCCGAGGTGGATGG + Intronic
910891835 1:92026872-92026894 GGTGGAAAGCGGGAGGGGGAGGG + Intergenic
910954035 1:92682053-92682075 CTTGGAGAGGCTGAGGTGGGAGG - Intronic
910984743 1:92994572-92994594 CTTTGAGAGGCCGAGGTGGATGG + Intergenic
911089781 1:94009339-94009361 TTTGGAAAGGTGGAGTTGGCAGG - Intronic
911602227 1:99857828-99857850 CGTGGGGAGGGGGAGGGGGAGGG + Intronic
911828863 1:102524773-102524795 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912301104 1:108518196-108518218 CTTGGAGAGGGGGATGTGTCAGG - Intergenic
912340176 1:108906895-108906917 CTTTGAAAGGCTGAGGTGGCAGG - Intronic
912345531 1:108960023-108960045 CTTGGAGAGGCTGAGGTGGGAGG + Intronic
912504532 1:110147159-110147181 AGTGGAAAGGTGGAGTTGGAGGG + Intergenic
912554271 1:110504760-110504782 CTTTGAGAGGCCGAGGTGGATGG + Intergenic
912626019 1:111204769-111204791 GTTGCAAAGGGAGAGGTGGAGGG - Intronic
912802553 1:112729359-112729381 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
912942650 1:114058904-114058926 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
912954475 1:114144925-114144947 CTTGGGAAGGGGGTGGTGGTAGG - Intronic
912965885 1:114237342-114237364 GCTGGGAAGGGTGAGGTGGAAGG - Intergenic
912966922 1:114243681-114243703 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
913378372 1:118181870-118181892 CTTTGAAAGCCCGAGGTGGAAGG + Intronic
914097440 1:144555750-144555772 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
914312711 1:146481194-146481216 CTTTGGAAGGATGAGGTGGACGG + Intergenic
914444002 1:147734036-147734058 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
914501637 1:148252144-148252166 CTTTGGAAGGATGAGGTGGACGG - Intergenic
914677555 1:149916441-149916463 CTTGGAGAGGTGGAGGTTAAAGG + Intronic
914712743 1:150230120-150230142 CTTGGAGAGGCAGAGGTGGGAGG - Intronic
914716235 1:150257234-150257256 CGTGGGAAGGGGGTGGTGGCAGG + Exonic
914765648 1:150635663-150635685 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
915103626 1:153518251-153518273 CTTCAAAAGGGCCAGGTGGATGG + Intergenic
915478248 1:156167119-156167141 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
915992817 1:160533249-160533271 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
916034991 1:160913905-160913927 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
916044533 1:160989542-160989564 CTTTGGAAGGCTGAGGTGGAAGG - Intergenic
916092163 1:161315901-161315923 CTCGGAGAGGGGGATGTGGCAGG + Intronic
916103570 1:161413400-161413422 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
916127556 1:161584785-161584807 CTTGGAGAGGCCGAGGTGGGTGG + Intronic
916137474 1:161666589-161666611 CTTGGAGAGGCCGAGGTGGGTGG + Intronic
916281422 1:163055420-163055442 CTTGTAAAGGGAGAGAAGGAAGG + Intergenic
916288974 1:163142775-163142797 CTTGCAAAGGGAGAAGAGGAAGG + Intronic
916289135 1:163144629-163144651 CGTGGAGAGGAGGAGGAGGAGGG + Intronic
916468196 1:165093350-165093372 CTTGGTGAGGGGGATGTGGCAGG - Intergenic
916518056 1:165538480-165538502 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
916692351 1:167202437-167202459 CTTGACAGAGGGGAGGTGGATGG - Intergenic
916756004 1:167771042-167771064 CTCGGAGAGGGGGATGTGGCAGG + Intronic
916759741 1:167805687-167805709 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
916809828 1:168295747-168295769 CTGGGAAACGGGGTGGTGGGGGG + Intronic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917196917 1:172476452-172476474 CTTGGGAGGTGGGAGGTGGTGGG + Intergenic
917439971 1:175059431-175059453 CTTTGAGAGGCCGAGGTGGATGG + Intergenic
917506685 1:175633785-175633807 CTCAGAATGGGAGAGGTGGAGGG + Intronic
917555648 1:176085226-176085248 ATTGAAAATGGGGAGGTGTAAGG - Intronic
917591268 1:176479511-176479533 CTTGGGAAGGGAGAGGTTTAGGG + Intronic
917992623 1:180397807-180397829 CTTTGAAAGGCCGAGGTGGGTGG + Intronic
918032485 1:180828951-180828973 CTTTGAGAGGCGGAGGTGGGAGG + Intronic
918295437 1:183151970-183151992 CTTGGAGAGGCTGAGGTGGGTGG + Intergenic
918327942 1:183427932-183427954 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
918334497 1:183495068-183495090 CTTTGAGAGGCCGAGGTGGATGG - Intronic
918570294 1:185982682-185982704 CTTTGAGAGGCCGAGGTGGATGG - Intronic
918702078 1:187617674-187617696 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
919016169 1:192039438-192039460 CTTTGAGAGGCTGAGGTGGACGG - Intergenic
919064918 1:192682630-192682652 ATTGGCAAGTAGGAGGTGGAAGG - Intergenic
919326074 1:196108934-196108956 CTCAGAAAGGGGGATGTGGCAGG + Intergenic
919639629 1:200035802-200035824 GTCGGAAAGAAGGAGGTGGAGGG + Intronic
919706240 1:200678598-200678620 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
919877962 1:201884485-201884507 GTTGGAAAGGGTCAGCTGGAGGG + Intergenic
919894643 1:202001830-202001852 CTCGGAAAGATGGTGGTGGATGG + Intronic
920144075 1:203842597-203842619 CGGGGAGAGGGGGAGGGGGAGGG + Intronic
920257470 1:204665381-204665403 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
920291965 1:204929562-204929584 CTTCTAAAAGGGGAGGTGGGAGG + Intronic
920292037 1:204929951-204929973 CTTGGCATGGGAGAGATGGAAGG + Intronic
920629226 1:207635305-207635327 CTCGGAGAGGGGGATGTGGCAGG + Intronic
920722733 1:208402700-208402722 ATTGGTAAGGAGGTGGTGGATGG - Intergenic
920778570 1:208965516-208965538 CTTGGAAAGGGAGAATTGAAAGG - Intergenic
921024847 1:211268618-211268640 CTTTGAGAGGCCGAGGTGGACGG - Intronic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921133613 1:212240816-212240838 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
921644994 1:217604105-217604127 CTTTGGGAGGGCGAGGTGGAAGG + Intronic
921984559 1:221298232-221298254 CTTTGAGAGGCCGAGGTGGACGG - Intergenic
922102144 1:222485879-222485901 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922104505 1:222501291-222501313 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922263227 1:223960990-223961012 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922264823 1:223973804-223973826 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922444923 1:225689102-225689124 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
922479740 1:225931240-225931262 CTTGGGGAGAGGGAGGTGGGAGG + Intergenic
922507166 1:226133300-226133322 CCAGGAAGGGAGGAGGTGGAGGG - Intergenic
922509817 1:226155172-226155194 CTTTGAGAGGCGGAGGTGGGTGG + Intronic
922656882 1:227392878-227392900 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
922747592 1:228053774-228053796 CCTGGAAAGAGAGAGGAGGATGG + Intronic
922843748 1:228666201-228666223 CTTGGAAAGGCTAAGGTGGATGG - Intergenic
923132429 1:231088163-231088185 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
923154404 1:231264889-231264911 CTTGTAAAGGGAGTGGTGCATGG + Intronic
923174724 1:231453564-231453586 CGTGGAAAGTGGGAGAGGGAGGG - Intergenic
923529645 1:234803251-234803273 CAAGGAGAGGGGGAGGAGGAAGG - Intergenic
923647538 1:235839397-235839419 TTTGGAAGGGTGGAGGTGGGCGG - Intronic
923800904 1:237207320-237207342 CTTTGAGAGGTGGAGGTGGATGG + Intronic
924127520 1:240870589-240870611 CTTTGAGAGGCCGAGGTGGAAGG - Intronic
924214187 1:241803235-241803257 CTTGGGGAGGCTGAGGTGGAAGG + Intergenic
924240017 1:242031619-242031641 CTTTGAAAGGCAGAGGCGGATGG - Intergenic
924345067 1:243065999-243066021 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
924346680 1:243078810-243078832 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
924371511 1:243355851-243355873 CTTGGGAAGGCAGAGGTGGAGGG - Intronic
924532325 1:244903930-244903952 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
924728106 1:246688698-246688720 ATTGGAGAGGCGGAGGTGGAAGG - Intergenic
924788611 1:247222206-247222228 CTTGGGGAGGCTGAGGTGGACGG - Intergenic
924906947 1:248465161-248465183 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1062845898 10:704825-704847 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1062947375 10:1471888-1471910 CATAGGAAGGGGGATGTGGAGGG - Intronic
1062953341 10:1522352-1522374 CTCTAAGAGGGGGAGGTGGAAGG + Intronic
1062968422 10:1627877-1627899 CTTGAAGAGGTGGAGCTGGAGGG + Intronic
1062997259 10:1878495-1878517 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1063197369 10:3756105-3756127 TTTGGAAAGGGGGATGTGGGTGG + Intergenic
1063234606 10:4099950-4099972 CTTTGGGAGGGTGAGGTGGAGGG - Intergenic
1063243614 10:4195537-4195559 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1063289665 10:4732547-4732569 CTTTGGAAGGCCGAGGTGGAAGG + Intergenic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1063347070 10:5321755-5321777 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1063774009 10:9239456-9239478 CTCACAAACGGGGAGGTGGAAGG - Intergenic
1063785340 10:9377429-9377451 CTTAGAAAGGGCCAAGTGGAAGG - Intergenic
1063927359 10:10993615-10993637 CTTGGAAAAAGAGAGTTGGAAGG + Intergenic
1063985470 10:11497164-11497186 CTTTGGAAGGGTGAGGTGGGGGG + Intronic
1064175872 10:13074566-13074588 GTGGGAGAGGGGGAGGGGGAGGG - Intronic
1064308356 10:14188659-14188681 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1064469692 10:15623440-15623462 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1064475354 10:15682609-15682631 CTTTGAAAGGCTGAGGCGGATGG + Intronic
1064525425 10:16250757-16250779 CTTGGCAAGGGAGATGTGGCAGG - Intergenic
1064539880 10:16394669-16394691 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1064834429 10:19510007-19510029 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1065368700 10:24960042-24960064 ATGGGAAAGGGGGTGGGGGATGG - Intergenic
1065399202 10:25277192-25277214 CTTGGAAAGGCTGAGGTGGGAGG - Intronic
1065481553 10:26199307-26199329 CTTGGAGAGGCCGAGGTGGGTGG + Intronic
1065491088 10:26282184-26282206 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1065721511 10:28632356-28632378 CTTTGAAGGGTTGAGGTGGATGG - Intergenic
1065834114 10:29641325-29641347 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
1065926604 10:30439564-30439586 CTTGGAGAGGCCGAGGTGGGTGG + Intronic
1065930076 10:30471577-30471599 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1065988915 10:30987684-30987706 CTTGGATGGGGGGTGGTGGGTGG - Intronic
1065994794 10:31048176-31048198 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1066000666 10:31101872-31101894 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1066058837 10:31705008-31705030 GTTGGGAAGGGTGAGGAGGAAGG + Intergenic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1066141074 10:32505227-32505249 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066570911 10:36770633-36770655 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1066729669 10:38426039-38426061 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1066731267 10:38439078-38439100 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1067080590 10:43210226-43210248 CTTTGAGAGGCCGAGGTGGATGG + Intronic
1067116739 10:43441130-43441152 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1067145087 10:43688889-43688911 CTGGGAAAGGGGGAGGTTGCTGG + Intergenic
1067844025 10:49704495-49704517 CTTTGAGAGGCAGAGGTGGATGG + Intronic
1068030920 10:51703893-51703915 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1068234820 10:54219671-54219693 CTCGGAAAGGGAGAGATGCAAGG - Intronic
1068774747 10:60857499-60857521 CAGGGAAAGGGGGAGATTGAGGG + Intergenic
1069514795 10:69069072-69069094 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1069619655 10:69829068-69829090 GTTGGAAAGGGCCAGGTGGGGGG - Intronic
1069816027 10:71195087-71195109 TTTGGAAAGGTGGAGGGGGCAGG - Intergenic
1069878285 10:71576367-71576389 CTTGGGGAGGGTGAGGTGGGGGG + Intronic
1070029400 10:72662441-72662463 CTTTGGGAGGGGGAGGTGGGTGG - Intergenic
1070203082 10:74227464-74227486 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1070279588 10:75038721-75038743 GGAGGAGAGGGGGAGGTGGAGGG + Intronic
1070616890 10:77976236-77976258 ATTGGTAAGGCTGAGGTGGAAGG - Exonic
1070724294 10:78777832-78777854 CTGGGACGAGGGGAGGTGGATGG - Intergenic
1070822660 10:79370627-79370649 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1071119312 10:82259682-82259704 CTTTGAAAGGCAGAGGTGGAAGG + Intronic
1071151614 10:82641973-82641995 CTTGGAAAGGGGGAGGTTGAGGG - Intronic
1071225238 10:83521137-83521159 CTTGGAGAGGGGGATATGGCAGG - Intergenic
1071257037 10:83880168-83880190 TTTGGAAAGAGGGAGGATGAAGG - Intergenic
1071260444 10:83914622-83914644 TTTGGCAAGTGGAAGGTGGATGG - Intergenic
1071289678 10:84179921-84179943 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1071367407 10:84913210-84913232 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071529656 10:86379306-86379328 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1071746273 10:88422990-88423012 CTTTGAGAGGGTGAGGTGGGTGG - Intronic
1071916788 10:90301846-90301868 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072263054 10:93700935-93700957 CTTGGAGAGGCTGAGGTGGGAGG - Intronic
1072269700 10:93764327-93764349 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
1072480749 10:95808764-95808786 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1072626082 10:97112935-97112957 CTTTGAAAGGCCGAGGTGGGAGG - Intronic
1072669228 10:97417032-97417054 CTCGGAGAGGGGGACGTGGCAGG + Intronic
1072977336 10:100070169-100070191 CTTTGGAAGGGCGAGGTGGGTGG - Intronic
1073048549 10:100653995-100654017 CTTGCTAAGGGGGAGGGAGAAGG - Intergenic
1073055663 10:100699306-100699328 CTTGGAAAGGTGGGTGGGGAGGG - Intergenic
1073298289 10:102454569-102454591 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1073755161 10:106573328-106573350 TTTGGAAAGGCAGAGCTGGAAGG + Intergenic
1074132362 10:110592018-110592040 CTTTGGGAGGGGGAGGTGGGCGG + Intronic
1074537578 10:114339768-114339790 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074626074 10:115188035-115188057 CTGGGAGAGAGGGAGGGGGAGGG + Intronic
1074816224 10:117142632-117142654 CGAGGAGAGGGGGAGGGGGAGGG + Intergenic
1074829743 10:117240511-117240533 CTTGGAAACGGGGGGGGGAAGGG - Intergenic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1075061129 10:119257478-119257500 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1075130212 10:119731418-119731440 CTTTGGAAGGCCGAGGTGGATGG + Intronic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076133820 10:128031007-128031029 TTTGGAAGTGGGGAGGTGGGAGG + Intronic
1076336596 10:129710574-129710596 TTTGAAGAAGGGGAGGTGGATGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076374108 10:129972379-129972401 CTTGGAGAGAGGGATGGGGAAGG - Intergenic
1076547667 10:131256640-131256662 CTTGGGGAGGCGGAGGTGGGCGG + Intronic
1076971671 11:137867-137889 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1076973270 11:150658-150680 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1077029210 11:456282-456304 CTTGGGAAGAGGGAGGGTGAGGG - Intronic
1077098401 11:809809-809831 GCTGGGAAGGGGGAGGGGGAAGG + Exonic
1077160154 11:1109037-1109059 CTTGGAAAGGGGGTCTTTGAAGG - Intergenic
1077226772 11:1442060-1442082 CTCGGGAAAGGGGAGGTGCAGGG - Intronic
1077282206 11:1750909-1750931 CTTGGAAAGGAGGAGGGAGTTGG - Intronic
1077473731 11:2776761-2776783 CTCGGAAAGGGGGAGTCGGTGGG - Intronic
1077475744 11:2789655-2789677 CCTGGGAAGGGGGAGGCCGACGG - Intronic
1077521673 11:3039454-3039476 CTTGGCAGGTGGGAGATGGAGGG - Intronic
1078444021 11:11390650-11390672 CTTGTCAGTGGGGAGGTGGAAGG + Intronic
1078517776 11:12039327-12039349 GTTGGTAAAGGGGAGGAGGACGG + Intergenic
1079142700 11:17823393-17823415 CATGGAAAGGGGTTGGGGGAGGG - Intronic
1079227741 11:18622284-18622306 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1079619338 11:22534319-22534341 CATGGATAGAGTGAGGTGGAAGG - Intergenic
1079690148 11:23406818-23406840 AGTGAAAAGGGGGAGGGGGAGGG - Intergenic
1080121257 11:28680522-28680544 CCTGGAAAAGGGGAAGTGTATGG + Intergenic
1080272012 11:30460374-30460396 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1080405145 11:31972030-31972052 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1080518913 11:33049516-33049538 CTTGGAGAGGGGGTTGTGGCAGG + Intronic
1081014564 11:37859680-37859702 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1081903227 11:46647678-46647700 CTTGGAAAGGCTGAGGTGGGAGG - Intronic
1081937642 11:46916625-46916647 CTAGGGAAGGGGGAGCTGGAAGG - Intronic
1082082953 11:48026305-48026327 CTGGGAAAGGGGCAGTTGGCTGG + Intronic
1082111007 11:48273893-48273915 ATTGGGAAGGTTGAGGTGGAGGG - Intergenic
1082673004 11:56058401-56058423 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1083094590 11:60236977-60236999 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1083162030 11:60860327-60860349 CATGAAAAGAGGGAGGGGGAAGG - Intergenic
1083203174 11:61132200-61132222 CTGGGAAAGGGGCCGGTGGCAGG + Exonic
1083388089 11:62327344-62327366 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1083392998 11:62368687-62368709 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1083468780 11:62867722-62867744 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1083618405 11:64037216-64037238 CCTGGGGAGGGGGATGTGGAGGG - Intronic
1083638985 11:64135325-64135347 GTTGGAAAGGGGGACAGGGAAGG - Intronic
1083784185 11:64934342-64934364 ATTGGGCAGGGGGAGGGGGAGGG + Exonic
1083798074 11:65029818-65029840 CTTGGGAAGGCCGAGGTGGGAGG - Intronic
1083863696 11:65441868-65441890 AATGGAAGAGGGGAGGTGGAGGG + Intergenic
1084212888 11:67631967-67631989 CTTGGGAAGGAGGAGCAGGAAGG - Intronic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084390953 11:68876477-68876499 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1084645696 11:70456331-70456353 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1084862744 11:72031549-72031571 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
1084892152 11:72241861-72241883 TTGGGAAGGGGAGAGGTGGATGG - Intronic
1084989717 11:72910777-72910799 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1085118084 11:73948157-73948179 CTTGGGGAGGCCGAGGTGGATGG - Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085138916 11:74121877-74121899 ATTGGACAGGAGGTGGTGGACGG - Intronic
1085186494 11:74580185-74580207 CATGGAAATGGAGAGGTGGAAGG - Intronic
1085205216 11:74727646-74727668 CTTTGAAAGGCCGAGGTGGATGG - Intronic
1085229199 11:74949983-74950005 GTAGCAAAGAGGGAGGTGGAGGG - Intronic
1085243962 11:75082836-75082858 CTTTGGGAGGCGGAGGTGGAAGG + Intergenic
1085250697 11:75141744-75141766 CTTGGAAAGCTTGAGGTGGGAGG + Intronic
1085494908 11:76960165-76960187 CTTTGAGAGGCGGAGGTGGGTGG + Intronic
1085596321 11:77813955-77813977 CTTTGAGAGGTGGAGGTGGCTGG + Intronic
1085635963 11:78159850-78159872 CTTTGAAAGGCTGAGGCGGATGG - Intergenic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1086661435 11:89423808-89423830 CTTTGAAAGGCAGAGGTGGAAGG + Intronic
1087425478 11:97980632-97980654 CTTGGAAGGAGGGAGGTTGTTGG + Intergenic
1087642452 11:100769819-100769841 TTTGGCCAGGGGGAGGTGTAGGG + Intronic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1088089913 11:106025395-106025417 CTTTGCAAGGCTGAGGTGGAAGG - Intergenic
1088297101 11:108311216-108311238 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1088481935 11:110302685-110302707 CTTTGAAAGGCTGAGGTGGGCGG + Intergenic
1088571946 11:111231049-111231071 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1088594795 11:111432933-111432955 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
1088904306 11:114142755-114142777 CTTGGGGAGGGGGAGCTGGGGGG + Intronic
1089231740 11:116983286-116983308 CTTTGGAAGGCTGAGGTGGATGG + Intronic
1089331759 11:117694157-117694179 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1089517013 11:119039463-119039485 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1089520574 11:119059932-119059954 TGGGGAAAGGGGGAGGGGGAGGG + Intergenic
1089865290 11:121626296-121626318 CTTGGAAGTGGGGTGGGGGAGGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090377703 11:126303132-126303154 CTTCGAGAGGTCGAGGTGGACGG - Intronic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090461840 11:126897937-126897959 CTTGGGAAGGGGGAGTGGGTGGG + Intronic
1090817450 11:130311450-130311472 CGTTGAAAGGCCGAGGTGGAAGG - Intronic
1090910965 11:131118934-131118956 CTTTGAGAGGGCAAGGTGGAAGG - Intergenic
1091229768 11:133980774-133980796 ATTGGGTTGGGGGAGGTGGAAGG - Intergenic
1091436634 12:478756-478778 CTTGGGAAGGAAGGGGTGGAAGG + Intronic
1091441286 12:512953-512975 GGTGGAAAGTGGAAGGTGGAAGG - Intronic
1091496836 12:980187-980209 CTTGGCCAGCGGGGGGTGGAAGG + Intronic
1091575319 12:1728351-1728373 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
1091601592 12:1921259-1921281 CTTGGAAAGGGGTGGATGTAGGG - Intergenic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1091852031 12:3707132-3707154 CATATAAAGGGGCAGGTGGATGG + Intronic
1092162798 12:6325173-6325195 CTTGGGGAGGGGGAGGGGGAGGG - Intronic
1092237422 12:6818943-6818965 AGGGGAAAGGGGGAGGGGGAGGG + Intronic
1092317677 12:7436526-7436548 CTTTGAAAGGCAGAGGTGGGAGG + Intronic
1092341349 12:7679078-7679100 CTTTGAAAGGCTGAGGCGGAAGG - Intergenic
1092371279 12:7918355-7918377 TTTGGGAAGGCGGAGGTGGGCGG + Intergenic
1092673556 12:10890628-10890650 CTTGGAGAGGCAGAGGTGGGAGG + Intronic
1093021972 12:14212375-14212397 GTAGGAAAGGGGAAGGTTGAAGG + Intergenic
1093042752 12:14402839-14402861 CTTTGGAAGGGTGAGGTGGGTGG - Intronic
1093131368 12:15395300-15395322 CTTGGAAAGAGGAAGGGTGAGGG + Intronic
1093178356 12:15939125-15939147 CTTGGAAAGGGAGAGGTTTGAGG + Intronic
1093247703 12:16760577-16760599 CTTTGAGAGGGCGAGGTGGGAGG - Intergenic
1093383149 12:18519952-18519974 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1093650996 12:21645712-21645734 CTCGGAGAGGGGGATGTGGCTGG - Intronic
1093747687 12:22761806-22761828 CTTTGGAAGGGTGAGGCGGAGGG + Intergenic
1094188263 12:27668385-27668407 ATTAAAAAGGGGGAGCTGGAAGG + Intronic
1094188766 12:27675083-27675105 CTTTGAAAGGCAGAGGTGGGAGG - Intronic
1094190606 12:27694255-27694277 CTTTGAAAGGCTGAGGTGGGAGG - Exonic
1094488495 12:30943707-30943729 CTTGGAATGGGGCAGCTGGAAGG - Intronic
1094582163 12:31743591-31743613 CTTTGAGAGGCGGAGGTGGGCGG + Intergenic
1094747720 12:33365217-33365239 CTTTGAAAGGCTGAGGTGGGCGG + Intergenic
1094820782 12:34222613-34222635 CATTGAAAGGCTGAGGTGGATGG - Intergenic
1095774999 12:46001068-46001090 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1095821634 12:46485150-46485172 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1095938971 12:47713238-47713260 CTTGGAAAGAAAGAGTTGGAGGG - Intronic
1095957075 12:47813156-47813178 CCAGGCAAGGGGGAGCTGGAGGG - Intronic
1096083768 12:48851589-48851611 CTTGTAAAAGGTGATGTGGAAGG + Intronic
1096196471 12:49651933-49651955 CTGGTAATGGGGGAGGTGGAGGG + Exonic
1096364811 12:51019886-51019908 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1096592482 12:52670157-52670179 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1096754652 12:53788843-53788865 CTTGGAAAGGGTGAGGGGCTAGG + Intergenic
1096785004 12:54011939-54011961 CCTGGGGAGGGGGAGGGGGAGGG - Exonic
1096805012 12:54135425-54135447 CTTGGAAAGGTGGAGAAGAAGGG - Intergenic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1096957274 12:55539489-55539511 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1097020239 12:56015637-56015659 CTTTGAGAGGGCGAGGTGGGTGG - Intronic
1097072092 12:56362534-56362556 CTTTGGGAGGCGGAGGTGGAAGG - Intronic
1097254992 12:57666280-57666302 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1097745173 12:63293694-63293716 CTTTGAGAGGCGGAGGTGGGTGG - Intergenic
1097831589 12:64230229-64230251 CTTTGGAAGGCTGAGGTGGAAGG - Intergenic
1097869201 12:64586079-64586101 CTTTGGGAGGGGGAGGTGGGTGG + Intergenic
1097913975 12:65000632-65000654 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1097969967 12:65623059-65623081 CATGGAAAGGGGGTGGTGGAGGG + Intergenic
1097989966 12:65824369-65824391 CTTGGGGAGGGGGTGGTGGTGGG - Exonic
1098075126 12:66721516-66721538 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1098125492 12:67288369-67288391 CTTGGGGAGGCGGAGGTGGGTGG - Intronic
1098253598 12:68594081-68594103 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
1098345715 12:69501216-69501238 CTTTTAAAGGGGGAGGGGGGAGG - Intronic
1098654321 12:73008923-73008945 CTTGGAGAGGCGGATGTGGCAGG + Intergenic
1098773767 12:74587572-74587594 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1099390708 12:82075218-82075240 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1100404800 12:94263612-94263634 CTTGGGGTGGGGGAGGTGGGCGG + Intronic
1100577998 12:95910616-95910638 CTTGGAAAGGCCAAGGTGGGAGG + Intronic
1101094558 12:101323893-101323915 CTTTGGGAGGCGGAGGTGGATGG + Intronic
1101106272 12:101443704-101443726 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1101170565 12:102088752-102088774 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1101209391 12:102521058-102521080 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
1101374028 12:104155256-104155278 GGGGGAAAGGGGGAGGTGGGGGG + Intergenic
1101379990 12:104206137-104206159 CTTTGAGAGGCAGAGGTGGATGG + Intergenic
1101713557 12:107290544-107290566 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1101812866 12:108122822-108122844 CCTGGGAAGGGAGAGGAGGAAGG - Intergenic
1101901701 12:108795610-108795632 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1102192814 12:111001843-111001865 CTAGGACAGGGGGAGCTGGAAGG - Intergenic
1102316725 12:111894273-111894295 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1102902494 12:116649077-116649099 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
1103116461 12:118337749-118337771 TTTGGATAGAGGGTGGTGGAAGG + Intronic
1103282982 12:119775733-119775755 TTTGGAAAGGAGGTGGTGGGGGG + Intronic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1103444478 12:120985323-120985345 CTTTGAAAGGCCGAGGTGGGAGG - Intronic
1103478030 12:121232818-121232840 CTTGGAGAAGGGAAGGTGGGAGG - Intronic
1103541622 12:121670116-121670138 CTTGGAGAGGCTGAGGTGGATGG - Intronic
1103577542 12:121889459-121889481 CTTTGAAAGGCCGAGGTGGAAGG - Intronic
1103659989 12:122506499-122506521 CTTTGAGAGGCCGAGGTGGAAGG + Intronic
1103675566 12:122653063-122653085 CTTTGGAAGGCCGAGGTGGAAGG - Intergenic
1103970390 12:124667175-124667197 CCTGGAAAGGGGAACATGGAAGG + Intergenic
1104069311 12:125330796-125330818 CTTGGGGAGGCAGAGGTGGAAGG + Intronic
1104169527 12:126266677-126266699 CCTGGAAAGGGTGAGTGGGAGGG + Intergenic
1104378308 12:128284890-128284912 CTTCGGAAGGCTGAGGTGGAAGG + Intronic
1104979108 12:132565279-132565301 CTGGGAATGGCGGGGGTGGAGGG - Intronic
1105267489 13:18835826-18835848 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1105372199 13:19811975-19811997 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
1105666853 13:22569160-22569182 CTTTGGAAGGTGGAGGCGGACGG - Intergenic
1105688677 13:22813848-22813870 CTCGGAAAGGGGAATGTGGCAGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105913407 13:24891801-24891823 CTGGGACAGTGGGTGGTGGATGG - Intronic
1105980756 13:25513976-25513998 GTGGGAGAGGGGGAGGGGGAGGG + Intronic
1106192023 13:27462014-27462036 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1106607418 13:31241858-31241880 TTTGGAAAGGTGGAGTTTGAGGG + Intronic
1106632554 13:31491430-31491452 CTTTGAAAGGCCGAGGTGGGTGG + Intergenic
1106747491 13:32720684-32720706 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1106761936 13:32876097-32876119 GATGGCCAGGGGGAGGTGGATGG - Intergenic
1106799600 13:33242703-33242725 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1106918325 13:34538916-34538938 TTTGGCAAGGGGGAGATAGAAGG - Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107247320 13:38311420-38311442 CTTTGAGAGGCGGAGGTGGGCGG + Intergenic
1107254713 13:38410581-38410603 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1107700315 13:43040738-43040760 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1107737462 13:43415288-43415310 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1107830107 13:44367589-44367611 CTTGGGAAGAGGGGGGTGGGAGG - Intergenic
1107848812 13:44549655-44549677 CTTGGAGAGGCTGAGGTGGGAGG + Intronic
1108035239 13:46284468-46284490 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1108044392 13:46369456-46369478 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1108092454 13:46863377-46863399 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1108399380 13:50023894-50023916 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1108813853 13:54266992-54267014 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1108922333 13:55691709-55691731 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1109849251 13:68038979-68039001 CTTTGAAAGGTCGAGGTGGGTGG + Intergenic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1110418828 13:75281434-75281456 CTTGGGAAAGGGTAGGAGGAGGG - Intergenic
1111463154 13:88572533-88572555 CTTTGGGAGGGTGAGGTGGAAGG + Intergenic
1111575012 13:90142672-90142694 CGTGGAAGGGGGGAGGGGGGAGG - Intergenic
1112007768 13:95268774-95268796 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1112144886 13:96688069-96688091 CATGGAATGGGGGGGGGGGAGGG + Intronic
1112248370 13:97754998-97755020 CTTGGGAAGGCTGAGGTGGAAGG - Intergenic
1112250601 13:97775449-97775471 CTCGGACAGGGGGATGTGGCAGG - Intergenic
1112411172 13:99164882-99164904 CTTGGGGAGGCTGAGGTGGATGG + Intergenic
1112462174 13:99612766-99612788 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1112542315 13:100327221-100327243 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1112826722 13:103400175-103400197 GTGGGATAGGGGGAGGTGGGAGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113079835 13:106506958-106506980 CTTGGACAGGGGGAGGGTGGTGG + Intronic
1113099978 13:106706939-106706961 CTTGGAAAGGAGGAGGGTGGAGG - Intergenic
1113171850 13:107513387-107513409 CTTGGAATGGGAGAGGGAGAAGG - Intronic
1113179714 13:107611635-107611657 CTTGGAGAGGCAGAGGTGGGAGG + Intronic
1113406378 13:110044659-110044681 CTGGGAGAGGTGGAGGTGGGGGG - Intergenic
1113660361 13:112103424-112103446 CTTGGGAAGGAGGAGGTACAGGG - Intergenic
1114154499 14:20085339-20085361 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1114182353 14:20377526-20377548 CTTGGGAAGGGGTAGGGGGCAGG + Intronic
1114491885 14:23107735-23107757 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1114547218 14:23512035-23512057 ATTGGGATGGGGGAGGAGGAAGG - Intergenic
1114578835 14:23737499-23737521 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1114770257 14:25422679-25422701 GTTGGAAAGTGAAAGGTGGAAGG - Intergenic
1114802483 14:25792965-25792987 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1115011686 14:28555765-28555787 GTGGGCATGGGGGAGGTGGAAGG + Intergenic
1115319856 14:32068188-32068210 CTTCGAAAGGCTGAGGTGGGAGG + Intergenic
1115329765 14:32183904-32183926 CTTGAAAAGAGAGAGATGGATGG + Intergenic
1115414464 14:33115156-33115178 ATCGGAAAGGGATAGGTGGAAGG + Intronic
1115573647 14:34690416-34690438 CTTGGAGAGGCTGAGGTGGGAGG - Intergenic
1115573859 14:34692318-34692340 TTTGGGAAAGGGGTGGTGGAAGG - Intergenic
1115669935 14:35599499-35599521 CTTTGGGAGGGGGAGGTGGGAGG + Intronic
1115710941 14:36050015-36050037 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1116199677 14:41775330-41775352 CTTTGGAAGGCGGAGGTGGGCGG - Intronic
1116444350 14:44991199-44991221 CTTTGAGAGGTGGAGGTGGGAGG - Intronic
1116448347 14:45038148-45038170 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1116937565 14:50757893-50757915 ATAGGAGAGGAGGAGGTGGAAGG - Exonic
1117010798 14:51468297-51468319 ATGGGAGAGGGGGAGGGGGAGGG + Intergenic
1117647525 14:57867023-57867045 AATGAAAAGGTGGAGGTGGAGGG + Intronic
1117697870 14:58384601-58384623 CTTGGAGTGGGGTATGTGGAGGG + Intergenic
1117811006 14:59546994-59547016 CTTTGAGAGGCGGAGGTGGGAGG + Intronic
1118008108 14:61583450-61583472 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
1118220441 14:63851117-63851139 CTTGGGGAGGCCGAGGTGGATGG + Intergenic
1118301336 14:64619076-64619098 TTTGGCATGGGGGAGGGGGAGGG + Intergenic
1118302340 14:64626709-64626731 CTTCAAGAGGGTGAGGTGGAGGG + Intergenic
1118305768 14:64653897-64653919 CTTTGAGAGGTCGAGGTGGAAGG - Intergenic
1118382774 14:65230964-65230986 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1118635273 14:67743079-67743101 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1118794491 14:69128872-69128894 CTTTGAAAGGTCGAGGTGGGAGG + Intronic
1118895616 14:69943073-69943095 CTTGGGGAGGGGGTGGTGGTGGG + Intronic
1118935537 14:70284618-70284640 CTTGGAAATGGGAATGTGGCAGG - Intergenic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119099672 14:71868209-71868231 CTTGGCAAGGGTGAGCAGGATGG + Intergenic
1119354381 14:73993227-73993249 CTTGGGAAGCTGGAGGTGGGAGG + Intronic
1119402959 14:74376756-74376778 CTTTGAGAGGATGAGGTGGATGG + Intergenic
1119476733 14:74934819-74934841 CTTTGAAAGGGAGAGGAGGAGGG + Intergenic
1119518372 14:75266444-75266466 CTTTGGGAGGCGGAGGTGGAAGG + Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119707956 14:76798368-76798390 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1119826572 14:77661592-77661614 CTCGGAGAGGGGGAGGTGACAGG + Intergenic
1119845453 14:77826185-77826207 CCTGGGAAGGGGGAGCTGGCTGG + Intronic
1119904858 14:78292478-78292500 ACTAGAAAGAGGGAGGTGGAAGG + Intronic
1119917029 14:78411739-78411761 CTTGGATAGGGGGAGGTGCAGGG - Intronic
1119996657 14:79261105-79261127 CTGGGAAGGGGTGAGGAGGAGGG + Intronic
1120207773 14:81604554-81604576 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1120641669 14:87020876-87020898 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1120733163 14:88025085-88025107 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1120954346 14:90068349-90068371 CTTTGGGAGGGGGAGGTGGGTGG + Intronic
1120982216 14:90300146-90300168 TTAGGAAAGGGGCAGGGGGAGGG + Intronic
1121051480 14:90821567-90821589 CATGGGTAGGGGGAGGTGGGGGG + Intergenic
1121065291 14:90957896-90957918 CTTGGAAAGGCCGAGGTAGAAGG + Intronic
1121194536 14:92057951-92057973 CTTTGAGAGGCCGAGGTGGAAGG - Exonic
1121287022 14:92743910-92743932 CTTGGAAAGGTTGAGGTGGGCGG + Intronic
1121353798 14:93196179-93196201 CTTTGGGAGGGGGAGGTGGGAGG - Intronic
1121432933 14:93900196-93900218 CTGGGAGTGGGGGTGGTGGACGG + Intergenic
1121445787 14:93977991-93978013 ATTGGGAAGGGGCAGGTGGTGGG - Intergenic
1121508567 14:94494914-94494936 CTGGGAACCAGGGAGGTGGAAGG - Intronic
1121732379 14:96195448-96195470 CTTGGGAGGGGGAAGGTGCAGGG + Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122804732 14:104250604-104250626 CTGGTAAAGGTGGAGGGGGAGGG + Intergenic
1202919304 14_KI270723v1_random:16200-16222 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1202925327 14_KI270724v1_random:18794-18816 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1123433356 15:20236872-20236894 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1123471013 15:20551958-20551980 CTTGGGGAGGCGGAGGTGGGTGG - Intergenic
1123647045 15:22448744-22448766 CTTGGGGAGGCGGAGGTGGGTGG + Intergenic
1123688959 15:22821206-22821228 CTTTGGAAGGGCGAGGTGGGCGG - Intronic
1123720758 15:23060050-23060072 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1123723689 15:23081915-23081937 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1123731314 15:23146947-23146969 CTTGGGGAGGCGGAGGTGGGTGG - Intergenic
1123749452 15:23344362-23344384 CTTGGGGAGGCGGAGGTGGGTGG - Intergenic
1124245631 15:28069422-28069444 CGGGGAGAGGGGGAGGGGGAGGG - Intronic
1124281825 15:28368237-28368259 CTTGGGGAGGCGGAGGTGGGTGG - Intergenic
1124300878 15:28543364-28543386 CTTGGGGAGGCGGAGGTGGGTGG + Intergenic
1124665499 15:31588486-31588508 CTTAGAAAGGGTGAGGGGCATGG - Intronic
1124912195 15:33932581-33932603 CTTTGGAAGGCTGAGGTGGAGGG + Intronic
1124921481 15:34030859-34030881 CTTTGGGAGGGTGAGGTGGAAGG - Intronic
1124933126 15:34143229-34143251 CTTTGGGAGGGGGAGGTGGGTGG + Intronic
1125016202 15:34938288-34938310 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1125447632 15:39775011-39775033 TTTGCAGTGGGGGAGGTGGAGGG + Intronic
1125449390 15:39792302-39792324 CTTTGGGAGGGGGAGGTGGGAGG + Intergenic
1125697928 15:41654755-41654777 CTTTGGGAGGAGGAGGTGGAAGG - Intronic
1125740482 15:41959722-41959744 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1125800827 15:42445235-42445257 CCTGGAAAGGTGGTGGTAGAAGG - Intronic
1125862625 15:43013866-43013888 CGTGGGGAGGGGGAGGGGGAAGG - Intronic
1125956719 15:43795479-43795501 CTTGGACTGGAGGAGCTGGAGGG + Exonic
1126479676 15:49104173-49104195 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1126667887 15:51091427-51091449 AATGGAATGTGGGAGGTGGAGGG + Intronic
1126839839 15:52707016-52707038 TTTTGAAAGGGGGAGTTGTATGG + Intronic
1126964685 15:54038374-54038396 CTTTGAAAGGCAGAGGTGGGCGG - Intronic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127396387 15:58546936-58546958 GTTGGAGTGGGGGAGGTGGGAGG - Intronic
1127479481 15:59365260-59365282 CTTTGGAAGGCTGAGGTGGAGGG - Intronic
1127768000 15:62206857-62206879 CTTTGAAAGGCCGAGGTGGGAGG - Intergenic
1127887020 15:63210557-63210579 GTTGGGAAGCTGGAGGTGGAAGG - Intronic
1127980757 15:64033251-64033273 CCTGGGGAGGGGGAGGGGGAGGG + Intronic
1128140121 15:65293764-65293786 CTTTGGAAGGCGGAGGTGGTCGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128434804 15:67636167-67636189 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1128568202 15:68715018-68715040 GGTGGAGAGGTGGAGGTGGATGG - Intronic
1128730418 15:70016963-70016985 CTTGGAGAGAGGGAAGAGGAAGG - Intergenic
1128987263 15:72230677-72230699 CTTGAAGAGGAGGGGGTGGAAGG + Intronic
1129327766 15:74810481-74810503 CTTTGAGAGGCTGAGGTGGACGG + Intergenic
1129731664 15:77935868-77935890 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG + Intergenic
1130822309 15:87508516-87508538 CTAGGAAATCAGGAGGTGGAAGG + Intergenic
1130942828 15:88524902-88524924 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1131034753 15:89214909-89214931 CCTGGAAAGGGCTAGGTGGCAGG + Intronic
1131061058 15:89404967-89404989 TTTGCAAAGGGTGAGGTGGGTGG + Intergenic
1131109730 15:89757819-89757841 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1131232288 15:90667999-90668021 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
1131636408 15:94237352-94237374 ATTTGAGAGGTGGAGGTGGAAGG + Intronic
1131774957 15:95784921-95784943 CTCGGAGAGGGGGACGTGGCAGG + Intergenic
1132073462 15:98799798-98799820 CTTGAAGGGGGGCAGGTGGAGGG - Intronic
1132752793 16:1466472-1466494 CGTGGATAGGTGGAGGTTGAGGG - Intronic
1132922004 16:2400774-2400796 CGTGGGGAGGGGGAGGAGGAGGG + Intergenic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133166241 16:3949599-3949621 CTTGGAAAGTGGGTGGGGGTAGG - Intergenic
1133602211 16:7350551-7350573 TCTGGAAAGTGGGAGGAGGATGG + Intronic
1133838222 16:9385430-9385452 CTTGGAGAGGCGGGGGTGGGTGG - Intergenic
1133845847 16:9453202-9453224 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1133924583 16:10182592-10182614 TTGGGAAGGGGGGAGGTGGGAGG - Intronic
1133934160 16:10255443-10255465 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1133963582 16:10515552-10515574 CTTTGAAAGGCGGAGGCGGGAGG + Intergenic
1133976423 16:10602395-10602417 TTTGGACAGGTGGAGGTGGGAGG - Intergenic
1134009984 16:10844716-10844738 CTTTGAAAGGCGGAGGTGGGAGG - Intergenic
1134100733 16:11449732-11449754 CTAGGAAATGGGGAAGTTGATGG - Intronic
1134110595 16:11513158-11513180 CTTTGGGAGGGCGAGGTGGAAGG + Intronic
1134259126 16:12636754-12636776 CTTTGAAAGGCCGAGGTGGGAGG - Intergenic
1134465815 16:14476584-14476606 CTTTGAGAGGCGGAGGTGGGAGG + Intronic
1134486327 16:14661644-14661666 CTTGGGAAGGCCGAGGTGGACGG - Intronic
1135033002 16:19053924-19053946 CTTTGAGAGGTGGAGGTGGGAGG - Intronic
1135090070 16:19506888-19506910 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1135255452 16:20938146-20938168 CTTTGAAAGGCAGAGGTGGGTGG + Intronic
1135280717 16:21151989-21152011 CTCTGAAAGGCTGAGGTGGATGG + Intronic
1135289357 16:21221986-21222008 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1135312778 16:21418984-21419006 GTTGGGGAGGGGGAGGGGGAGGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135446113 16:22519898-22519920 GTTGGGGAGGGGGAGGGGGAGGG - Intronic
1135646308 16:24165284-24165306 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1135947876 16:26881295-26881317 CTTGGGGAGGCCGAGGTGGATGG - Intergenic
1136062210 16:27734453-27734475 CTTTGGGAGGGCGAGGTGGACGG + Intronic
1136179509 16:28541319-28541341 TTTTGAAAGGCTGAGGTGGAAGG + Intergenic
1136346189 16:29677660-29677682 CTTGGAAAGAGGGAAGGGAAGGG + Intronic
1136357390 16:29754248-29754270 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1136614808 16:31391998-31392020 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1136689465 16:32018586-32018608 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136790054 16:32962128-32962150 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136851269 16:33614249-33614271 CTTTGGGAGGCGGAGGTGGAAGG - Intergenic
1136879759 16:33891808-33891830 CTTTGGAAGGTGGAAGTGGAAGG - Intergenic
1137242687 16:46670526-46670548 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1137630172 16:49937731-49937753 CTTTGAAAGGCTGAGGTGGTGGG - Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137942493 16:52702610-52702632 ATTGGAACAGGGGAGGAGGAGGG - Intergenic
1138106045 16:54287486-54287508 CTGGGAATGGGGGAGGAGCAGGG + Intergenic
1138181947 16:54946614-54946636 CTTTGAAAGGTCGAGGTGGGTGG + Intergenic
1138326444 16:56175019-56175041 GTGGGAAAGGGGGAGGATGAGGG - Intergenic
1138570797 16:57871046-57871068 TTTGGGAAGTGGGTGGTGGAAGG + Intergenic
1138579954 16:57934209-57934231 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1138665140 16:58560633-58560655 CTTTGAAAGGCTGAGGCGGAAGG + Intronic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139518854 16:67468181-67468203 CTTGGGAAAGGTGAGGTAGAAGG + Intronic
1139864015 16:70050323-70050345 CGTGGAGAGAGGGAGGGGGAGGG - Intergenic
1140088138 16:71814524-71814546 CTTGGGGAGGGTGAGGTGGGAGG - Intergenic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140201918 16:72901907-72901929 CTTAAAAAGGGGGTGGGGGAAGG - Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140223354 16:73059172-73059194 AAAGAAAAGGGGGAGGTGGAGGG + Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1140511969 16:75515428-75515450 CTTTGAAAGGCCGAGGTGGCTGG + Intergenic
1140552624 16:75883387-75883409 CTTGGGCAGGGGCAGGTGAAGGG + Intergenic
1140564173 16:76021957-76021979 CCTGGCTAGAGGGAGGTGGACGG - Intergenic
1140597294 16:76431434-76431456 CTTTGGAAGGTGGAGGTGGGGGG + Intronic
1140619596 16:76713193-76713215 CTTGGGAAGGGGTAGGTTGCTGG - Intergenic
1140711365 16:77680978-77681000 CTTTGAAAGGCTGAGGTGGAAGG - Intergenic
1140904980 16:79402366-79402388 CTTGGAAATGGGGAGCAGGAAGG + Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141449826 16:84091240-84091262 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141802359 16:86319478-86319500 CTAGGGCAGGAGGAGGTGGAAGG - Intergenic
1141909680 16:87050196-87050218 CTTAGGAAGGGGTCGGTGGACGG - Intergenic
1142138708 16:88463101-88463123 CTTGGGAAGTGGGAGCTTGATGG - Intronic
1142287870 16:89178803-89178825 CCTGGAGAGGTGGAGGGGGACGG + Intronic
1142446981 16:90146868-90146890 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1142448577 16:90159655-90159677 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1203092258 16_KI270728v1_random:1223591-1223613 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1203112871 16_KI270728v1_random:1462710-1462732 CTTTGGGAGGCGGAGGTGGAAGG - Intergenic
1142458908 17:75634-75656 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142460511 17:88463-88485 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142803316 17:2358464-2358486 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1142987445 17:3704761-3704783 CTTTGGAAGGCCGAGGTGGACGG + Intergenic
1143039549 17:4023574-4023596 CTTCAAGAGGCGGAGGTGGAAGG + Intronic
1143071541 17:4299314-4299336 GTTGGAACCTGGGAGGTGGAGGG + Intronic
1143253898 17:5541822-5541844 GGTGGGCAGGGGGAGGTGGAGGG - Intronic
1143355573 17:6325595-6325617 CTTTGAGAGGCCGAGGTGGATGG + Intergenic
1143459095 17:7089089-7089111 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1143496672 17:7316367-7316389 CTTTGCAAGGGGGAGGTGATGGG - Intronic
1143557606 17:7671852-7671874 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143871978 17:9963622-9963644 CTTTGAGAGGTTGAGGTGGAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144663577 17:17087221-17087243 CTTAGCTAGGGGGAGGGGGAGGG + Intronic
1144812448 17:18009168-18009190 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1144914768 17:18715322-18715344 CTTGAGCAGGGGGTGGTGGATGG - Intronic
1145056239 17:19705840-19705862 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1145087244 17:19951847-19951869 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1145927358 17:28658298-28658320 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1146023719 17:29301297-29301319 CTTTGGGAGGTGGAGGTGGATGG - Intergenic
1146051080 17:29554018-29554040 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
1146179469 17:30688044-30688066 CTTTGAGAGGCCGAGGTGGACGG - Intergenic
1146290453 17:31602964-31602986 CTTGGAGAGGGTGGGGTGGGTGG - Intergenic
1146313709 17:31790895-31790917 CTTGGGAAGGCAGAGGTGGGAGG - Intergenic
1146361612 17:32180587-32180609 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1146394235 17:32450202-32450224 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1146484930 17:33235239-33235261 CCTGGGAAGGGGGAGGGAGAAGG - Intronic
1146574389 17:33978750-33978772 CTTGGACAGAGGGAGGAGTAAGG + Intronic
1146797517 17:35793521-35793543 CTAGGAAGGGGAGGGGTGGAAGG + Intronic
1147038759 17:37701213-37701235 CTGGGATAAGGAGAGGTGGATGG + Intronic
1147158708 17:38558681-38558703 CATGCAAAGGGGGAGCTGCATGG + Intronic
1147352374 17:39859986-39860008 CTTGGGAAGGTTGAGGCGGAAGG + Intronic
1147432370 17:40380228-40380250 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1147532304 17:41290854-41290876 CCTGGGGAGGGGGATGTGGATGG + Intergenic
1147688892 17:42303464-42303486 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1147784883 17:42972323-42972345 CATGGGGAGGGGGAGGGGGAGGG - Intronic
1147885384 17:43680690-43680712 CTTGGAAAGGGAGACGTGGTAGG + Intergenic
1148179747 17:45595729-45595751 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
1148269155 17:46250172-46250194 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
1148404091 17:47397030-47397052 GAGGGAAAGGGGGAGGGGGAGGG - Intronic
1148502498 17:48102215-48102237 CTTGGGGAGGCGGAGGTGGGTGG + Intergenic
1148534080 17:48423863-48423885 CTTTGAGAGGCGGAGGTGGGAGG - Intronic
1148672077 17:49418857-49418879 CTCGGAGAGGGGGATGTGGTGGG + Intronic
1148796994 17:50201771-50201793 AATGGAGAGGGGGAGGAGGAGGG + Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1148975363 17:51522997-51523019 CATGGAAATGGGGAGGGGAAGGG - Intergenic
1149238205 17:54617818-54617840 CTTGGAATGGGGGTTGTGTAGGG - Intergenic
1149387848 17:56159642-56159664 CTTGGAAAGGGGGAGGGTAGAGG - Intronic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1149582928 17:57763756-57763778 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1149641972 17:58208706-58208728 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1149773623 17:59340656-59340678 CTTTGAAAGGCCGAGGTGGGCGG - Intronic
1149830615 17:59868450-59868472 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1149994006 17:61397398-61397420 CCTGGGAAGGGGGAGGGGGCCGG + Intergenic
1150139287 17:62714988-62715010 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1150284100 17:63945800-63945822 GGTGGTAAGGGGGAGGGGGAGGG + Intronic
1150409393 17:64930773-64930795 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1150489317 17:65563499-65563521 GCTGGAAAGGGGCAGGTGGCAGG + Intronic
1150518365 17:65838041-65838063 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1150877560 17:68986298-68986320 TTTTGAAAGGGAGCGGTGGAGGG - Exonic
1150894795 17:69197000-69197022 CGTGGACAGAGGGAGGGGGAGGG + Intronic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151325192 17:73375488-73375510 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1151452956 17:74210546-74210568 CTGGGATGGGGGGAGGTGCATGG + Exonic
1151576375 17:74954402-74954424 ATTGGACGGGGGGAGCTGGAGGG - Intronic
1151665998 17:75545444-75545466 CTTGGAAGTGGAGAGGAGGAAGG + Intronic
1151671052 17:75571880-75571902 CTTGGCTAGGGGGAGGAGGTGGG - Exonic
1151958482 17:77392626-77392648 CTTGGGAAGGCAGAGGGGGAGGG + Intronic
1152386404 17:79977414-79977436 CTGGGAAGGGGCCAGGTGGAGGG - Intronic
1152400838 17:80065238-80065260 CTTGGGAATGAGGAGGAGGAGGG - Intronic
1152618429 17:81348559-81348581 CTGGGACAGTGGGAGGGGGATGG + Intergenic
1152661617 17:81544923-81544945 CTTTGAGAGGGTGAGGTGGGCGG + Intronic
1152840425 17:82563993-82564015 CTTGGAGAGGCTGAGGTGGGCGG - Intronic
1152962898 18:90412-90434 CTCGGCAAGGGGGATGTGGCAGG + Intergenic
1152972728 18:179842-179864 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1152980700 18:273496-273518 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1153023075 18:648899-648921 CTTGGGGAGGCTGAGGTGGAAGG - Intronic
1153170577 18:2311519-2311541 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1153208949 18:2737475-2737497 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1153236325 18:2991766-2991788 CTTTGGGAGGGGGAGGTGGGTGG + Intronic
1153414789 18:4834911-4834933 CTTTGAGAGGGCGAGGTGGGCGG - Intergenic
1153518926 18:5933710-5933732 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1153723447 18:7931460-7931482 CTTTGAGAGGGCGAGGTGGGTGG + Intronic
1153924006 18:9817151-9817173 CATGGGAAGGGTGAGGTGGGTGG + Intronic
1154102497 18:11489206-11489228 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1154143902 18:11850188-11850210 CTTTGACTGGCGGAGGTGGAGGG + Intronic
1154189430 18:12216535-12216557 TTTGGAAAGGAGGAGATAGAAGG - Intergenic
1154192768 18:12244113-12244135 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1154321470 18:13356888-13356910 CTTTGGAAGGCCGAGGTGGAGGG + Intronic
1154347895 18:13558881-13558903 CTTGTAGAGGGGCAGGGGGAGGG - Intronic
1154482919 18:14854947-14854969 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1154965710 18:21354030-21354052 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1154983042 18:21520182-21520204 CTTTGAGAGGCCGAGGTGGATGG - Intronic
1155021178 18:21898256-21898278 CTTTGAAAGGAGGTGGTGGCAGG - Intergenic
1155208653 18:23582556-23582578 CTTTGGGAGGCGGAGGTGGATGG + Intronic
1155422138 18:25667217-25667239 CTTGGAAAGGGGTACTGGGAAGG - Intergenic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1155835674 18:30580981-30581003 TTTGGAAAGGGAGAAGTGGTTGG + Intergenic
1155942262 18:31811247-31811269 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1156277239 18:35594970-35594992 TTTGGAAATGGGGAGGAAGATGG + Intronic
1156398493 18:36720212-36720234 ATTGGAACGGGGCATGTGGATGG - Intronic
1156457422 18:37302590-37302612 CCTGGAGGTGGGGAGGTGGAGGG + Intronic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157278439 18:46329323-46329345 CTGGAAAAGGTGGAAGTGGAGGG - Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157370041 18:47102562-47102584 CCTGGATAGGGGGCGGGGGATGG - Intergenic
1157456050 18:47828885-47828907 CTCGGAGAGGGGGATGTGGCAGG - Exonic
1157777132 18:50404389-50404411 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1158318366 18:56237091-56237113 CTTTGGGAGGGGGAGGTGGGTGG - Intergenic
1158425989 18:57340047-57340069 CTGGGAAAGGGAGAGGGAGAGGG - Intergenic
1158474458 18:57767542-57767564 CTTGGGGAGGGCGAGGTGGGTGG + Intronic
1158591861 18:58784962-58784984 CTAGGAAAGGCAGAGGGGGAAGG - Intergenic
1158603002 18:58870869-58870891 TTTGGAAGAGTGGAGGTGGAGGG + Intronic
1158698736 18:59727238-59727260 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
1158823394 18:61187041-61187063 CTTTGGAAGGCGGAGGTGGGAGG + Intergenic
1158962087 18:62596021-62596043 ATTGGAAAGGGCCAGGTGGCTGG - Intergenic
1159207535 18:65272855-65272877 CTTGGCGAGGCGGAGGTGGGTGG - Intergenic
1159344831 18:67188222-67188244 CTTTGAGAGGGTGAGGTGGGTGG + Intergenic
1159453304 18:68629859-68629881 CTTTGAAAGGCCGAGGAGGATGG + Intergenic
1159570201 18:70103710-70103732 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1159931950 18:74321546-74321568 CTTGGAGAGGTCGAGGTGGGAGG - Intronic
1159952943 18:74497943-74497965 TTTGTAACGGGGGAGGTGGGGGG + Intronic
1160294364 18:77623887-77623909 CGTGGAAGGGGGAAGGGGGAAGG - Intergenic
1160648627 19:208147-208169 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1160650226 19:220963-220985 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1160686538 19:439331-439353 CTGGGAAAGAGGGTGGTAGAGGG - Intronic
1160725038 19:614092-614114 CTTGGACAGTGGCAGGGGGAAGG + Intronic
1160868751 19:1267612-1267634 CTTGTAGGGGGGGAGTTGGAGGG - Intronic
1161362235 19:3856970-3856992 CTTTGGAAGGCCGAGGTGGACGG - Intronic
1161544874 19:4874346-4874368 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1161555228 19:4937905-4937927 CTTGGAGAGGCGGAGGTGGGCGG + Intronic
1161629564 19:5345895-5345917 CTTTGGGAGGGGGAGGTGGGAGG - Intergenic
1161721655 19:5905936-5905958 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
1161729739 19:5952013-5952035 TTAGGAAAGAGGGAGGTGGCTGG + Intronic
1161989717 19:7677761-7677783 CTTGGGAAGGGGCAGGTGGGCGG + Intronic
1162291489 19:9784259-9784281 CTGGGCAAGGGGGATGTGGCAGG + Intronic
1162340644 19:10089714-10089736 CTTGGGATGGGGGAGTTGGGAGG + Intronic
1162723020 19:12673657-12673679 CTTGGGAAGGCTGAGGTGGGTGG - Intronic
1162744966 19:12792969-12792991 CTTGTAAACGTCGAGGTGGAAGG - Exonic
1162861006 19:13505863-13505885 CCTGGAAGAGGGGAGGCGGAGGG + Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1162901877 19:13799975-13799997 CTGGAAATGGGGGAGTTGGAGGG + Intronic
1162928827 19:13945409-13945431 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163016173 19:14456272-14456294 CTTTGAGAGGCCGAGGTGGAGGG + Intronic
1163118471 19:15201460-15201482 CTTTGAGAGGCAGAGGTGGATGG + Intergenic
1163306342 19:16481846-16481868 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163421093 19:17214066-17214088 CTTTGGGAGGGTGAGGTGGATGG - Intronic
1163609287 19:18292690-18292712 CTTGAAAAGGGGGTGTGGGAGGG + Intergenic
1163637348 19:18443490-18443512 CTTGGAAAGGTGGTGGGGGGTGG - Exonic
1163913683 19:20219169-20219191 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1164016327 19:21258932-21258954 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1164153726 19:22575689-22575711 TTTGGAGAGGGGGATGTGGCAGG - Intergenic
1164154405 19:22581543-22581565 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1164573792 19:29393383-29393405 CAATGAGAGGGGGAGGTGGAGGG + Intergenic
1165059124 19:33196124-33196146 CTTGGCACGGGGGAAGAGGATGG + Intronic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165295168 19:34920924-34920946 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1165386319 19:35512543-35512565 CTTGGAGGGAGGGAGGTGGCAGG + Intronic
1165420688 19:35720676-35720698 CTTGGGCAGGAGGCGGTGGAGGG - Exonic
1165457154 19:35919309-35919331 CTTTGGCAGGCGGAGGTGGAAGG + Intergenic
1165506403 19:36233564-36233586 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1165523483 19:36332368-36332390 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1165530478 19:36396147-36396169 CTTTGAAAGGCAGAGGTGGGAGG - Intronic
1165576134 19:36820658-36820680 CTTGGAAAGGCTGAGGCAGATGG + Intronic
1165606202 19:37106820-37106842 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1165607140 19:37115397-37115419 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1165712779 19:38024007-38024029 CTTGGGGAGGGGGAGGGGGGTGG + Intronic
1165727280 19:38121975-38121997 CTTGGGGAGGCCGAGGTGGATGG + Intronic
1165814192 19:38631328-38631350 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1166115862 19:40653884-40653906 CTTTGAAAGGCCGAGGCGGATGG - Intergenic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166361041 19:42253225-42253247 CCTGGAGTGGGGGAGGTGGTGGG - Intronic
1166502201 19:43350074-43350096 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1166507907 19:43383375-43383397 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1166529120 19:43532270-43532292 CTTTGGGAGGCGGAGGTGGACGG - Intronic
1166545855 19:43634714-43634736 CTTGGAAAAGGGGACAGGGAGGG + Intronic
1166596323 19:44053308-44053330 CTTGGTGAGGGGGATGTGGAAGG + Intronic
1166645242 19:44526631-44526653 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1166744735 19:45136024-45136046 CTTTGGAAGGCTGAGGTGGACGG - Intronic
1166821121 19:45580857-45580879 CTTTGGAAGGCGGAGGTGGGTGG - Intronic
1166884294 19:45950402-45950424 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1167082847 19:47289065-47289087 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1167261770 19:48462806-48462828 CTTTGCGAGGGGGTGGTGGAGGG + Intronic
1167371463 19:49085217-49085239 CGCGGAAAGCGGGAGGTGGAGGG + Intergenic
1167407578 19:49323919-49323941 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1167408362 19:49329537-49329559 CTTTGCAAGGGCGAGGTGGGAGG + Intergenic
1167445237 19:49533696-49533718 CCTGGTAAGGGGGAGGGGCATGG + Intronic
1167500302 19:49842823-49842845 CTTGCAAAGGAGCAGGTGGTAGG + Intergenic
1167588681 19:50390617-50390639 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1167608129 19:50492669-50492691 TATGGATAGGGGGAGGAGGAGGG + Intergenic
1167622126 19:50566406-50566428 GCTGGGAAGGGGGAGGGGGAAGG - Intronic
1167686540 19:50960112-50960134 GATGGAGAGGGGGAGGAGGATGG + Intronic
1167814678 19:51869474-51869496 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167818648 19:51906442-51906464 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167831538 19:52026954-52026976 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167834102 19:52052467-52052489 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167867347 19:52338978-52339000 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1167893239 19:52559438-52559460 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167913708 19:52723757-52723779 CTCAGAGAGGGGGATGTGGAAGG + Intronic
1167939704 19:52936827-52936849 CTTGGAGAGGGGAATGTGGCAGG - Intronic
1167940865 19:52944781-52944803 CTCGGAGAGGGGGATGTGGAAGG + Intronic
1168017265 19:53583523-53583545 CTTGGGGAGGCTGAGGTGGACGG + Intergenic
1168059599 19:53883462-53883484 TTTGGAAAAGGGGAGCTGAAGGG + Intronic
1168071986 19:53958549-53958571 ATTGGAATGGGGGAGGGGGCAGG + Intergenic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168405475 19:56108237-56108259 CTGGGCAGGGGCGAGGTGGAGGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
1168614155 19:57824373-57824395 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1168625810 19:57916847-57916869 CTTTGGAAGGCGGAGGTGGGCGG + Intergenic
1168638393 19:58013744-58013766 CTTGGCAAGGGGGATGTGGCAGG + Intergenic
925238711 2:2302451-2302473 CTTTGAAATGGTGAGGAGGAGGG + Intronic
925336811 2:3104679-3104701 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925738586 2:6985552-6985574 CTTAGGAAGGTGGATGTGGAAGG + Intronic
925872617 2:8284216-8284238 CTGGGAAAGGGACAGTTGGAGGG - Intergenic
926186793 2:10696912-10696934 CTTTGAAAGGCCGAGGTGGGAGG + Intergenic
926354560 2:12029246-12029268 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
926730522 2:16032699-16032721 CTTGGAAACAGGGAGGAGGTTGG + Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
927163546 2:20293463-20293485 CTTTGAAAGGTCGAGGTGGGTGG + Intronic
927299867 2:21499836-21499858 CTTTGAGAGGGCGAGGTGGGTGG + Intergenic
927773688 2:25885491-25885513 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
927839177 2:26427357-26427379 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
928109609 2:28495959-28495981 CTTTGAAAGGGGGTAGTGGCGGG - Intronic
928159560 2:28909627-28909649 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
928321369 2:30285072-30285094 CTTGGGAAGGCCAAGGTGGATGG - Intronic
928443383 2:31312063-31312085 CTAGGAAGGGAGGAGATGGAGGG - Intergenic
928483427 2:31706610-31706632 GGTGGAAAGGGGGTGGTGGGGGG - Intergenic
928507770 2:31971617-31971639 CTTTGCAAGGCTGAGGTGGAAGG - Intronic
928574446 2:32640737-32640759 CTTTGAGAGGCTGAGGTGGACGG + Intronic
929178670 2:39008828-39008850 CCTGGAAAGGGGGCTGGGGAAGG + Intronic
929685018 2:44026089-44026111 CTTTGGAAGGCCGAGGTGGAAGG - Intergenic
929855002 2:45629503-45629525 CTTCGGAAGGCCGAGGTGGAAGG + Intergenic
929912647 2:46103883-46103905 GATGGAAAGGAGGAGGTGGAAGG + Intronic
929924113 2:46195214-46195236 CTTGGAAAGGGGGAGCAGCTAGG + Intergenic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930083824 2:47478038-47478060 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
930125357 2:47792087-47792109 CTTTGGTAGGGGGAGGTGGGTGG - Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930704301 2:54489075-54489097 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
931300763 2:60975842-60975864 GTTTGAAACGGGGAGGAGGAGGG - Intronic
931381517 2:61757824-61757846 CTTTGGGAGGCGGAGGTGGACGG + Intergenic
931707781 2:64961823-64961845 CTAGGAAAGAGAGAGGTGGTGGG - Intergenic
932253963 2:70267775-70267797 CGTGGAGAGGGAGAGGGGGAGGG + Intronic
932427012 2:71644341-71644363 CTTGGGAAGGGGTAGGGGGCTGG - Intronic
932429349 2:71664738-71664760 CCTGGAAAGGGAGAGAGGGAAGG + Intronic
932457374 2:71858182-71858204 CCTGGAAGGTGGGAGGTGGAGGG - Intergenic
932560856 2:72867500-72867522 CTTGGGAAGGCTGAGGTGGGAGG + Intergenic
932569197 2:72929022-72929044 CATGGAAAGGAGGATTTGGAGGG + Intronic
932912857 2:75822511-75822533 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
932926174 2:75977644-75977666 GATGGAATGGGGGAGGTGAAAGG + Intergenic
932964898 2:76461624-76461646 TTTTGAAAGGGCGAGGTGGGAGG - Intergenic
933148447 2:78885477-78885499 CTTGGAAGGGGGAGGGTGAAAGG + Intergenic
933450441 2:82442712-82442734 ATTGGAAAAGTGGAGGAGGAGGG + Intergenic
933642514 2:84778737-84778759 CTTTGGGAGGCGGAGGTGGAGGG - Intronic
933826680 2:86167723-86167745 CTTTGAGAGGCTGAGGTGGATGG - Intronic
935180497 2:100685616-100685638 CTTGGAAAGGGGGATGTGGCAGG - Intergenic
935228974 2:101079617-101079639 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
935351136 2:102152608-102152630 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
935736195 2:106108414-106108436 CTTGAAGTGGGGGAGATGGAAGG - Intronic
936116112 2:109704440-109704462 CTTGGGAAGGCTGAGGTGGGAGG + Intergenic
936157315 2:110056816-110056838 CTTGGAGAGGGGGATGCGGCAGG - Intergenic
936187379 2:110314628-110314650 CTTGGAGAGGGGGATGCGGCAGG + Intergenic
936378468 2:111963037-111963059 CTCGGAGAGGGGGATGTGGCAGG + Intronic
936487053 2:112935005-112935027 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
936770368 2:115905670-115905692 GTTGAAAAGGGGGATGTGGTGGG - Intergenic
937202453 2:120213071-120213093 TATGGAAAAGGGGAGGTGGGTGG - Intergenic
937207612 2:120246528-120246550 GTTAGGAAGGGGGAGGAGGAAGG - Intronic
937210288 2:120264393-120264415 CTTTGAGGGGCGGAGGTGGATGG - Intronic
937478461 2:122236140-122236162 CTTGGAAAGTTAAAGGTGGATGG - Intergenic
937584186 2:123525968-123525990 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
937629506 2:124084510-124084532 CTTTGAGAGGCTGAGGTGGATGG - Intronic
937928759 2:127188479-127188501 CTTGGGGAGGCGGAGGTGGGAGG - Intronic
937933235 2:127221486-127221508 CTTTGAGAGGCCGAGGTGGACGG + Intergenic
937955277 2:127418678-127418700 CCTGGAAAGAGGGAGGCGCATGG - Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938221942 2:129576573-129576595 CTTGCAGAGGAGGAGGAGGAGGG - Intergenic
938255538 2:129857449-129857471 CTGGGAATTGGAGAGGTGGAAGG + Intergenic
938692298 2:133802713-133802735 CTTTGAAAGGAGGAGGGTGAGGG + Intergenic
938698757 2:133857968-133857990 CTTGGAAAAGGTGGGGAGGAGGG - Intergenic
938757807 2:134396913-134396935 CTTGTAAAGGAGGAGGAGGCAGG + Intronic
938845165 2:135200997-135201019 CTTGGGGAGGCTGAGGTGGATGG - Intronic
938993765 2:136656122-136656144 ATTGTAAAGGGGGAGGCTGAGGG + Intergenic
939149036 2:138451195-138451217 CTTGGGTTGGGGGAGGTAGATGG - Intergenic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
939305893 2:140410918-140410940 CTAGCAAAGGGGGAGGTGAAAGG + Intronic
939344499 2:140946354-140946376 CTTTGAGAGGCTGAGGTGGATGG + Intronic
939433396 2:142141195-142141217 GTTTGAAAGGCCGAGGTGGATGG + Intergenic
939605610 2:144251950-144251972 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
939999358 2:148951456-148951478 CTTGGACAGTGGGAGGGGGTAGG - Intronic
940078501 2:149771480-149771502 CTTGGTGAGGGGGAGGGGAAAGG + Intergenic
940237816 2:151529771-151529793 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
940313721 2:152305792-152305814 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940434969 2:153640533-153640555 CTTTGGAAGGGTGAGGTGGGAGG + Intergenic
940526630 2:154824089-154824111 CTTTGGAAGGCCGAGGTGGATGG + Intronic
940696859 2:156990566-156990588 CTTTGGGAGGGCGAGGTGGACGG + Intergenic
941016964 2:160368720-160368742 ACTGGAAACCGGGAGGTGGAGGG - Intronic
941622981 2:167799337-167799359 CTTGCAAGGGGGAGGGTGGAGGG - Intergenic
941859427 2:170263481-170263503 CTCGGAGAGGGGGATGTGGCAGG + Intronic
941869878 2:170372939-170372961 CTTGGCATGGGGTAGGTGGGAGG + Intronic
941904478 2:170707621-170707643 CTTTGGGAGGTGGAGGTGGACGG - Intergenic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
943046339 2:182866421-182866443 CTTGCACAGGGGGATGCGGACGG + Exonic
943327767 2:186522241-186522263 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
943361032 2:186919608-186919630 CTTGGAAAGGAGTATGTGGATGG - Intergenic
943578243 2:189654435-189654457 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
943692083 2:190880174-190880196 CATGGGAGGGTGGAGGTGGAGGG - Intergenic
943937060 2:193933266-193933288 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
944217075 2:197267332-197267354 ATTAGAAAGGTGGAGGAGGATGG - Intronic
944483698 2:200182002-200182024 CTTGGAAGGGGGAAGGGGCAGGG - Intergenic
944533625 2:200688470-200688492 CTTGGCAAGGGTGAGGAGAAAGG - Intergenic
944803788 2:203261312-203261334 CTTGGAGAGGCTGAGGTGGGAGG + Intronic
944884289 2:204047228-204047250 ATTGGGTTGGGGGAGGTGGAAGG + Intergenic
944925218 2:204457208-204457230 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
945216709 2:207441977-207441999 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
945277053 2:207998401-207998423 ATTTGGAAGGGTGAGGTGGAAGG + Intronic
945321546 2:208429996-208430018 GTTGGAACTGGGGAAGTGGAAGG - Intronic
945506439 2:210647113-210647135 CAAGGAGAGGGGAAGGTGGAAGG + Intronic
945844594 2:214929232-214929254 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
946258690 2:218467183-218467205 CCTGGGCAGGGGGAGGGGGAAGG - Intronic
946264772 2:218529728-218529750 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
946447217 2:219750573-219750595 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
946540786 2:220682272-220682294 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
946751640 2:222897908-222897930 CGTGGAGAGGGAGAGGGGGAGGG + Intronic
946780726 2:223191229-223191251 CTCGGAGAGGGGGATGTGGCAGG - Intronic
947179684 2:227401053-227401075 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
947455428 2:230249758-230249780 CAAGGAAAGGGGCAGGTCGAGGG + Intronic
947500016 2:230664894-230664916 CTTGGATATGGGGAGGAAGAAGG - Intergenic
947730146 2:232423755-232423777 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
947897071 2:233685274-233685296 CTTTGAAAGGCGGAGGCGGGCGG - Intronic
947926346 2:233925626-233925648 CTTGGAAGGGGTGAGGAGGAAGG + Intronic
947953507 2:234168259-234168281 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
948020548 2:234729822-234729844 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
948449306 2:238059218-238059240 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
948589064 2:239037951-239037973 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
948677842 2:239609554-239609576 CTAAGAAGAGGGGAGGTGGATGG - Intergenic
948725336 2:239930656-239930678 GTGGGAAACAGGGAGGTGGAAGG + Intronic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
948939157 2:241187625-241187647 GGAGGAAAGGGGGAGGGGGAGGG + Intergenic
949076405 2:242061498-242061520 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1169125909 20:3126461-3126483 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1169159161 20:3361477-3361499 CAGGGAAAGTGGGAGGTGGGAGG + Intronic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169383086 20:5125988-5126010 CTTTGGAAGGCGGAGGCGGACGG + Intronic
1169485166 20:6024197-6024219 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1169581314 20:7026359-7026381 GTTGGAGGAGGGGAGGTGGAGGG + Intergenic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169658907 20:7956951-7956973 CTTGGACAGGGGGATGTGGCAGG - Intergenic
1170134182 20:13055010-13055032 CTAGGAAAGAGGCAGGTGGAAGG + Intronic
1170225718 20:13990246-13990268 CTTGGGAAGGGTGTGGGGGATGG - Intronic
1170451017 20:16483816-16483838 CTTGGAGAGGAGGGGGTGGTTGG - Intronic
1170579255 20:17685306-17685328 GGAGGAGAGGGGGAGGTGGAGGG + Intergenic
1171046206 20:21810843-21810865 CTTGGGAAGGTGGCAGTGGATGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171450707 20:25234032-25234054 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1171451938 20:25241999-25242021 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1171507833 20:25653383-25653405 CTTTGAGAGGTGGAGGTGGGTGG - Intergenic
1171525989 20:25811674-25811696 CTTTGGAAGGCCGAGGTGGAAGG - Intronic
1171550838 20:26044211-26044233 CTTTGGAAGGCCGAGGTGGAAGG + Intergenic
1171783266 20:29440490-29440512 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1172267035 20:33625254-33625276 CTTAGAGAGGCTGAGGTGGAAGG + Intronic
1172295036 20:33803671-33803693 CTTTGAGAGGCCGAGGTGGATGG - Intergenic
1172316520 20:33959243-33959265 CTTTGAGAGGTGGAGGTGGGCGG + Intergenic
1172324946 20:34027113-34027135 CATTGAACGGGGGATGTGGAGGG - Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172628830 20:36364849-36364871 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1172684771 20:36745654-36745676 CTTGGAGCGGGCGAGGTAGATGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173341625 20:42157587-42157609 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1173428838 20:42967791-42967813 CTTGGAGAGGGCGAGGCTGAAGG - Intronic
1173450695 20:43160995-43161017 CTTCGGAAGGCTGAGGTGGAAGG - Intronic
1173538356 20:43832709-43832731 CTTGGAAGGGAGGAGGTGTGGGG - Intergenic
1173583072 20:44160838-44160860 CTTGGGAAGGTGGAGGCGGATGG + Intronic
1173624584 20:44463110-44463132 CTTGGAGAGGCTGAGGTGGGCGG - Intronic
1174116894 20:48232418-48232440 CTGGGAGAGGGAGAGGTAGAGGG - Intergenic
1174198006 20:48786883-48786905 AGAGGAAAGGGAGAGGTGGAGGG + Intronic
1174204070 20:48827019-48827041 CTTGGAGATGGGGAGTTGGTGGG + Intronic
1174324731 20:49770161-49770183 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
1174346098 20:49931236-49931258 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1174883327 20:54304490-54304512 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1175011179 20:55738326-55738348 CTCGGAAGGGGGAAGATGGAGGG + Intergenic
1175112818 20:56660779-56660801 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1175116316 20:56685070-56685092 CTTGGAGAGGCTGAGGTGGGAGG + Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175506560 20:59489910-59489932 CTTCGAAAGGCCGAGGTGGGTGG + Intergenic
1175573434 20:60041377-60041399 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1175598211 20:60252534-60252556 CTTGGACAGGTGGAAGTGGCAGG - Intergenic
1175726105 20:61319700-61319722 CTTTGGGAGGTGGAGGTGGATGG + Intronic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1175945051 20:62554804-62554826 TTTGGAAAAGGGCAGGTGGCTGG + Intronic
1176797683 21:13381630-13381652 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1176852538 21:13934291-13934313 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1177022834 21:15884623-15884645 CTTGGGGAAGTGGAGGTGGATGG + Intergenic
1177097697 21:16858638-16858660 CTTGGAAAGTGCGGGGAGGAGGG + Intergenic
1177144950 21:17397585-17397607 CTTGGGAAGGCTGAGGTGGGAGG + Intergenic
1177153525 21:17478614-17478636 CTTTGGAAGGCCGAGGTGGAAGG - Intergenic
1177175105 21:17694410-17694432 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1177180431 21:17739086-17739108 CTAGGAAAGGGGGAGGTGGCAGG - Intergenic
1177199027 21:17932914-17932936 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1177278913 21:18952409-18952431 CTCCGAAAGTGGGAGCTGGATGG + Intergenic
1177672002 21:24244589-24244611 CTTTGGAAGGCCGAGGTGGAAGG + Intergenic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1177804461 21:25860434-25860456 CAAGGAGAGGTGGAGGTGGAGGG - Intergenic
1178039954 21:28629255-28629277 ATTAGAAAGGAGGAGGTGGGTGG + Intergenic
1178113329 21:29392232-29392254 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1178117383 21:29431414-29431436 CATGGAAAGGAGGGGGTAGAGGG - Intronic
1178195065 21:30335322-30335344 CTTGGTATGGGGGAGGTAGTGGG - Intergenic
1178335107 21:31735491-31735513 GTTGGAAAGGGGGACTTGGGAGG + Intergenic
1178375533 21:32064569-32064591 ATTGGACTGGGGGAGGGGGAGGG + Intergenic
1178565067 21:33676469-33676491 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1178669357 21:34577352-34577374 CTTTGAGAGGTGGAGGTGGGTGG + Intronic
1178964421 21:37102751-37102773 CTTGGAGAGGCTGAGGCGGATGG + Intronic
1178983666 21:37285237-37285259 CTTAGAAAGGCTGAGGTGGGTGG + Intergenic
1179024237 21:37667104-37667126 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1179037674 21:37773505-37773527 GGAGGAAAGGGGGAGGTGAAGGG - Intronic
1179814537 21:43896998-43897020 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1179878417 21:44283048-44283070 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1179986253 21:44921965-44921987 CTTTGGAAGGCAGAGGTGGATGG - Intronic
1180333660 22:11556101-11556123 CTTGGAGAGGGGTATGTGGCAGG + Intergenic
1180558474 22:16596647-16596669 CGTGGAAAGGGGAAGGGTGATGG + Intergenic
1180636957 22:17269240-17269262 CTAGGAAAGGTGAAGGTGGGGGG + Intergenic
1180745876 22:18088533-18088555 CTTTGGAAGGGTGAGGTGGGTGG + Exonic
1180844425 22:18973485-18973507 CTTGGGCAGAGGGAGGCGGAGGG - Intergenic
1180891759 22:19293878-19293900 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1181114688 22:20624001-20624023 CTTGGAGTGGGGGTGGTGGGGGG + Intergenic
1181149437 22:20872641-20872663 CTTTGGAAGGCGGAGGCGGATGG - Intronic
1181153250 22:20900419-20900441 CTTTGAAAGGCAGAGGTGGGAGG - Intergenic
1181315315 22:21967325-21967347 CGTGGAAAGGGGAGAGTGGAAGG + Intronic
1181534930 22:23536810-23536832 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1181570145 22:23763994-23764016 CTGGGAAAGGGAGAGATGGGAGG + Intronic
1181733432 22:24863982-24864004 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1181959200 22:26610785-26610807 CTTTGAAATGGGGAGAAGGATGG - Intronic
1181979972 22:26759474-26759496 CTTTTCAAGGGGGAGGTGTATGG - Intergenic
1182040240 22:27232812-27232834 CTTTGACAGGTGGAGGTGGGAGG + Intergenic
1182241541 22:28920207-28920229 CTTTGGGAGGGGGAGGTGGGTGG - Intronic
1182366764 22:29784400-29784422 CTTTGAAAGACGGAGGTGGGTGG - Intergenic
1182407807 22:30152572-30152594 CTTTGAGAGGGTGAGGTGGGAGG - Intronic
1182412591 22:30199864-30199886 CTTGGAGAGGCTGAGGTGGGTGG + Intergenic
1182556222 22:31129962-31129984 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1182848341 22:33450153-33450175 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1182875905 22:33690852-33690874 CATGGAAAGGTGTGGGTGGAGGG - Intronic
1183033674 22:35124442-35124464 CTTTGGGAGGGCGAGGTGGACGG + Intergenic
1183350536 22:37332292-37332314 CTTAGAAATGAGGAAGTGGAGGG + Intergenic
1183439989 22:37817755-37817777 CTTGGAATGAGCGAGATGGAAGG - Intergenic
1183470305 22:38002091-38002113 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1183472943 22:38019240-38019262 TTAGGAATGGGGGATGTGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183753849 22:39740655-39740677 CTTTGAAAGGCCGAGGTGGGAGG - Intergenic
1183899960 22:40997702-40997724 CTTGGGAAGGCCGAGGTGGGTGG - Intergenic
1183916271 22:41122407-41122429 CTTTGAGAGGTGGCGGTGGATGG - Intronic
1184013210 22:41765257-41765279 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1184198601 22:42949047-42949069 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1184380466 22:44142132-44142154 CTTTGAGAGGCCGAGGTGGATGG + Intronic
1184821943 22:46915955-46915977 CTTGGAAAGAAGGATGTGGTGGG + Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
949199580 3:1358825-1358847 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
949565609 3:5242414-5242436 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
949725647 3:7041294-7041316 CCTGGGAATGGGAAGGTGGAAGG - Intronic
949831693 3:8221762-8221784 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
949879175 3:8648487-8648509 CTAGGAAAAGGAAAGGTGGAAGG - Intronic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
950030333 3:9847856-9847878 CTCGGAGAGGGGGATGTGGCAGG + Intronic
950031049 3:9853830-9853852 CTCGGAGAGGGGGATGTGGCAGG + Intronic
950044443 3:9940716-9940738 GAGGGAAAGGGGGAGGGGGAGGG + Intronic
950204575 3:11068889-11068911 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
950387965 3:12674862-12674884 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
950389738 3:12687114-12687136 CATGGGGAGGTGGAGGTGGAAGG + Intergenic
950789684 3:15462271-15462293 CTTGGGGAGGCTGAGGTGGACGG - Intronic
950845511 3:16011870-16011892 CTTAGAAAAGGGGAGGGGGCTGG + Intergenic
951264066 3:20547329-20547351 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
951639635 3:24822293-24822315 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
951896246 3:27612432-27612454 CTTTGAGAGGTTGAGGTGGAAGG + Intergenic
951919469 3:27838603-27838625 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
952132544 3:30382665-30382687 CTTTGAGAGGTTGAGGTGGATGG - Intergenic
952247279 3:31607841-31607863 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
952380649 3:32801863-32801885 CTTTGAGAGGCCGAGGTGGACGG - Intergenic
952418051 3:33107439-33107461 TGTGGACAGGTGGAGGTGGAGGG - Intergenic
952463401 3:33553981-33554003 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
952523286 3:34184030-34184052 CTGGGAGAGGAGGTGGTGGAAGG - Intergenic
953059891 3:39418493-39418515 CTCAGAGAGGGGGAGGTGGCAGG + Intergenic
953270964 3:41444734-41444756 CTTTGAAAGGCCGAGGTGGACGG + Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
953366353 3:42348586-42348608 CTTGGAAAGGAAGAGGGGTAAGG + Intergenic
953405204 3:42656519-42656541 CTGGGACAGAGGGAGATGGATGG + Intronic
953481830 3:43258498-43258520 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953988773 3:47467359-47467381 CTTTGGAAGGCTGAGGTGGATGG + Intronic
954056489 3:48030143-48030165 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
954084157 3:48230910-48230932 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
954246592 3:49337039-49337061 CTTTGAGAGGCCGAGGTGGATGG + Intronic
954284103 3:49606671-49606693 ATACAAAAGGGGGAGGTGGAAGG - Intronic
954330961 3:49890062-49890084 TGTGGAAAGGGGGAGGTGAGGGG + Intronic
954524381 3:51256836-51256858 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
954808551 3:53234167-53234189 CTCAGAAAGGGAGAGGAGGAAGG - Intronic
955141817 3:56277304-56277326 CAGGGACAGGGGGAGGTGAAGGG + Intronic
955256742 3:57339330-57339352 CTCGGAGAGGGGGATGTGGCAGG - Intronic
955291231 3:57693963-57693985 CTAAGAAAGGAGGAGGTGGTAGG - Intergenic
955486228 3:59437586-59437608 CTTTGGGAGGCGGAGGTGGAAGG + Intergenic
955511656 3:59686992-59687014 CTTCGAACCCGGGAGGTGGAGGG + Intergenic
955600765 3:60642722-60642744 CCTGGAGCGGGGGAGGTGGGGGG - Intronic
955683384 3:61525948-61525970 CTTTGGAAGGGTGAGGTGGGAGG - Intergenic
955915801 3:63906758-63906780 CTTGGGAACTGGGAGTTGGATGG + Intronic
956121978 3:65975510-65975532 CTTTGGAAGGTGGAGGTGGGCGG + Intronic
956371495 3:68567805-68567827 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
957050907 3:75411146-75411168 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
957082212 3:75646072-75646094 CTTTGAGAGGGGGATGTGGCAGG - Intergenic
957187977 3:76967448-76967470 CTTTGGGAGGTGGAGGTGGATGG - Intronic
957742244 3:84285957-84285979 CTTTCAAACGGAGAGGTGGAGGG + Intergenic
957823262 3:85406950-85406972 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
957831975 3:85532997-85533019 CTTGGAGGGTGGGAGGTGGGAGG + Intronic
958020680 3:87991407-87991429 ATTGCAAAGGAGGAGGTGAATGG + Exonic
958047636 3:88304272-88304294 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
958744204 3:98113465-98113487 CTTGGGAAGGTGGAGGGGGGTGG - Intergenic
958858777 3:99420058-99420080 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
958943204 3:100336517-100336539 CTCGGAGAGGGGGATGTGGCAGG + Intronic
959054287 3:101552433-101552455 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
959072880 3:101719438-101719460 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
959402048 3:105914736-105914758 CTTTGGAAGGCCGAGGTGGACGG + Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959948528 3:112152208-112152230 CTCGGAGAGGGGGATGTGGCAGG + Intronic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
960541561 3:118867456-118867478 TTGGGAAATGGGGTGGTGGAGGG + Intergenic
960556717 3:119038119-119038141 TTTGCAAAGGGGGAGGGGGAGGG - Intronic
960652695 3:119969046-119969068 CTTGGGGAGGCGGAGGTGGGTGG + Intronic
960680639 3:120243924-120243946 GTTGGGGAGGAGGAGGTGGAGGG - Intronic
960750037 3:120938887-120938909 CTTGGGAAGGATGAGGTGGGAGG - Intronic
960801853 3:121547804-121547826 CTTTGGGAGGCGGAGGTGGACGG - Intergenic
960918732 3:122724691-122724713 CTTGGAGAGGGGGATGTGGCAGG + Intronic
960931844 3:122859601-122859623 CTTGGAGAGGCTGAGGTGGGAGG + Intronic
960987696 3:123291432-123291454 CACGGAGAGGAGGAGGTGGAGGG - Intronic
961160564 3:124721218-124721240 CTTGGATGGGATGAGGTGGAGGG - Intronic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
961883197 3:130077581-130077603 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
962295099 3:134176493-134176515 CTTGGGAAGGCTGAGGTGGGAGG + Intronic
962334624 3:134516127-134516149 CTCGGAGAGGGGGATGTGGCAGG + Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962387941 3:134948035-134948057 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
962558651 3:136582553-136582575 CTTGGAGAGGCTGAGGTGGGTGG + Intronic
962572976 3:136729820-136729842 CTTTGAGAGGGCGAGGTGGGTGG - Intronic
963138026 3:141925221-141925243 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
963202044 3:142596230-142596252 CGTGGATGGGGAGAGGTGGACGG - Intergenic
963413649 3:144964687-144964709 CTTTGGAAGGCGGAGGTGGGCGG - Intergenic
963614330 3:147516581-147516603 CTTTGGAAGGCGGAGGCGGACGG - Intergenic
964358208 3:155869925-155869947 GTTGCCAAGGGGTAGGTGGAGGG + Intergenic
964600082 3:158490325-158490347 CTTTGGAAGGGTGAGGTGGGTGG - Intronic
964692153 3:159461964-159461986 CTTTGAAAGGCCGAGGTGGGCGG + Intronic
964717899 3:159741984-159742006 CTTGGAGAGGCTGAGGTGGGCGG + Intronic
964722690 3:159783002-159783024 GTTGGGAAGGGGGAAGTTGAGGG + Intronic
964985070 3:162727231-162727253 ATTGAATAGGGGGAGGGGGAGGG - Intergenic
965266662 3:166552296-166552318 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
965302520 3:167019628-167019650 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
965354213 3:167654035-167654057 GTTGGAGAGGGGGAAGTGAAAGG - Intergenic
965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG + Intergenic
965947073 3:174255900-174255922 CTTGGGGAGGGCGAGGTGGGCGG - Intronic
966378004 3:179316771-179316793 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
966623630 3:181993061-181993083 TGTGGCAAGGGGGAGGGGGAGGG + Intergenic
966920096 3:184605396-184605418 GTTGGAAGTGGGGAGGAGGAAGG + Intronic
966934135 3:184694771-184694793 CTTAGAAATGGGGCGGAGGAGGG - Intergenic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
967247725 3:187504818-187504840 CTTTGAGAGGGTGAGGTGGGAGG - Intergenic
967418856 3:189251565-189251587 CTTAGAGAGGGGGATGTGGCAGG + Intronic
967738180 3:192976015-192976037 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
968065077 3:195754001-195754023 CCTGGAAAGGGGGTGGTGGATGG - Intronic
968129535 3:196184844-196184866 CTTGGACAGGGGCAGGTGCAGGG - Intergenic
968156675 3:196386330-196386352 CTCGGAGAGGGGGATGTGGCAGG - Intronic
968217038 3:196901286-196901308 CTTTGGGAGGGGGAGGTGGGCGG - Intronic
968367620 3:198199166-198199188 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968369222 3:198211968-198211990 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968482279 4:839413-839435 CTTGGAGAGGCTGAGGTGGGTGG - Intergenic
968527289 4:1067619-1067641 CTTTGGAAGGCTGAGGTGGATGG + Intronic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968852606 4:3093958-3093980 CTTGGAGAGGGGGATTTGGCAGG + Intronic
968859538 4:3155466-3155488 CTTTGAGAGGCTGAGGTGGACGG - Intronic
969293077 4:6252947-6252969 GATGGAAAGAGGGAGGTGGGCGG - Intergenic
969331895 4:6478627-6478649 CTGGCAAAGGGGGAGGTAGCAGG - Intronic
969413278 4:7043231-7043253 CTGGGAAAGGCGGCGGTGGCCGG + Intronic
969448697 4:7260375-7260397 CCTGGGAGGGGGGAGGTGGGAGG - Intronic
969486199 4:7473736-7473758 CTTGGCAATGGGGAGGTGGGAGG + Intronic
969523675 4:7693357-7693379 CTTGGCAAAGGGGTGGTGGGAGG - Intronic
969572644 4:8018887-8018909 TGTGGAAAGGGCGGGGTGGAGGG + Intronic
969595993 4:8149572-8149594 CCTTGAAAGGGAGAGGAGGAGGG + Intronic
969740149 4:9018655-9018677 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
970631059 4:17945512-17945534 CTTGGAAAGGGAGAAAAGGAGGG - Intronic
970741608 4:19246218-19246240 CTTTGGGAGGCGGAGGTGGACGG + Intergenic
970950512 4:21750082-21750104 CCTGGAGAGAGGGAGGAGGATGG - Intronic
970981156 4:22098879-22098901 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
971364503 4:25966951-25966973 CTTTGAGAGGGTGAGGTGGGCGG - Intergenic
971767730 4:30854781-30854803 CTTGGAAAAGTGGAAGAGGAGGG + Intronic
972190825 4:36588527-36588549 CAGGGAAAGGGGTAGGTGTAGGG - Intergenic
972221927 4:36965828-36965850 CATGGAAAGCGGGAGGTGTATGG + Intergenic
972624888 4:40787275-40787297 CTCGGAGAGGGGGATGTGGCAGG - Intronic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
973263171 4:48185785-48185807 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973263183 4:48185810-48185832 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973755221 4:54067455-54067477 GTTGGCAGGGCGGAGGTGGAGGG - Intronic
973818847 4:54644642-54644664 CTTGTAGTGGGGGAGGTGGGAGG + Intergenic
974003516 4:56533702-56533724 CTTTGAGAGGCCGAGGTGGAAGG + Intronic
974008409 4:56584208-56584230 CCTTGAAAGGTGGAGGTGGGAGG - Intronic
974154323 4:58051488-58051510 CTTTGAGAGGGCGAGGTGGGTGG + Intergenic
974360735 4:60876008-60876030 CTTTGAGAGGGTGAGGTGGGTGG - Intergenic
974396663 4:61345039-61345061 CTTTGAAAGGCCGAGGCGGATGG - Intronic
974766886 4:66358951-66358973 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
974848943 4:67382319-67382341 CTTGGAGAGGGGGTTGTGGCAGG - Intergenic
975112938 4:70647419-70647441 CTTTGGGAGGCGGAGGTGGATGG - Intronic
975354985 4:73391707-73391729 CATGGAAAGGGGGAAATGGGAGG - Intergenic
975624023 4:76324428-76324450 CTTGGGAAGGCTGAGGTGGGTGG - Intronic
975653500 4:76618194-76618216 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
975687270 4:76929758-76929780 CTTGGGGAGGCAGAGGTGGAAGG + Intergenic
975825891 4:78319199-78319221 CTTGGAAAAGGTGGAGTGGAAGG - Intronic
976189016 4:82471434-82471456 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
976218499 4:82736907-82736929 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
976976335 4:91169151-91169173 CTCGGAGAGGGGGATGTGGCAGG - Intronic
977256536 4:94747058-94747080 TTTGGAAGGTGGAAGGTGGAAGG + Intergenic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
978110390 4:104956884-104956906 TATGGAAATGGGGAGGTGTAAGG - Intergenic
978124827 4:105123182-105123204 CTTGGGGAGGCTGAGGTGGAAGG + Intergenic
978225054 4:106322237-106322259 CTTGGAGAGGGGGATTTGGGAGG - Intronic
978499781 4:109396826-109396848 CTTTGAAAGGCTGAAGTGGATGG + Intergenic
978527029 4:109677858-109677880 CTCGGAGAGGGGGATGTGGCAGG + Intronic
978840702 4:113208744-113208766 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
978978857 4:114916776-114916798 CTTGGAAAGGCTGAGGTGGGAGG - Intronic
979256035 4:118608878-118608900 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979257647 4:118621696-118621718 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979330700 4:119418866-119418888 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
979332309 4:119431659-119431681 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
980104111 4:128570758-128570780 ATTGGAAAGGGGGCGGTGACTGG - Intergenic
980541748 4:134204276-134204298 CTTAGAGAGGCTGAGGTGGAGGG - Intergenic
980785554 4:137549781-137549803 CTTTGAAAGGCCCAGGTGGAAGG + Intergenic
981995122 4:150965785-150965807 CTTTGCAAGGCCGAGGTGGAAGG - Intronic
982055473 4:151544964-151544986 CTTGGAGAGGCTGAGGTGGGAGG + Intronic
982141489 4:152324465-152324487 GTAGGAAAGGGGGAAGAGGATGG + Intronic
982329542 4:154165739-154165761 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
982440036 4:155424431-155424453 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
982454675 4:155594522-155594544 CTTTGAGAGGGAGAGGTGGGAGG + Intergenic
982711214 4:158760265-158760287 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
982759949 4:159269765-159269787 CTTTGAGAGGCAGAGGTGGAAGG + Intronic
982766035 4:159349694-159349716 CTTGGAAAGGGGTAGCTCAAGGG - Intronic
983045992 4:162986502-162986524 TTTGGTGAGGGGGAGGTGAAAGG + Intergenic
983215946 4:165002698-165002720 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
983301924 4:165936682-165936704 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
983917709 4:173310314-173310336 CTTGGTAAGGGGGAGGGACAGGG - Intronic
983934514 4:173491884-173491906 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
984060488 4:174983915-174983937 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
984080143 4:175238021-175238043 CTTGGAAAGGCCGAGGTGGGCGG - Intergenic
985059027 4:186057974-186057996 GGTGGATAGCGGGAGGTGGATGG - Intergenic
985245385 4:187975259-187975281 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
985304214 4:188521419-188521441 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
985377506 4:189356281-189356303 CTTGGGAAGTGGGAGGTAAACGG + Intergenic
986157786 5:5193855-5193877 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
986170006 5:5307466-5307488 TTTGGAGAGATGGAGGTGGAAGG + Intronic
986279210 5:6309701-6309723 ATTGAAAAGTGGGAGGTAGAAGG - Intergenic
986732947 5:10648885-10648907 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
986852850 5:11833044-11833066 CTTGGAAATGGAAAAGTGGATGG + Intronic
987031078 5:13977565-13977587 CCAGGAAAGAGGGAGGAGGAGGG - Intergenic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987510701 5:18834286-18834308 CTTTGGGAGGGCGAGGTGGATGG - Intergenic
987761028 5:22163122-22163144 CTTGGAGAGGCCGAGGTGGGCGG - Intronic
987764442 5:22206968-22206990 CTTTGGGAGGCGGAGGTGGATGG + Intronic
988152292 5:27399809-27399831 CTGGGATGGGGGGAGGGGGAAGG + Intergenic
988533028 5:32041795-32041817 CTCGGAGAGGGGGATGTGGCAGG - Intronic
988562848 5:32296554-32296576 CTTTGGAAGGGTGAGGTGGTGGG + Intronic
988967316 5:36432338-36432360 TTGGGATAGTGGGAGGTGGATGG + Intergenic
988980654 5:36564779-36564801 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
989056586 5:37371351-37371373 GTTGGATAGGGTGAGGAGGAAGG + Intergenic
989071704 5:37518728-37518750 CTCGGAGAGGGGGATGTGGCAGG + Intronic
989085558 5:37672668-37672690 CTTGGCAAGGGGAATGTGGCAGG - Intronic
989123440 5:38027557-38027579 GTTGGAGACGGGGAGGTGGTGGG - Intergenic
989314654 5:40063679-40063701 CTTGGAAAGGTGGAGGTGTGGGG - Intergenic
989574865 5:42979817-42979839 CATGGAGAGAGGGAGGGGGAGGG - Intergenic
989583854 5:43058891-43058913 CTTGGTGAGGGGGATGTGGCAGG - Intergenic
989586406 5:43077218-43077240 CTTGGCGAGGGGGATGTGGCAGG + Intronic
989594069 5:43139970-43139992 CTTTGGAAGGCTGAGGTGGATGG + Intronic
989743571 5:44800501-44800523 CTTTGAGAGGTCGAGGTGGAAGG + Intergenic
989837362 5:46009147-46009169 CTCAGAGAGGGGGAGGTGGCAGG + Intergenic
989991592 5:50773879-50773901 CTTGGAGAGGGGGATGTGGCAGG + Intronic
990235228 5:53760049-53760071 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
990468958 5:56095727-56095749 ATTGGAAGGTGGGAGGAGGACGG - Intergenic
990616887 5:57517943-57517965 CTCGGACAGGGGGATGTGGCAGG + Intergenic
991203744 5:64024951-64024973 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
991690567 5:69221138-69221160 CTCGGAGAGGGGGATGTGGCAGG - Intronic
991899180 5:71440094-71440116 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
991935086 5:71793352-71793374 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992026686 5:72676987-72677009 CTTTGAGAGGGGGAGGCGGGTGG - Intergenic
992304532 5:75422506-75422528 CTTGGGAAGGCTGAGGTGGGAGG + Intronic
992320662 5:75610877-75610899 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
992405076 5:76449090-76449112 CTTGGAAGGGTGGAGGGGAATGG + Intronic
992534843 5:77689421-77689443 CTTGGGAAGGGGTGGGTGGGTGG - Intergenic
992540797 5:77761589-77761611 CTCGGAGAGGGGGATGTGGCAGG - Intronic
992666798 5:79018280-79018302 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
992889358 5:81189600-81189622 CTTTGGGAGGCGGAGGTGGAAGG - Intronic
992914534 5:81434412-81434434 CTTTGAGAGGCCGAGGTGGATGG + Intronic
992953967 5:81889216-81889238 CCTAGAAAGGGAGAGATGGAAGG + Intergenic
993097712 5:83499456-83499478 AATGGAAAGGTGGTGGTGGAAGG - Intronic
993251915 5:85538173-85538195 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
993485494 5:88479224-88479246 TTTGGAGAGGGGGGGTTGGAGGG + Intergenic
993505581 5:88705063-88705085 CTTTGAGAGGTTGAGGTGGAAGG + Intergenic
993707401 5:91186629-91186651 CTTGGAATGGGTGAGGAAGAAGG + Intergenic
993925453 5:93860049-93860071 CTTGGGGAGGCTGAGGTGGATGG + Intronic
994134818 5:96274042-96274064 CTTGGGAAAAGGGAGATGGAAGG + Intergenic
994357865 5:98814661-98814683 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
994411207 5:99409367-99409389 CTTTGGAAGGCCGAGGTGGAAGG - Intergenic
994482623 5:100355896-100355918 CTTTGGAAGGCCGAGGTGGAAGG + Intergenic
994569193 5:101491894-101491916 CTTTGAAAGGCCGAGGTGGGTGG + Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
994901231 5:105772266-105772288 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
994924764 5:106100605-106100627 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
994936471 5:106259368-106259390 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
995028574 5:107452616-107452638 CTTGGAAGGGCTGAGGTGGGAGG + Intronic
995525437 5:113047039-113047061 GTTGAAGAGGGGCAGGTGGAGGG - Intronic
996391727 5:122969894-122969916 CTTGAATAGGGGTAGGTGGGTGG - Intronic
996509227 5:124300326-124300348 ATCGGAAACAGGGAGGTGGAAGG - Intergenic
996817121 5:127586855-127586877 CTTAGCAAGGGGCAGCTGGAGGG - Intergenic
996862366 5:128082115-128082137 CTTGGAGAGGCGGAGGTGGGCGG + Intergenic
997025794 5:130059438-130059460 TTGGGAGAGGGGGAGGGGGAAGG - Intronic
997285579 5:132675791-132675813 CTTTGAGAGGCCGAGGTGGACGG - Intronic
997433405 5:133857215-133857237 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
997870434 5:137501131-137501153 TTTGGAAACGGGGTGGGGGATGG - Intronic
997871334 5:137507633-137507655 GTTGCAAAGGGGCAGGTGGAAGG - Intronic
998016838 5:138739010-138739032 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
998435165 5:142101864-142101886 CTTTGGGAGGGGGAGGTGGGTGG + Intergenic
998828464 5:146131732-146131754 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
998890083 5:146736630-146736652 CTAGGAAAGGGGGTGGTGCTGGG - Intronic
999176024 5:149632267-149632289 AAAGGAAAGGTGGAGGTGGAAGG + Exonic
999254754 5:150204131-150204153 CTTGCAAAGAGGAAGATGGAGGG - Intronic
999265623 5:150265064-150265086 TTTGAGAAGGGGGAGATGGAGGG - Intronic
999295035 5:150453954-150453976 CTTGGAGAGAGGGATGTGGCAGG + Intergenic
999401288 5:151266233-151266255 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
999616279 5:153428113-153428135 CTTGGGGAAGGGGAGATGGAAGG - Intergenic
999719462 5:154388133-154388155 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
999903388 5:156112021-156112043 CTTTGAGAGGCTGAGGTGGATGG - Intronic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
1000096536 5:157975995-157976017 CTAGGTATGTGGGAGGTGGAGGG + Intergenic
1000103225 5:158036408-158036430 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1000124603 5:158231503-158231525 GTTGGGTGGGGGGAGGTGGAAGG + Intergenic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000351204 5:160354332-160354354 CTTTGGAAGGGCGAGGTAGATGG + Intronic
1000486392 5:161849056-161849078 CTGGGGGAGGGGGAGGTTGAAGG + Intronic
1001071321 5:168587601-168587623 CTGGGCAAGTGGGTGGTGGATGG - Intergenic
1001379357 5:171293443-171293465 CTTGGAGAGAGGGAGGGGAATGG - Intronic
1002050445 5:176567734-176567756 CTTTGAGAGGTGGAGGTGGGCGG - Intronic
1002118767 5:176985045-176985067 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1002126858 5:177052054-177052076 CTTGGGAAGGCTGAGGTGGGAGG + Intronic
1002172374 5:177382609-177382631 GTTGGAAACGAGGAAGTGGAGGG + Intronic
1002295374 5:178227835-178227857 CATGGAGATGGAGAGGTGGAGGG + Intronic
1002377508 5:178798820-178798842 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1002726843 5:181304395-181304417 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1002728500 5:181317553-181317575 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1002816669 6:687424-687446 CTTTGAGAGGCCGAGGTGGAAGG - Intronic
1002845212 6:939282-939304 CTTGGCAAGGGGCATGGGGAGGG + Intergenic
1002904138 6:1435232-1435254 GTTGTAAAGAGGGAAGTGGAAGG + Intergenic
1002934203 6:1657906-1657928 CTTTAAAAAGGGGAGGGGGATGG - Intronic
1002970415 6:2011668-2011690 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1003145069 6:3503481-3503503 ATTGGGAAGGTGGAGGAGGAGGG + Intergenic
1003268010 6:4583568-4583590 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004034327 6:11908063-11908085 TTTGGAAGGTGGGAGGTTGAGGG + Intergenic
1004124213 6:12856497-12856519 CTTTGGAAGGCTGAGGTGGACGG - Intronic
1004136693 6:12974161-12974183 CTTTGCAAGGCGGAGGTGGGTGG - Intronic
1004662560 6:17723024-17723046 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1004691402 6:17995390-17995412 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1004717005 6:18227486-18227508 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1004721803 6:18274250-18274272 CTTTGAGAGGGTGAGGTGGGAGG - Intergenic
1005089396 6:22041130-22041152 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1005293357 6:24400246-24400268 CCTGGAGAGGGGGATGTGGCAGG + Intergenic
1005453839 6:25999981-26000003 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1005495385 6:26383487-26383509 CTCGGGGAGGGGGAAGTGGAGGG + Intronic
1005525358 6:26642258-26642280 CTTGGTGAGGGGGATGTGGCAGG - Intronic
1005534898 6:26745420-26745442 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1005629707 6:27696028-27696050 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1005901611 6:30221528-30221550 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1005956424 6:30666562-30666584 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1006093101 6:31639701-31639723 CATGGAAAGGGTGAGCCGGATGG - Intronic
1006194870 6:32233608-32233630 CTTTGAGAGGCGGAGGTGGGCGG - Intergenic
1006471998 6:34234952-34234974 CTTGGAGAGCGCGAAGTGGAGGG + Intergenic
1006648612 6:35532924-35532946 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
1006648655 6:35533272-35533294 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1006689026 6:35863618-35863640 CATGGGGAGGGGGAGGTGGAGGG + Intronic
1006983988 6:38166004-38166026 CGGGTAGAGGGGGAGGTGGAGGG - Intergenic
1007036230 6:38676695-38676717 TTTGGGAAAGGGGAGGAGGAAGG - Exonic
1007295295 6:40816514-40816536 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007403720 6:41620249-41620271 CTTCGGAAGGTGGAGGTGGGAGG - Intergenic
1007697760 6:43744534-43744556 CTTGGAATGAGGGAGGAAGATGG + Intergenic
1007792287 6:44317392-44317414 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1008094095 6:47321227-47321249 CTTGTAAAGAAGGAAGTGGAGGG - Intergenic
1008514414 6:52306290-52306312 CCAGGAGAGGTGGAGGTGGAGGG + Intergenic
1008598824 6:53068891-53068913 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1008823119 6:55657902-55657924 TTTGGAGAGTGGAAGGTGGAAGG + Intergenic
1008936806 6:57000524-57000546 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1009508395 6:64516292-64516314 TTTGGAGAGTGGAAGGTGGAAGG + Intronic
1009512004 6:64564522-64564544 CTTTGGGAGGCGGAGGTGGACGG - Intronic
1009575797 6:65457406-65457428 CTTAGGAAGGCTGAGGTGGAAGG - Intronic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010237129 6:73584315-73584337 CTTTGAGAGGCCGAGGTGGATGG + Intergenic
1010240683 6:73612806-73612828 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1010317404 6:74467016-74467038 CTTAGAAAAGTGGAAGTGGAAGG - Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011048033 6:83108419-83108441 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
1011184488 6:84659077-84659099 TATGGAAAGGGGTAAGTGGAAGG + Intergenic
1011317061 6:86046382-86046404 CTTTGAAAGGCTGAGGTGGTAGG - Intergenic
1011504027 6:88021713-88021735 CTAGGAAATGTGGACGTGGAAGG - Intergenic
1011513724 6:88129264-88129286 CTTCGAGAGGCTGAGGTGGATGG + Intergenic
1011634477 6:89358252-89358274 CTTTGGGAGGTGGAGGTGGAGGG + Intergenic
1011904341 6:92343458-92343480 CTTTGAAAGGCTGAGGTGGAAGG - Intergenic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1012837192 6:104284176-104284198 TTTGGAAAGTGAGAGGTAGAAGG + Intergenic
1012899762 6:104991996-104992018 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1013003568 6:106049057-106049079 CTTGGGGAGGCCGAGGTGGATGG - Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013111209 6:107066714-107066736 GGTGGGAAGGGGGAGGTGGTGGG + Exonic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013335531 6:109155943-109155965 TTTGGAAAGGGGTAGGTATAAGG - Intronic
1013386910 6:109640658-109640680 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1014344344 6:120248988-120249010 TTTGGAAGGGGGTAGGGGGAAGG + Intergenic
1014546183 6:122739226-122739248 CTTTGAAAGGCAGAGGTGGATGG + Intergenic
1014806010 6:125830443-125830465 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1014980689 6:127943017-127943039 CTTGGAAGGGGGTTGGGGGAAGG - Intergenic
1015253914 6:131156528-131156550 CTTGGAGAGGCTGAGGTGGGAGG + Intronic
1015398143 6:132758284-132758306 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1015812327 6:137173126-137173148 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1016031952 6:139346956-139346978 CTTTGGGAGGAGGAGGTGGACGG + Intergenic
1016749815 6:147620186-147620208 CGTGGAGAGTGGGTGGTGGATGG - Intronic
1016850144 6:148610675-148610697 CTTAGAAAGGGGGTGGCAGATGG - Intergenic
1016980729 6:149851717-149851739 CTTGGAAGGGGTGTTGTGGAAGG + Intronic
1017019360 6:150127827-150127849 CTTGCAAAAAGGAAGGTGGAGGG - Intergenic
1017025130 6:150174719-150174741 CTTTGGGAGGTGGAGGTGGACGG + Intronic
1017468150 6:154714178-154714200 TTTGGAAAGGTTGAGGTGGCCGG - Intergenic
1017540031 6:155391604-155391626 CTTGGAGATGGTGGGGTGGAGGG + Intergenic
1017544673 6:155438275-155438297 CTTGGGATGGGCAAGGTGGATGG - Intronic
1017841007 6:158222985-158223007 CTTTGCAAGGGCGAGGTGGGAGG + Intergenic
1017855543 6:158348217-158348239 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1018009065 6:159651281-159651303 CTTGGGAAGGCTGAGGTGGGCGG + Intergenic
1018068521 6:160140838-160140860 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1018215306 6:161520469-161520491 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1018254633 6:161905715-161905737 CTTGGAGAGGCCGAGGTGGGCGG + Intronic
1018261996 6:161979515-161979537 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1018351732 6:162966717-162966739 CTTTGGGAGGGGGAGGTGGGTGG - Intronic
1018597715 6:165501025-165501047 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1019012739 6:168855122-168855144 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1019159073 6:170057611-170057633 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019159097 6:170057658-170057680 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019933803 7:4241389-4241411 CTTTGAGAGGCCGAGGTGGAAGG + Intronic
1020002725 7:4764964-4764986 CGTGGAAAGGGGGTGGTGGATGG + Exonic
1020031339 7:4934940-4934962 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1020174693 7:5872828-5872850 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1020317219 7:6914313-6914335 TTTTGAAAGGCTGAGGTGGATGG + Intergenic
1021346846 7:19539459-19539481 CTTGGAAAGAGGGAAGTTCATGG + Intergenic
1021712283 7:23427626-23427648 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1021733947 7:23624384-23624406 CTTTGAGAGGCCGAGGTGGAAGG - Intronic
1021747511 7:23757411-23757433 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1021995519 7:26175901-26175923 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1022104260 7:27187179-27187201 CTTGTAAAGGTGGTGGTGGGGGG - Intergenic
1022375605 7:29807849-29807871 TCTGGAAAGGAGGAGGCGGAGGG - Intronic
1022757235 7:33305087-33305109 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1023383301 7:39629970-39629992 CTTGGGGAGGCTGAGGTGGACGG - Intronic
1023399631 7:39782955-39782977 GGAGGAAAGGGGGAGGTGGAGGG + Intergenic
1023645023 7:42302513-42302535 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1023659789 7:42459965-42459987 CTTTGAAAGGGTGAGGCAGAAGG - Intergenic
1023891325 7:44393961-44393983 CTTGGAGGTGGGAAGGTGGAAGG - Intronic
1023962569 7:44939341-44939363 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1024071736 7:45792008-45792030 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024072567 7:45798759-45798781 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024148184 7:46538444-46538466 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1024391509 7:48818290-48818312 CTTTGAAAGGTTGAGGTGGGTGG + Intergenic
1024574398 7:50752431-50752453 CTTGGAAAGAGAAAGGTGAAAGG + Intronic
1024650765 7:51401423-51401445 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1024910543 7:54443488-54443510 CGTAGAAAGAGGGAGGGGGAGGG - Intergenic
1025054886 7:55757003-55757025 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025068905 7:55881948-55881970 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
1025132959 7:56387229-56387251 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025184595 7:56847652-56847674 GGTGGGAAGGGGGAGGTGGAGGG - Intergenic
1025227111 7:57175376-57175398 CTTGGGGAGGCTGAGGTGGAAGG + Intergenic
1025266646 7:57465591-57465613 CTTTGAGAGGCCGAGGTGGAAGG - Intronic
1025687334 7:63729316-63729338 GGTGGGAAGGGGGAGGTGGAGGG + Intergenic
1025873717 7:65460469-65460491 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1025898150 7:65722976-65722998 CTTTGAAAGGCTGAGGAGGATGG - Intergenic
1025909519 7:65817114-65817136 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1025911032 7:65828837-65828859 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1025949912 7:66136471-66136493 CTTTGAGAGGTCGAGGTGGATGG - Intronic
1025959454 7:66206926-66206948 TTTGGAGAGGGGGAGGGAGAGGG - Intronic
1025980727 7:66403186-66403208 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1026000750 7:66557854-66557876 CTAGGACAGGGGCAGATGGAGGG + Intergenic
1026034553 7:66821642-66821664 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1026328988 7:69335833-69335855 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1026331912 7:69359524-69359546 CTTGGGAGGGCGGAGGTGGGAGG + Intergenic
1026409805 7:70108514-70108536 ATTGGGAAGGGGGAAGTGTAGGG - Intronic
1026641356 7:72128625-72128647 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1026729014 7:72895069-72895091 CTTTGGAAGGTGGAGGTGGGAGG - Intronic
1026778598 7:73248070-73248092 CTTTGAAAGGTGGAGGCGGGCGG + Intergenic
1026829511 7:73602425-73602447 CTTTGAGAGGCTGAGGTGGACGG + Intronic
1026999449 7:74642163-74642185 CTTTGAAAGGCCGAGGTGGGAGG + Intergenic
1027130136 7:75584822-75584844 AATGGAAAGTGGGAGGAGGAAGG - Intronic
1027131805 7:75596627-75596649 CTTTGGAAGGTGGAGGCGGATGG - Intronic
1027143973 7:75681154-75681176 CTTTGAAAGGCCGAGGCGGACGG - Intronic
1027162777 7:75814455-75814477 CTTGGGGAGGCTGAGGTGGAAGG + Intronic
1027183121 7:75953305-75953327 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1027710767 7:81598831-81598853 CTTTGAAAGGCTGAGGTGGAAGG + Intergenic
1027752321 7:82165160-82165182 TTAGGAAATGGGGAGGTAGAAGG - Intronic
1027890525 7:83967509-83967531 CTTTGGAAGGCTGAGGTGGACGG + Intronic
1027950132 7:84804667-84804689 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1028399158 7:90405854-90405876 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1028440318 7:90852138-90852160 TTTTGAAAGGTGGAGGTGGGAGG - Intronic
1029089087 7:98034097-98034119 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1029280503 7:99432508-99432530 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1029308022 7:99635568-99635590 CTGGAAATGGGGGAGGGGGAAGG - Intergenic
1029374241 7:100168379-100168401 CATGGGAAGGGAGAGATGGATGG - Intronic
1029433789 7:100549933-100549955 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1029505263 7:100960069-100960091 CCTGGACAGGGTGTGGTGGAGGG - Exonic
1029680516 7:102105754-102105776 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1029837308 7:103326219-103326241 CTTTGGAAGGCCGAGGTGGACGG - Intronic
1029927224 7:104329694-104329716 CTGGGAAAGGGGGCGGGGGGCGG + Intronic
1030028413 7:105347430-105347452 CTTTGAGAGGGTGAGGTGGGAGG - Intronic
1030109458 7:106014177-106014199 CTTGGGGAGGTGGAGGTGGGAGG - Intronic
1030329204 7:108255176-108255198 CGTGGAAAGTGGGAGGGGCAGGG - Intronic
1030667009 7:112289831-112289853 CTTGGGGAGGCTGAGGTGGAAGG - Intronic
1030885991 7:114938197-114938219 CTTGGGAAGGCCGAGGTGGGTGG - Intronic
1031083208 7:117278117-117278139 CTTGTAGAAGGGAAGGTGGATGG + Exonic
1031279451 7:119778864-119778886 ATTTGAAAGGCTGAGGTGGAAGG - Intergenic
1031779149 7:125940471-125940493 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1031931999 7:127694939-127694961 CTTGGAAAAGGTGAGCTGCAGGG + Exonic
1032015265 7:128375958-128375980 CTTTGGGAGGTGGAGGTGGATGG + Intergenic
1032048353 7:128629614-128629636 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032049954 7:128642437-128642459 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032179698 7:129664124-129664146 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1032257642 7:130310008-130310030 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1032349229 7:131144732-131144754 CTTTGAGAGGGCGAGGTGGGCGG + Intronic
1032354158 7:131194091-131194113 CTTTGAGAGGCCGAGGTGGATGG - Intronic
1032589210 7:133176936-133176958 CGTGGGAAGGGGGAGGGGGAGGG - Intergenic
1032592089 7:133200827-133200849 CTTGGGGAGGCCGAGGTGGATGG - Intergenic
1032800652 7:135314968-135314990 CTTTGAAAGGCCGAGGTGGGAGG + Intergenic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033185971 7:139226916-139226938 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1033212172 7:139468157-139468179 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1033305414 7:140221956-140221978 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
1033400655 7:141021015-141021037 CTTTGAAAGGCTGAGGCGGAAGG + Intergenic
1033482004 7:141751881-141751903 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1034263781 7:149772205-149772227 GCTGGAAAGGGGGAGGGGAAGGG - Intronic
1034334845 7:150314697-150314719 CTTGGGAAGGCTGAGGTGGGTGG + Intronic
1034483522 7:151341690-151341712 CTTGGAAAGAGGGTTGTGGGCGG - Exonic
1034576611 7:152005343-152005365 CTTAGAAAAGGGCAGGTGGCTGG - Intronic
1034618843 7:152441349-152441371 CGTGGAAAGGGGAAGGGCGATGG - Intergenic
1034748026 7:153541315-153541337 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1034819348 7:154202564-154202586 CTCGGAAAGGGGCAGAAGGATGG - Intronic
1034851492 7:154498228-154498250 CTTGGACTGAGCGAGGTGGAAGG + Intronic
1035392740 7:158516234-158516256 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1035466582 7:159083470-159083492 TATGGAAAGGTGGAGCTGGAAGG - Intronic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1036401393 8:8411964-8411986 CCAGCAAAAGGGGAGGTGGAGGG + Intergenic
1036555867 8:9859987-9860009 CTTTGACAGGCTGAGGTGGAAGG - Intergenic
1036565446 8:9934202-9934224 CTTTGGAAGGCGGAGGCGGAAGG + Intergenic
1036604557 8:10293958-10293980 CTTCGAAAGGCCGAGGTGGGAGG + Intronic
1036702618 8:11023179-11023201 CTAGGAAATGGGGACATGGAGGG - Intronic
1036825349 8:11971530-11971552 CTTTGGAAGGTCGAGGTGGATGG + Intergenic
1037100628 8:15040369-15040391 CTTTGAAAGGCCGAGGCGGACGG + Intronic
1037247336 8:16850177-16850199 GCTTGAAATGGGGAGGTGGAGGG + Intergenic
1037281967 8:17251209-17251231 CTTGGTTAGTGGGAGTTGGAGGG + Intronic
1037362780 8:18091607-18091629 CTTTGAACCTGGGAGGTGGAGGG - Intergenic
1037526722 8:19731423-19731445 CCTGGAACCCGGGAGGTGGAGGG + Intronic
1037696754 8:21230324-21230346 CTTGGAGGTGAGGAGGTGGAAGG - Intergenic
1037712391 8:21365307-21365329 CTTGGAAGGGTGGAGGTGGATGG - Intergenic
1037927411 8:22854849-22854871 TTTGAAAAGAGGGAGGGGGAGGG - Intronic
1038138077 8:24812473-24812495 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
1038182650 8:25243570-25243592 CTTTGAGAGGGTGAGGTGGGTGG - Intronic
1038456463 8:27674968-27674990 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1038672263 8:29591931-29591953 CAAGGAGAGGGGGAGCTGGAGGG - Intergenic
1038696460 8:29811074-29811096 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1038765280 8:30422355-30422377 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1038769498 8:30463903-30463925 CTTGGGGAGGTGGAGGTGGGTGG + Intronic
1038970305 8:32626185-32626207 CTTGGGAAGTGGGAGGTGGGAGG + Intronic
1039231682 8:35455520-35455542 CTTTGGGAGGCGGAGGTGGACGG - Intronic
1039329336 8:36519688-36519710 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
1039361644 8:36883538-36883560 CTTGGGAAGGCAGAGGTGGGAGG + Intronic
1039521099 8:38172563-38172585 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039573794 8:38607437-38607459 CTTTGAGAGGCAGAGGTGGATGG + Intergenic
1039783110 8:40807108-40807130 CTTGGGCAGGGGGAGGTAGTGGG + Intronic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1039925351 8:41926400-41926422 TTTGGAAAGGCTGAGGTGGGAGG + Intergenic
1039933593 8:42018677-42018699 CTTTGAGAGGCCGAGGTGGATGG + Intronic
1039938159 8:42066152-42066174 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1040015054 8:42692842-42692864 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
1040409363 8:47138627-47138649 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1041304110 8:56442119-56442141 TTTGGAAAGGTGAAAGTGGAGGG + Intronic
1041457459 8:58076201-58076223 CTTTGCAACGGCGAGGTGGAAGG - Intronic
1041684211 8:60627758-60627780 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1042008172 8:64206220-64206242 CATGGAATGTGGGAGCTGGAAGG + Intergenic
1042168306 8:65968194-65968216 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1042287615 8:67131276-67131298 ATTTGAAAGGCTGAGGTGGAAGG + Intronic
1042361754 8:67891672-67891694 CTTGGAAAGGGGCATGACGAGGG + Intergenic
1042535751 8:69856494-69856516 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1042912671 8:73844158-73844180 CGTGCAGAGGGGGAGGGGGAGGG - Intronic
1043279039 8:78439511-78439533 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1043401173 8:79885644-79885666 TGTGGAAAGTGGGAGGTGAAGGG + Intergenic
1043422322 8:80110960-80110982 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
1043439460 8:80264210-80264232 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1044689100 8:94859170-94859192 CTTGGGGAGGTTGAGGTGGAAGG + Intronic
1044998908 8:97863187-97863209 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
1045254119 8:100505437-100505459 CTTGCAAAAGGGGAGCTGGCAGG - Intergenic
1045335280 8:101196792-101196814 GTTGGAAAGGGGGAAGTGATTGG - Intronic
1045425519 8:102062158-102062180 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1045456548 8:102385657-102385679 CTAGGGAAGGCTGAGGTGGAAGG - Intronic
1045663722 8:104465139-104465161 CTTGGAGAGGGGGAGGTGTAAGG + Intronic
1046102236 8:109628584-109628606 CTTTGAAAGGCTGAGGTGGAAGG - Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046366620 8:113240155-113240177 CTTTGAAAGGAGGACATGGATGG - Intronic
1046703812 8:117428014-117428036 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1046939593 8:119918045-119918067 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1047399779 8:124536305-124536327 CTTTGGGAGGCGGAGGTGGAAGG + Intronic
1047668409 8:127118128-127118150 CTTGGGAAGGCTGAGGTGGAAGG - Intergenic
1047976793 8:130138591-130138613 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1048017084 8:130507111-130507133 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
1048375723 8:133820689-133820711 CTTGGAAGGGTTGAGGTGGGAGG - Intergenic
1048491537 8:134898179-134898201 CTTGAAATGTGGAAGGTGGAAGG - Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048706927 8:137164085-137164107 CTTTGGAAGGCTGAGGTGGACGG - Intergenic
1048727023 8:137398168-137398190 GGTGGCAAGGGGGAGGGGGAGGG + Intergenic
1048841927 8:138574251-138574273 CTGGGAAAAGGGGAGTTGGTAGG - Intergenic
1049033831 8:140059103-140059125 GTTGTAAAGGGGCAGGAGGAAGG - Intronic
1049081500 8:140446773-140446795 CTTTGGAAGGCGGAGGTGGGTGG - Intronic
1049481979 8:142829586-142829608 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1049554486 8:143275234-143275256 CTTCTCAAGGGGGAGGTGCAGGG - Intronic
1049833217 8:144715361-144715383 CTTTGAGAGGCCGAGGTGGACGG - Intergenic
1049858221 8:144877584-144877606 CTTGGAGAGGAGGAGGTGAGTGG + Exonic
1050118726 9:2287000-2287022 GATGGAATGGGGGAGGGGGATGG - Intergenic
1050301039 9:4259341-4259363 TATGTAAAGGGGAAGGTGGAAGG - Intronic
1050360393 9:4825124-4825146 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1050417438 9:5432501-5432523 CGTAGAAAGAGGGAGGGGGAGGG - Intronic
1050418092 9:5435271-5435293 CTTAGAGAGGGGGATGTGGCAGG - Intronic
1050978371 9:11972730-11972752 CTTGGAAAGAAGGAGATGGATGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051176192 9:14362785-14362807 CTTGGGAAGGCTGAGGTGGGAGG + Intronic
1051287961 9:15515315-15515337 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1052186732 9:25605930-25605952 CTTTGGAAGGCCGAGGTGGACGG - Intergenic
1052552656 9:29970318-29970340 CTTGGAAAGGGTGGGGGGGGCGG + Intergenic
1052771489 9:32694765-32694787 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1052812148 9:33070866-33070888 CTGGGAAGGGTGGAGGTGGCGGG + Intronic
1052960246 9:34289498-34289520 GAGGGAATGGGGGAGGTGGAAGG - Intronic
1053163837 9:35830862-35830884 GTTGGAATGTGGGAGGAGGAGGG + Intronic
1053209164 9:36213056-36213078 CTTGGAAACGGGGAGGTAGCAGG - Intronic
1053588340 9:39483897-39483919 CTTTGGAAGGCCGAGGTGGAGGG - Intergenic
1053681104 9:40485981-40486003 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
1054131406 9:61370203-61370225 GTTTGAGAGGGCGAGGTGGATGG + Intergenic
1054282609 9:63138953-63138975 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1054294191 9:63321496-63321518 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
1054392212 9:64625985-64626007 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
1054426860 9:65131196-65131218 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
1054503515 9:65890344-65890366 CTTTGGAAGGCCGAGGTGGATGG - Intronic
1054577965 9:66881397-66881419 CTTTGGAAGGCCGAGGTGGAGGG + Intronic
1054846132 9:69800336-69800358 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1055000034 9:71438424-71438446 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1055066836 9:72127393-72127415 CTTTGGAAGGCGGAGGTGGGCGG + Intronic
1055157201 9:73078962-73078984 CTTTGGGAGGCGGAGGTGGACGG + Intronic
1055328470 9:75157062-75157084 ATTGGCAAGGGGGAGGAGAAGGG - Intergenic
1055580342 9:77702147-77702169 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1056166996 9:83949045-83949067 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1056203193 9:84296054-84296076 CCTGGAAGAGGGGAGGGGGAAGG + Intronic
1056307144 9:85301246-85301268 CTTTGAGAGGGTGAGATGGAAGG + Intergenic
1056370147 9:85945760-85945782 CTTTGAGAGGCCGAGGTGGATGG - Intronic
1056399584 9:86213551-86213573 CTTTGGAAGGCTGAGGTGGACGG + Intergenic
1056567262 9:87785141-87785163 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1056754663 9:89374155-89374177 CGTGAAAAGGGGGTGGCGGAGGG + Intronic
1056762132 9:89423431-89423453 CTTTGAGAGGCCGAGGTGGACGG - Intronic
1056840694 9:89996179-89996201 CTTGGAGAGGGGGTGGAGGCGGG + Intergenic
1056932756 9:90892527-90892549 TTTGGAAAGTGAGAGGGGGAAGG - Intronic
1056944693 9:90984311-90984333 CTTGGGAGGGTGGAGGTGGGAGG - Intergenic
1057255089 9:93539833-93539855 CCTGCAAAGGGGCAGCTGGAGGG - Intronic
1057483516 9:95463762-95463784 CTTGGAAAGGGGAGACTGGAGGG + Intronic
1057491710 9:95525303-95525325 CTTGGAATGCAGGAGGTGAAGGG + Intergenic
1057630659 9:96716501-96716523 CATGGAAAGTGGGAGAGGGAGGG + Intergenic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1057674686 9:97129779-97129801 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1057685752 9:97232886-97232908 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1057805207 9:98215028-98215050 ATTGGATAGGGGGAGGAGGGTGG - Intronic
1057862066 9:98648582-98648604 CTTGGAGAGGGAGAAGTGGGAGG - Intronic
1058057028 9:100458748-100458770 CTTGGGAAGGCGAAGGTGGGAGG + Intronic
1058180612 9:101793598-101793620 TATGGAAAAGGGGAGGTGGGCGG + Intergenic
1058375586 9:104317370-104317392 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1058390320 9:104489259-104489281 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058738797 9:107921908-107921930 CTTTGGAAGGCTGAGGTGGACGG + Intergenic
1058876998 9:109252925-109252947 TTTGGAAAGGGGAAGGGGGCAGG + Intronic
1058948347 9:109879803-109879825 CTTGGGAAGGCTGAGGTGGGAGG - Intronic
1059042194 9:110826995-110827017 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1059143467 9:111876047-111876069 CTTGGAGAGAGGGATGTGGCAGG - Intergenic
1059166914 9:112086058-112086080 CTTTGAGAGGCCGAGGTGGAAGG + Intronic
1059582951 9:115572212-115572234 CTTGGGCAGGGGGAGGGGGCAGG - Intergenic
1059791679 9:117647525-117647547 CTTGAACCTGGGGAGGTGGAGGG - Intergenic
1060055224 9:120407341-120407363 CTTAGGAAGGGGGAGGGCGATGG - Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060339205 9:122758753-122758775 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
1060479351 9:124008934-124008956 CTGGGGGAGGGGGAGGTCGAGGG + Intronic
1060515439 9:124262831-124262853 TTTGGACAGGGGAAGGGGGAGGG + Intronic
1060556790 9:124512160-124512182 CCTGGAGAGCTGGAGGTGGAGGG + Intergenic
1060641975 9:125246472-125246494 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
1060814306 9:126626679-126626701 TTTGGAAAGGGGTGGGTGGGGGG + Intronic
1061023714 9:128033957-128033979 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1061278929 9:129586038-129586060 CTTTGCAAGGCCGAGGTGGACGG - Intergenic
1061365447 9:130170665-130170687 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1061421210 9:130473676-130473698 TTTGGAGAGGGGGAGGGGCACGG - Intronic
1061560654 9:131400653-131400675 CTTTGATAGGCGGAGGCGGAGGG - Intronic
1061642010 9:131966117-131966139 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1061678357 9:132230761-132230783 GGTGGAGGGGGGGAGGTGGAGGG - Intronic
1061977141 9:134075169-134075191 CGTGGAAAGGGAGAGGGAGAGGG - Intergenic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062292739 9:135804531-135804553 GCTGGAAAGTGGGTGGTGGAGGG - Intergenic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1062735245 9:138133716-138133738 CTCGGCAAGGGGGATGTGGCAGG - Intergenic
1062751961 9:138261871-138261893 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1062753563 9:138274652-138274674 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1203443297 Un_GL000219v1:31364-31386 CTTGGAGAGGGGGATATGGCAGG + Intergenic
1203514105 Un_KI270741v1:150273-150295 CTTGGAGAGGGGGATATGGCAGG + Intergenic
1203576075 Un_KI270745v1:9431-9453 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1185518914 X:723674-723696 CCGGGAAAGGGGGAGGGGAATGG - Intergenic
1185551776 X:987701-987723 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1185582024 X:1217111-1217133 CTGGGAAAAGGGGAAGTGGCCGG + Intergenic
1185593280 X:1292480-1292502 CTTGGCAAGGGGAATGTGGCAGG + Intronic
1186208630 X:7226648-7226670 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1186404162 X:9287022-9287044 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1186428494 X:9484421-9484443 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1186451177 X:9674821-9674843 CTTTGCAAGGTCGAGGTGGAAGG - Intronic
1186457562 X:9722014-9722036 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186688326 X:11948601-11948623 CTTGGAAAGGGGAAGGGGAAGGG + Intergenic
1187215740 X:17274947-17274969 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1187338392 X:18400469-18400491 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1187385732 X:18846689-18846711 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1187457700 X:19457366-19457388 CTTTGAGAGGCGGAGGTGGGTGG + Intronic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188770273 X:34145753-34145775 CTTGAACCTGGGGAGGTGGAGGG + Intergenic
1188806346 X:34595161-34595183 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
1188981852 X:36733831-36733853 CTTGGAAATGGGTGGATGGATGG - Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189304019 X:39973274-39973296 CTTTGAGAGGGCGAGGTGGGAGG + Intergenic
1189320279 X:40083438-40083460 ATTAGTAAGGGGGAGGGGGAAGG + Intronic
1189777879 X:44486465-44486487 CTTGGAGAGGCTGAGGTGGGTGG + Intergenic
1189883369 X:45514301-45514323 CTTGGAAAGAGGGAGCAGGCAGG + Intergenic
1189943036 X:46146681-46146703 CTTTGAGAGGCAGAGGTGGAAGG - Intergenic
1190077989 X:47332807-47332829 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1190079211 X:47342191-47342213 CTTGGGAAGGCTGAGGTGGGAGG + Intergenic
1190117459 X:47635879-47635901 CTTGGAGTGGGGGAGGCGGCAGG + Exonic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1190186781 X:48242043-48242065 CTTTGAAAGGTTGAGGTGGACGG + Intronic
1190187407 X:48247645-48247667 CTTTGAAAGGTCGAGGTGGATGG - Intronic
1190195170 X:48311338-48311360 CTTTGAAAGGTCGAGGTCGACGG - Intergenic
1190201128 X:48362088-48362110 CTTTGAAAGGTCGAGGTGGACGG - Intergenic
1190202703 X:48377487-48377509 CTTTGAAAGGTCGAGGTGGATGG + Intergenic
1190207835 X:48417923-48417945 CTTTGAAAGGTCGAGGTGGATGG - Intergenic
1190210736 X:48444909-48444931 CTTTGAAAGGTTGAGGTGGATGG + Intergenic
1190276041 X:48900005-48900027 CTTTGGGAGGCGGAGGTGGACGG + Intronic
1190377477 X:49803633-49803655 CTTTGAGAGGCGGAGGTGGGCGG + Intergenic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1190656290 X:52615409-52615431 CTTTGAGAGGTCGAGGTGGATGG - Intergenic
1190667958 X:52712548-52712570 CTTTGAAAGGTCGAGGTGGACGG - Intergenic
1190671459 X:52745856-52745878 CTTTGAAAGGTCGAGGTGGACGG + Intergenic
1190973036 X:55371242-55371264 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1191143855 X:57144667-57144689 CTTGGAAAGGATGAGAGGGAGGG - Intergenic
1191679204 X:63824836-63824858 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1191717102 X:64201169-64201191 ATTCCAAAAGGGGAGGTGGAGGG + Intronic
1191816337 X:65250078-65250100 GTAGGATAGGGGGAGGGGGAGGG - Intergenic
1192114312 X:68396187-68396209 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1192123593 X:68479457-68479479 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1192207588 X:69106468-69106490 CTTGGCCAGGGGGACGGGGATGG + Intergenic
1192324954 X:70123837-70123859 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
1192478805 X:71467133-71467155 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1192658731 X:73020903-73020925 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1192677665 X:73215238-73215260 CTGGGGAGGGGAGAGGTGGATGG + Intergenic
1192794017 X:74412005-74412027 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1193106501 X:77680452-77680474 CTTTGGAAGGCCGAGGTGGAAGG + Intronic
1193205885 X:78746937-78746959 CTTGCCATGGGGGAGGTGGGCGG + Intergenic
1193315065 X:80055490-80055512 CTGGGATGGGGGGAGGTGAATGG - Intergenic
1193716225 X:84937402-84937424 CTTGTTAAAGGGGAGATGGAGGG + Intergenic
1194124697 X:90001466-90001488 CTTGGAATGGGGGTGGGGAAAGG + Intergenic
1194141349 X:90214060-90214082 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1194256021 X:91635062-91635084 GTGGGGTAGGGGGAGGTGGAAGG + Intergenic
1194296047 X:92127819-92127841 CTTAGAAAGGGGGAAGGGTAAGG - Intronic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1194946508 X:100074670-100074692 ATTGGAAGGGGGAGGGTGGAAGG + Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195371864 X:104183706-104183728 CTTTGAGAGGCGGAGGTGGGTGG - Intronic
1195413908 X:104599489-104599511 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195543616 X:106090054-106090076 CATGGAAAGGAGGAGAGGGAAGG - Intergenic
1195604574 X:106790459-106790481 TTTGGAAAGAGGGAGGAAGAAGG - Intronic
1196550761 X:117021743-117021765 CTTTGGAAGGCCGAGGTGGATGG + Intergenic
1196681993 X:118478939-118478961 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1196809096 X:119614415-119614437 CTTTGGAAGGCCGAGGTGGATGG - Intergenic
1196841813 X:119866162-119866184 CTTTGAGAGGCCGAGGTGGATGG - Intergenic
1196858738 X:120007745-120007767 CTTGTAATGGGGGCTGTGGAAGG - Intergenic
1197186400 X:123592198-123592220 CTTGGGGAGGCTGAGGTGGAAGG - Intergenic
1197194065 X:123680414-123680436 CTCGGAGAGGGGGATGTGGCGGG - Intronic
1197322030 X:125044342-125044364 CTTTGCAAGGCTGAGGTGGAAGG + Intergenic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1197840018 X:130736280-130736302 CTTGGGGAGGGGGAGGTTGCAGG + Intronic
1198090383 X:133322927-133322949 CATGGAAAGGTAGAGGTGGTGGG + Intronic
1198101912 X:133429407-133429429 CTTTGAGAGGCCGAGGTGGAAGG - Intergenic
1198109734 X:133492448-133492470 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1198308621 X:135406850-135406872 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1198600657 X:138282096-138282118 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1198600964 X:138283437-138283459 CGGGGAGAGGGGGAGGGGGAGGG + Intergenic
1198605676 X:138334239-138334261 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1198735292 X:139778098-139778120 CTTTGAAAGGTTGAGGTGGGAGG - Intronic
1198928938 X:141831341-141831363 CTTGGAAATGAGGATGGGGAAGG - Intergenic
1199036122 X:143052996-143053018 TTTGGAAAGGGGAAGGAAGAGGG - Intergenic
1199105203 X:143858152-143858174 GTTGGGGAGGGGGTGGTGGAAGG + Intergenic
1199285527 X:146050282-146050304 CTCGGAAAGGGGGATTTGGCAGG - Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199550250 X:149053648-149053670 CTAGGACAGGGGGAGGTGGAAGG - Intergenic
1199836633 X:151598863-151598885 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1200215325 X:154365702-154365724 CTTGGAAGGGGGAGGGTGGGGGG - Intronic
1200377255 X:155796252-155796274 CTCAGAAAGGGGGAGGGGGCAGG - Intergenic
1200477591 Y:3659077-3659099 CTTGGAATGGGGGTGGGGAAAGG + Intergenic
1200487104 Y:3783164-3783186 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1200613550 Y:5352420-5352442 CTTAGAAAGGGGGAAGGGTAAGG - Intronic
1200689979 Y:6297424-6297446 GTGGGGTAGGGGGAGGTGGAGGG + Intergenic
1200833669 Y:7712083-7712105 CTCGGAAAGGGGGATCTGGCAGG - Intergenic
1201045294 Y:9877296-9877318 GTGGGGTAGGGGGAGGTGGAGGG - Intergenic
1201314632 Y:12631718-12631740 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1201380411 Y:13370803-13370825 CTTTGAAAGGCCGAGGTGGGTGG + Intronic
1201968178 Y:19761638-19761660 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1202069527 Y:20976281-20976303 CTTTGAGAGGGGGATGTGGCAGG + Intergenic
1202196072 Y:22299175-22299197 CTTTGAGAGGCCGAGGTGGATGG + Intergenic