ID: 1091726373

View in Genome Browser
Species Human (GRCh38)
Location 12:2849223-2849245
Sequence AAGCCCTTCTAGAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091726368_1091726373 12 Left 1091726368 12:2849188-2849210 CCTGGGGCTCTGGGTATCACGAT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1091726373 12:2849223-2849245 AAGCCCTTCTAGAAGTGTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091726373 Original CRISPR AAGCCCTTCTAGAAGTGTCC AGG Intronic
901227392 1:7621711-7621733 TCGCCCTTCTGGAAGTTTCCTGG + Intronic
902304264 1:15524778-15524800 GAGACCTTCTAGATGCGTCCCGG - Intronic
902984958 1:20149526-20149548 ACCCTCTTCTAGAAGTTTCCAGG - Exonic
905494362 1:38372866-38372888 AGGCCCATCTAGAAATGGCCAGG + Intergenic
906992791 1:50756439-50756461 AAGCCATTCAACAAGTCTCCAGG + Intronic
907873550 1:58464990-58465012 AAGCCTTTCCAGAAGTTTGCAGG + Intronic
908068704 1:60434929-60434951 AAACCATTCAACAAGTGTCCAGG + Intergenic
908442727 1:64170967-64170989 AAGCCATTCAACAAGTCTCCAGG + Intronic
908624881 1:66028871-66028893 AAGCCATTCAAGAAGTCTCTAGG + Intronic
908729101 1:67207918-67207940 AAGCCATTCAACAAGTCTCCAGG - Intronic
908885112 1:68780205-68780227 AAGCCATTCAACAAGTCTCCAGG - Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909710185 1:78640454-78640476 AAGCCCTGTTAAAAGAGTCCTGG + Intronic
910083660 1:83372502-83372524 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
910417254 1:87013988-87014010 AAGCCATTCAACAAGTCTCCAGG + Intronic
911926071 1:103834554-103834576 AAGCCATTCAACAAGTGTCTAGG - Intergenic
912405601 1:109435032-109435054 AAGCCATTCTACAAGTCTCTAGG + Intergenic
913241970 1:116837259-116837281 AAGCCATTCAAGAAGTCTCTAGG - Intergenic
913261766 1:117005024-117005046 ATGCCCTTGTAAAAGAGTCCAGG - Intronic
913289546 1:117259457-117259479 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
916734900 1:167598900-167598922 AAGCCATTCAACAAGTCTCCAGG + Intergenic
917692303 1:177482050-177482072 ACTCCCTTGGAGAAGTGTCCAGG - Intergenic
917895141 1:179480006-179480028 AAGCCATTCAACAAGTGTCTAGG + Intronic
919156886 1:193776723-193776745 AAGCCATTCTACAAGTCTCTAGG + Intergenic
919554398 1:199032351-199032373 AAGCCATTCAACAAGTCTCCAGG + Intergenic
921531166 1:216284762-216284784 AAGCCATTCAACAAGTCTCCAGG - Intronic
921610304 1:217205906-217205928 AAGCCATTCTGGAAGTCTCCAGG - Intergenic
921773465 1:219070890-219070912 AAGCCATTCAACAAGTCTCCAGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922422376 1:225468487-225468509 AACTCCTTTTAGAAGTGCCCCGG + Intergenic
923751449 1:236750301-236750323 AAACCCTTCTAGACGGCTCCTGG - Intronic
1065456253 10:25909642-25909664 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1068865882 10:61895594-61895616 ACGCCCTTCTAGAGATGTGCTGG - Intergenic
1071450304 10:85787202-85787224 AAACCCTTCCAGGACTGTCCTGG - Intronic
1071971478 10:90912068-90912090 AAGTCCTTCTATAAGTGTGGTGG - Intergenic
1073476786 10:103758985-103759007 AAGCCCTTCCTGAAGGGCCCTGG - Intronic
1074223538 10:111461553-111461575 AAGCCATTCAACAAGTGTCTAGG - Intergenic
1075064922 10:119282784-119282806 AAGAGCTTCTAGAAGCCTCCCGG - Intronic
1077426308 11:2480107-2480129 AAGCCCTTCAACAAGTTTCTAGG + Intronic
1078518094 11:12041657-12041679 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1078713045 11:13813636-13813658 AAGCCATTCTACAAGTCTCTAGG + Intergenic
1079521076 11:21327717-21327739 AAGCCATTCAAGAAGTCTCTAGG - Intronic
1079686362 11:23363857-23363879 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086309234 11:85518264-85518286 AAGTCATTCAAGAAGTCTCCAGG - Intronic
1087763571 11:102126800-102126822 AAGCCATTCAAGAAGTCTCTAGG - Intronic
1088109545 11:106246378-106246400 AAAGCATTCAAGAAGTGTCCTGG + Intergenic
1090890852 11:130921250-130921272 AAGCCTTTCTACAAGTCTCTAGG + Intergenic
1091726373 12:2849223-2849245 AAGCCCTTCTAGAAGTGTCCAGG + Intronic
1092231844 12:6780284-6780306 AAGTCCTTTTAGAAGCTTCCAGG + Intergenic
1092593577 12:9975321-9975343 AAGCCATTCAAGAAGTCTCTAGG - Intronic
1092815131 12:12306043-12306065 GAGTCCTCCTAGAACTGTCCTGG + Intergenic
1093206970 12:16263152-16263174 AAGCCATTCAACAAGTCTCCAGG - Intronic
1093271252 12:17065001-17065023 AACCAGTTCTTGAAGTGTCCAGG + Intergenic
1093353017 12:18127528-18127550 AAGCCATTCAACAAGTCTCCAGG - Intronic
1094076982 12:26488049-26488071 AATGCCTTATGGAAGTGTCCAGG + Intronic
1094421851 12:30279536-30279558 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1096445336 12:51685564-51685586 AATCCATTCTGAAAGTGTCCAGG - Intronic
1097476077 12:60057893-60057915 AAGCCCTTCAACAAGTTTCTAGG - Intergenic
1098145042 12:67489306-67489328 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098686873 12:73433545-73433567 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1098836870 12:75434186-75434208 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1099132931 12:78859037-78859059 AAAGCCATCCAGAAGTGTCCCGG + Intergenic
1100621540 12:96280543-96280565 AAGACCTTTTACAAGTGACCTGG - Intronic
1101692678 12:107096163-107096185 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1107234696 13:38154183-38154205 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1109189619 13:59308791-59308813 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1109482547 13:62974556-62974578 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1109692056 13:65907344-65907366 AAGCCATTCAAAAAGTCTCCAGG - Intergenic
1109758150 13:66788949-66788971 TAGCACATCTAGAATTGTCCTGG + Intronic
1110929307 13:81195123-81195145 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1110970862 13:81759206-81759228 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1111189483 13:84789639-84789661 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1111472146 13:88696504-88696526 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1111474040 13:88723743-88723765 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1111819220 13:93193360-93193382 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1114015666 14:18426513-18426535 AGACCCTTGTAGTAGTGTCCCGG + Intergenic
1114018195 14:18451560-18451582 AAACCCTCGTAGTAGTGTCCTGG + Intergenic
1114020585 14:18474877-18474899 ATACCCTCCTAGAAGTGTTCTGG + Intergenic
1114026883 14:18535852-18535874 AGACCCTTGTAGAAGTGTTCAGG - Intergenic
1114026888 14:18535900-18535922 AGACCCTCCTAGAAGTGTTCTGG - Intergenic
1114986649 14:28238256-28238278 AAGCCATTCAAGAAGTCTCCAGG - Intergenic
1115112459 14:29840400-29840422 AAGCCATTCAACAAGTCTCCAGG + Intronic
1115820123 14:37204897-37204919 AAGCCATTCAATAAGTCTCCAGG - Intronic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116625183 14:47254555-47254577 AAGCCATTCAAGAAGTCTCTAGG + Intronic
1116802880 14:49461712-49461734 AAGCCCTTATAGTAGTGGCAAGG - Intergenic
1118083275 14:62386910-62386932 AAAGCCTTCAAGAAGTGACCTGG + Intergenic
1118391840 14:65302465-65302487 ATGTCCTTCTAGAAATGGCCAGG - Intergenic
1119040305 14:71268740-71268762 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1119963025 14:78881386-78881408 AAGCCATTCAACAAGTATCCAGG - Intronic
1120326563 14:83037135-83037157 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1120921158 14:89756491-89756513 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1120972005 14:90215392-90215414 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1202838256 14_GL000009v2_random:95008-95030 AGACCCTTGTAGAAGTGTTCTGG - Intergenic
1202907620 14_GL000194v1_random:85022-85044 AGACCCTTGTAGAAGTGTTCTGG - Intergenic
1128718708 15:69929608-69929630 AAGCCATTCTACAAGTCTCTAGG + Intergenic
1128754601 15:70172947-70172969 AAGCACTTCAAGAAGTCTCTGGG - Intergenic
1129620043 15:77136065-77136087 AAGCCATTCAACAAGTCTCCAGG - Intronic
1130778324 15:87008672-87008694 AAGCCATTCAACAAGTCTCCAGG - Intronic
1131659422 15:94498224-94498246 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1131980090 15:97986466-97986488 AAGCCCTTCAACAAGTCTCTAGG - Intergenic
1132311650 15:100861981-100862003 CAGCCCTGCTAGACATGTCCAGG + Intergenic
1133972851 16:10579980-10580002 AAGCCCTTCTAGAGTTGGCAGGG + Intronic
1134601407 16:15536476-15536498 TAGACCTTCTACAATTGTCCAGG - Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1135514111 16:23115129-23115151 AAGCCCTTCTCCAAGAGTCCCGG + Intronic
1135516980 16:23144330-23144352 GAGCCCTTCTAGAACTGAGCAGG + Intronic
1140231847 16:73123805-73123827 ATGCCCTTATAGAAGAGGCCTGG + Intergenic
1141569759 16:84927538-84927560 AAGCCCTCCTTCAAGTGGCCGGG + Intergenic
1146173971 17:30653073-30653095 AAGACCTTCTAGAACAATCCTGG + Intergenic
1146347425 17:32069095-32069117 AAGACCTTCTAGAACAATCCTGG + Intergenic
1147770686 17:42866152-42866174 AAGTCTTCCTAGATGTGTCCAGG + Intergenic
1149095301 17:52832964-52832986 TCTCCCTTCTAGAAATGTCCTGG + Intergenic
1149374839 17:56033469-56033491 CAGCCCATCTGGAAGTGTCTTGG - Intergenic
1149445316 17:56708710-56708732 AAGCCCTTCTAGAAGTGCTCTGG + Intergenic
1152318962 17:79597365-79597387 AAGCCCTTCTACAAGTCTGTAGG - Intergenic
1152426919 17:80223037-80223059 AGGCACTTCTCCAAGTGTCCTGG - Intronic
1203156024 17_GL000205v2_random:4357-4379 AGACCCTTGTAGAAGTGTTCTGG + Intergenic
1203159261 17_GL000205v2_random:34144-34166 AGACCCTCTTAGAAGTGTCCTGG + Intergenic
1156769082 18:40697835-40697857 AAGCCATTCAACAAGTGTCTAGG - Intergenic
1158123985 18:54082061-54082083 AAGCCATTCAAGAAGTCTCTAGG - Intergenic
1158335717 18:56413610-56413632 AAGCCATTCAACAAGTGTCTAGG - Intergenic
1158822567 18:61178312-61178334 AAGCCATTCAACAAGTGTCTAGG - Intergenic
1159247620 18:65829928-65829950 AAGGCTCTGTAGAAGTGTCCAGG + Intronic
1162152308 19:8655271-8655293 AGGCCCTTCTAGAAAGATCCAGG - Intergenic
1162988443 19:14286963-14286985 AAGACCTTCTAGAACAATCCTGG - Intergenic
1167475182 19:49696378-49696400 AAGGCCTTCTAGAAGTACCAGGG - Intronic
1168706591 19:58473854-58473876 CAGCCCTGCTAGATGAGTCCTGG + Intergenic
1202634663 1_KI270706v1_random:34666-34688 AAACCCTTGTAGCAGTGTTCCGG + Intergenic
925453437 2:3991334-3991356 AAGCCATTCAATAAGTCTCCAGG + Intergenic
925782877 2:7399122-7399144 AAGTCCTTCCAGAAGTATCTAGG + Intergenic
926456601 2:13074759-13074781 AAGCCATTCAACAAGTGTCTAGG + Intergenic
926496691 2:13597800-13597822 AAGCCCTTAGAGGAGTGTCTGGG - Intergenic
927640049 2:24840498-24840520 AAGCCCGTCTAGTATTGCCCTGG - Intronic
928853744 2:35780630-35780652 AAGCCATTCAACAAGTGTCTAGG - Intergenic
929044383 2:37775951-37775973 AATCCCTTCTAGAAGTTTTCAGG + Intergenic
930544046 2:52744969-52744991 AAGCCTTTCAACAAGTCTCCAGG - Intergenic
933046120 2:77539518-77539540 AAGACATTCAAGATGTGTCCTGG + Intronic
936800384 2:116258596-116258618 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
936831564 2:116654031-116654053 AAGCATTTCTGGAACTGTCCTGG + Intergenic
936897502 2:117445191-117445213 AAGCCATTCAACAAGTCTCCAGG - Intergenic
937547230 2:123037035-123037057 AAGCCATTCTACAAGTCTCTAGG + Intergenic
938594444 2:132773129-132773151 AACCACTTCTTCAAGTGTCCAGG + Intronic
939071782 2:137552913-137552935 TAGCCATTCTATAGGTGTCCAGG - Intronic
939752520 2:146064768-146064790 AAGCCATTCAACAAGTCTCCAGG + Intergenic
943483877 2:188455820-188455842 AAGCCATTCAACAAGTGTCTAGG - Intronic
943491270 2:188558660-188558682 AAGCCATTCAACAAGTCTCCAGG - Intronic
944043964 2:195387805-195387827 AAGCCATTCAACAAGTCTCCAGG - Intergenic
944904234 2:204246308-204246330 AATCATTTCTAGAAGTGTCCAGG - Intergenic
947280507 2:228447644-228447666 CACCCCTTCTAGAAGTGCCTGGG + Intergenic
947772511 2:232681882-232681904 AAGCCCCTCCAGGAGGGTCCTGG + Exonic
1169985299 20:11436804-11436826 AAGCCATTCAAGAAGTTTCTAGG + Intergenic
1170499720 20:16961967-16961989 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1171132174 20:22663850-22663872 CAGCCCCTCAGGAAGTGTCCAGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1175439471 20:58980942-58980964 AAATCCTTCCGGAAGTGTCCAGG - Intergenic
1176410711 21:6448139-6448161 AAACCCTTCTAGATGTTTCTGGG + Intergenic
1176626918 21:9099311-9099333 AGACCCTTGTAGAAGTGTTCTGG - Intergenic
1177118241 21:17110775-17110797 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1177139606 21:17344041-17344063 AAGCCCTTCAACAAGTCTCTAGG - Intergenic
1177266918 21:18797805-18797827 AAGCCATTCTACAAGTCTCTAGG - Intergenic
1177654956 21:24004839-24004861 AAGCCATTCAAGAAGTCTCCAGG + Intergenic
1178258474 21:31076827-31076849 AAGCAGTTCTAGAACTTTCCAGG + Intergenic
1178469115 21:32875892-32875914 AAGCCCTTCAACAAGTCTCTAGG + Intergenic
1179089613 21:38252558-38252580 AAGCCCTGCTAGGATTCTCCTGG + Intronic
1179686205 21:43056461-43056483 AAACCCTTCTAGATGTTTCTGGG + Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1180440176 22:15357385-15357407 AGACCCTTGTAGTAGTGTCCTGG + Intergenic
1180442707 22:15382431-15382453 AAACCCTCGTAGTAGTGTCCTGG + Intergenic
1180445092 22:15405702-15405724 ATACCCTCCTAGAAGTGTTCTGG + Intergenic
1180451019 22:15463047-15463069 AGACCCTTGTAGAAGTGTTCAGG - Intergenic
1180451024 22:15463095-15463117 AGACCCTCCTAGAAGTGTTCTGG - Intergenic
1180523602 22:16233343-16233365 AAACCCTCCAAGCAGTGTCCTGG + Intergenic
1184092444 22:42299678-42299700 AAGACCTCCTAGGAGTGACCTGG + Intronic
1203296475 22_KI270736v1_random:47332-47354 AAACCCTTATAGAAGTTTTCAGG + Intergenic
949369519 3:3319114-3319136 AAACCATTCAAGAAGTCTCCAGG + Intergenic
952401129 3:32965272-32965294 AAGCCATTCAACAAGTCTCCAGG - Intergenic
955097919 3:55818127-55818149 AAGACCTTCCAGAGCTGTCCTGG + Intronic
956503163 3:69909538-69909560 AAGCCATTCAACAAGTGTCTTGG - Intronic
956517637 3:70067083-70067105 AAGACCATCTAGAAGGGTCAGGG + Intergenic
957300688 3:78388446-78388468 AAGCCATTCAACAAGTCTCCAGG + Intergenic
957757443 3:84509202-84509224 AAGCCATTCAACAAGTGTCTGGG - Intergenic
957857071 3:85892925-85892947 AAGCCATTCAAGAAGTCTCTAGG - Intronic
958860155 3:99436481-99436503 AAGCCATTCAATAAGTCTCCAGG - Intergenic
959756594 3:109906711-109906733 AAGCCATTCAACAAGTCTCCAGG + Intergenic
960486418 3:118258615-118258637 AAGCCATTCAACAAGTGTCTAGG - Intergenic
960626612 3:119687538-119687560 AAGCCATTCAACAAGTATCCAGG + Intergenic
961722871 3:128907912-128907934 AAGCCTTTCTCCAAGTCTCCAGG - Intronic
961753387 3:129111187-129111209 AAGCTCTACTAGAAGAGTTCAGG - Intronic
962005389 3:131344158-131344180 AAAGCCTTCAAGATGTGTCCTGG - Intronic
963494589 3:146043439-146043461 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
964275289 3:155003259-155003281 AAGCCCTTCAACAAGTCTCTAGG - Intergenic
964905389 3:161713212-161713234 AAGGCCTTGTAAAATTGTCCAGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
967068093 3:185938272-185938294 AATCCCTTCTAGAACTTTCCAGG + Intergenic
967513758 3:190342039-190342061 AAGCCATTCAAGAAATCTCCAGG + Intronic
967635099 3:191791588-191791610 AAGCCATTCAACAAGTCTCCAGG + Intergenic
967810312 3:193754258-193754280 AAGCCATTCAACAAGTCTCCAGG - Intergenic
970290283 4:14564159-14564181 AAGCCCTTCAGGATGGGTCCAGG + Intergenic
970703429 4:18770832-18770854 AAGATCTGCTTGAAGTGTCCTGG - Intergenic
971591271 4:28472541-28472563 AAGCCATTCAACAAGTCTCCAGG - Intergenic
971611635 4:28733028-28733050 AATCCCTTCTAAAAGAGTTCTGG - Intergenic
974171168 4:58269429-58269451 AAAGCATTCAAGAAGTGTCCAGG - Intergenic
974487486 4:62524254-62524276 AAGCCCTTCAACAAGTCTCTAGG - Intergenic
974772558 4:66434726-66434748 AAGCCATTCAACAAGTCTCCAGG + Intergenic
975307271 4:72864720-72864742 AAGCCATTCAACAAGTCTCCAGG - Intergenic
976003512 4:80400842-80400864 AAGCCATTCAACAAGTGTCCAGG - Intronic
977026166 4:91821594-91821616 AAGCCATTCAACAAGTCTCCAGG + Intergenic
978856472 4:113400160-113400182 AAGCCGTTCAAGAAGTCTCTAGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979182767 4:117752523-117752545 AAGCCATTCAACAAGTGTCTAGG - Intergenic
981661342 4:147170533-147170555 AAGTCATTCTAAAAGTATCCAGG + Intergenic
984865448 4:184276701-184276723 AAGCCATTCTACAAGTCTCTAGG - Intergenic
985201328 4:187488165-187488187 AAGCCATTCAACAAGTCTCCAGG - Intergenic
985394218 4:189525024-189525046 AAGCCATTCTACAAGTCTCTAGG - Intergenic
986507870 5:8471404-8471426 AAGCCATTCAACAAGTGTCTAGG + Intergenic
986557582 5:9026803-9026825 AAGCCCTTCAGCAAGTCTCCAGG - Intergenic
987597449 5:20020138-20020160 AAGGCGTTCAAGAAGTGGCCTGG + Intronic
988047771 5:25980435-25980457 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
988070833 5:26285954-26285976 AAGCCTTTCAACAAGTCTCCAGG + Intergenic
988345655 5:30035075-30035097 AAGCCATTCAACAAGTGTCTAGG - Intergenic
988379079 5:30477842-30477864 AAGCCATTCTACAAGTCTCTAGG + Intergenic
989414457 5:41157418-41157440 AAGCTTTTCTATAAGTGGCCTGG + Intronic
990094457 5:52094642-52094664 AAGCCATTCAACAAGTCTCCAGG + Intergenic
990997028 5:61742989-61743011 AAGTCCTCCAAGGAGTGTCCTGG - Intronic
993238222 5:85344176-85344198 AAGCCATTCAACAAGTCTCCAGG - Intergenic
996011354 5:118484359-118484381 AAGCCATTCAACAAGTCTCCAGG + Intergenic
997022132 5:130014158-130014180 AAGCCATTCAAAAAGTGTCTAGG + Intronic
997099905 5:130957625-130957647 AAACCATTCAAGAAGTCTCCAGG - Intergenic
997444972 5:133934057-133934079 AAGCCCTTCCTGACGAGTCCAGG - Intergenic
998487614 5:142516868-142516890 AAAGCATTCCAGAAGTGTCCTGG + Intergenic
1000080652 5:157842446-157842468 AAGACCTTTTTAAAGTGTCCTGG - Intronic
1003463044 6:6350304-6350326 AAGCACTTCTAGATGTGTTGTGG - Intergenic
1004322355 6:14641943-14641965 AATCCCTTCAATGAGTGTCCAGG - Intergenic
1005047799 6:21658669-21658691 AAGCCCTTCTAGAACCCCCCAGG - Intergenic
1006566386 6:34961411-34961433 AAGCCCATCTAGAAGTTTTGGGG - Intronic
1009171211 6:60402455-60402477 AAGTCCTTCTGGAAGAGGCCTGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012967053 6:105686416-105686438 AAGCCATTCAACAAGTGTCTAGG - Intergenic
1013798357 6:113910647-113910669 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014861142 6:126469635-126469657 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1015674102 6:135725542-135725564 AAGCCATTCAACAAGTTTCCAGG - Intergenic
1016728406 6:147401455-147401477 AAACCCTTTGAGAAGTGACCTGG - Intergenic
1017174503 6:151490602-151490624 TAGCCCTTCTAAAAGTGGCTCGG - Intergenic
1018585089 6:165349241-165349263 AAGCCATTCAACAAGTCTCCAGG - Intronic
1019044360 6:169131818-169131840 AAGTGCATCTAGAAATGTCCAGG - Intergenic
1019050853 6:169182441-169182463 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1020537958 7:9424999-9425021 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1020782790 7:12536947-12536969 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1024438643 7:49388904-49388926 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1027300489 7:76828640-76828662 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1027519167 7:79182025-79182047 AAGCCATTCAAGAAGTCTCGAGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027953833 7:84855113-84855135 AAGCCATTCGAGAAGTCTCTAGG + Intergenic
1028011482 7:85649500-85649522 AAGCCCTTCAACAAGTCTCTAGG + Intergenic
1029597530 7:101545642-101545664 AAGCCCTCCATGCAGTGTCCAGG + Intronic
1030494671 7:110284121-110284143 CATCCCTTCTAGAAGTACCCAGG - Intergenic
1030511006 7:110481881-110481903 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1030559184 7:111063868-111063890 AAGCCATTCTACAAGTCTCTAGG + Intronic
1031170812 7:118290254-118290276 AAGCCATTCGACAAGTCTCCAGG - Intergenic
1031275313 7:119713415-119713437 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1031645498 7:124220927-124220949 AAGCCATTCAATAAGTCTCCAGG - Intergenic
1031803361 7:126276471-126276493 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034737456 7:153442116-153442138 AAACCCTTCCAGAAAGGTCCAGG + Intergenic
1034990271 7:155543539-155543561 GAGACCTTCTAGAAGTTTCCAGG + Intergenic
1037117738 8:15246684-15246706 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1039586456 8:38711444-38711466 AATCCATTCTGGAAGTGGCCAGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040741253 8:50579087-50579109 AAGCCATTCAACAAGTGTCAAGG - Intronic
1042164792 8:65934985-65935007 AAGCCATTCAACAAGTTTCCAGG - Intergenic
1042466497 8:69134451-69134473 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1042728436 8:71903829-71903851 AAGCCATTCAACAAGTCTCCAGG + Intronic
1043518470 8:81018953-81018975 AAGCCATTCAATAAGTGTCTAGG - Intronic
1043749962 8:83922633-83922655 AAACCATTCAAGAAGTCTCCGGG + Intergenic
1044454067 8:92371253-92371275 AAGGACTTCTCGAAGTTTCCAGG - Intergenic
1044748690 8:95395720-95395742 AAACTCTTCTAGAAGGTTCCGGG - Intergenic
1046882034 8:119319930-119319952 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1047096831 8:121634823-121634845 AAGGCCTTCTAGACCTGTTCTGG - Intronic
1047586818 8:126282184-126282206 AAGCCATTCAACAAGTGTCTAGG - Intergenic
1048069704 8:131008761-131008783 AAGCCATTCAACAAGTGTCTAGG - Intronic
1048147292 8:131857835-131857857 AAGCACTTTAAGAAGTGTCTGGG + Intergenic
1048503880 8:135003389-135003411 AATCCCTCATAGGAGTGTCCTGG + Intergenic
1049489778 8:142889579-142889601 AAGCCATTCAACAAGTCTCCAGG + Intronic
1050940438 9:11451188-11451210 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1052267509 9:26591297-26591319 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1052518274 9:29510918-29510940 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1053717925 9:40915627-40915649 AAACCCTTGTAGCAGTGTTCTGG - Intergenic
1053719408 9:40930266-40930288 AAACCCTTGTAGCAGTGTTCTGG - Intergenic
1055083584 9:72291427-72291449 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1056775818 9:89511936-89511958 AAGCCCTTTTAGAAGGGCCCTGG - Intergenic
1058345775 9:103959834-103959856 AAGTCCTTCCAGAAGAGACCAGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203494154 Un_GL000224v1:134966-134988 AAACCCTCCTAGCAGTGTTCTGG - Intergenic
1203495103 Un_GL000224v1:143747-143769 AAACCCTTGTAGCAGTGTTCTGG - Intergenic
1203495121 Un_GL000224v1:143935-143957 ATGCCCTTGTAGCAGTGTTCTGG - Intergenic
1203506773 Un_KI270741v1:76841-76863 AAACCCTCCTAGCAGTGTTCTGG - Intergenic
1203507729 Un_KI270741v1:85670-85692 AAACCCTTGTAGCAGTGTTCTGG - Intergenic
1203507747 Un_KI270741v1:85858-85880 ATGCCCTTGTAGCAGTGTTCTGG - Intergenic
1203708647 Un_KI270742v1:74562-74584 AAACCCTTGTAGCAGTGTTCTGG - Intergenic
1185795671 X:2962395-2962417 CGGCCCTTCTAAAAGTGGCCAGG - Intronic
1186496106 X:10014451-10014473 TAGCCCTTCTAGGGCTGTCCTGG + Intergenic
1186700201 X:12082662-12082684 AAGCCATTCAATAAGTGTCTAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1190127915 X:47722540-47722562 AATCCCCTCTGCAAGTGTCCTGG - Intergenic
1190513377 X:51196374-51196396 AAGCCATTCTACAAGTCTCTAGG + Intergenic
1191598542 X:62975049-62975071 AAGCCATTCAAGAAGTCTCTAGG + Intergenic
1192160566 X:68783475-68783497 AAGCCCTCCTGTAAGTGCCCAGG - Intergenic
1192676662 X:73203612-73203634 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1193195831 X:78630857-78630879 AAGCCATTCAAGAAGTCTCCAGG - Intergenic
1193388105 X:80894550-80894572 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1194185226 X:90766771-90766793 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1194215886 X:91129657-91129679 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1194368907 X:93046676-93046698 AAAGCATTCAAGAAGTGTCCTGG + Intergenic
1194497380 X:94634641-94634663 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1194843528 X:98775425-98775447 AAGCCATTCAACAAGTCTCCAGG - Intergenic
1194920513 X:99759296-99759318 AAGCCATTCAAGAAGTCTCTAGG - Intergenic
1195210181 X:102646848-102646870 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1197341772 X:125284036-125284058 AAGCCATTCAACAAGTGTCTAGG + Intergenic
1198734523 X:139771549-139771571 AAGCCATTCAACAAGTGTCTAGG - Intronic
1198750205 X:139931788-139931810 AAGCCCTGGTCGAATTGTCCTGG + Intronic
1198888278 X:141362901-141362923 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1199258991 X:145748865-145748887 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1199309505 X:146306801-146306823 AAGCCATTCTACAAGTCTCTAGG - Intergenic
1199909557 X:152271264-152271286 AAGCCATTCAAGAAGTCTCTAGG - Intronic
1200531849 Y:4348858-4348880 AAGCCATTCAACAAGTCTCCAGG + Intergenic
1201163484 Y:11185083-11185105 AGACCCTTGTAGAAGTGTTCTGG - Intergenic
1201452161 Y:14128493-14128515 AAGCCATTCAACAAGTCTCCAGG - Intergenic