ID: 1091730606

View in Genome Browser
Species Human (GRCh38)
Location 12:2877358-2877380
Sequence CGCGTGGGTGGGCGAGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091730590_1091730606 12 Left 1091730590 12:2877323-2877345 CCGTGGGGCCGGGGAGGGGCCGG 0: 1
1: 0
2: 8
3: 87
4: 834
Right 1091730606 12:2877358-2877380 CGCGTGGGTGGGCGAGCCGAGGG 0: 1
1: 0
2: 1
3: 10
4: 85
1091730596_1091730606 -7 Left 1091730596 12:2877342-2877364 CCGGAGGGGTCCCCGCCGCGTGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1091730606 12:2877358-2877380 CGCGTGGGTGGGCGAGCCGAGGG 0: 1
1: 0
2: 1
3: 10
4: 85
1091730595_1091730606 4 Left 1091730595 12:2877331-2877353 CCGGGGAGGGGCCGGAGGGGTCC 0: 1
1: 0
2: 5
3: 54
4: 409
Right 1091730606 12:2877358-2877380 CGCGTGGGTGGGCGAGCCGAGGG 0: 1
1: 0
2: 1
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091730606 Original CRISPR CGCGTGGGTGGGCGAGCCGA GGG Intronic
900410145 1:2508897-2508919 CGCGTGGCTGGCCGAGCGGCTGG - Exonic
903848818 1:26294286-26294308 GCAGTGGGTGGGCGAGCCCATGG - Exonic
907266357 1:53263967-53263989 CGAGTGGGTGGGAGAGTCCAGGG + Intronic
910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG + Exonic
914702902 1:150150221-150150243 GGCGCGGGGCGGCGAGCCGAGGG - Exonic
922618551 1:226977379-226977401 CTTGTGGGTGGGCGAGCGGGTGG + Intronic
923429278 1:233905146-233905168 GGCGTGGGTGAGCGAGCCGGCGG + Intronic
1062848630 10:726723-726745 TGAGTGGATGGGTGAGCCGATGG - Intergenic
1064001126 10:11664509-11664531 GGTGTGAGTGGGCGAGCAGAGGG + Intergenic
1064022796 10:11823334-11823356 CGCGCGGGTGGGCGCGCACAGGG + Intronic
1066406994 10:35127412-35127434 GGCGTGGGGCGGCGAGCCGGCGG - Intronic
1066963660 10:42242524-42242546 CGCGGGGGTGGGCGAGACACTGG - Intergenic
1076374014 10:129971756-129971778 CGCGCGGGCGGGAGAGCCGGCGG - Intergenic
1076700010 10:132266700-132266722 GGCGTGGGTGGGGGAGGCGCTGG + Intronic
1077480998 11:2814527-2814549 CGGCTGGGTGGGTGAGCTGATGG + Intronic
1078904392 11:15670877-15670899 AGGGTGGGTGGGGGAGCCGCAGG + Intergenic
1078929319 11:15901212-15901234 CGGGTGGGAGGGCCAGCAGAGGG + Intergenic
1091730606 12:2877358-2877380 CGCGTGGGTGGGCGAGCCGAGGG + Intronic
1104954579 12:132457934-132457956 CGGGTGGGTGGGTGAGCGGGTGG + Intergenic
1104954584 12:132457950-132457972 CGGGTGGGTGGGTGAGTGGACGG + Intergenic
1104954604 12:132458010-132458032 CGGGTGGGTGGGTGAGTTGACGG + Intergenic
1106061802 13:26300327-26300349 AGCGTGGGTGGGCTGGACGAAGG + Intronic
1106776682 13:33016343-33016365 AGCGGGGGTGGGCGCGCCGGCGG + Intergenic
1112341021 13:98553047-98553069 CCCGTGGGTGTGGGAGCCAAGGG + Intronic
1113788449 13:113015141-113015163 TGTGTGGGTGGCCGAGCCCATGG + Intronic
1113813154 13:113154187-113154209 GGCGTGGGGGGGCGGGCCGTGGG + Intergenic
1113813171 13:113154218-113154240 GGCGTGGGGGGGCGGGCCGTGGG + Intergenic
1114461153 14:22886952-22886974 GGCGAGGGGGGGCGAGCGGAGGG - Exonic
1114558801 14:23577177-23577199 CGAGTGGCTGGGCGGGCTGAAGG - Exonic
1128656033 15:69462752-69462774 TGCGTTGGTGGGCGCGCCGCGGG - Intergenic
1132351378 15:101141721-101141743 TGGGTGGGTGGGCGGGCAGATGG - Intergenic
1132583055 16:694132-694154 CGGGAGGCGGGGCGAGCCGAGGG - Exonic
1132626571 16:894306-894328 CGGGTGGGTGGACGATCCGGTGG - Intronic
1132977891 16:2719681-2719703 TGGGAGGGTGGCCGAGCCGAGGG - Intronic
1133029621 16:3004273-3004295 CGCGGGCGCGGGCGAGCCGCGGG - Intergenic
1136267037 16:29127949-29127971 CCCATGGGTGGGAGAGCCAAGGG - Intergenic
1139914314 16:70418838-70418860 TGCGTGGGTGGGGGAGGAGAGGG - Intronic
1141096847 16:81168792-81168814 TGCGTGGGTGGGTGGGCGGATGG + Intergenic
1141178300 16:81734969-81734991 CGCGTGGGTGGGTGAGAGAAGGG + Intergenic
1142070325 16:88088272-88088294 CCCATGGGTGGGAGAGCCAAGGG - Intronic
1142187679 16:88702138-88702160 CGGGAGGGTGTGCGAGCCCAAGG - Intronic
1142854865 17:2723962-2723984 CGCGGGGGTGGGGGAGGCGGGGG + Intergenic
1143628089 17:8122314-8122336 CGCGGGGGTGGGGCAGCGGAGGG - Intronic
1147598834 17:41733752-41733774 GGGGTGGGTGGGCGGGCGGAGGG - Intronic
1147833806 17:43315667-43315689 CGCGTGGGTAGGCGTGGCTACGG - Intergenic
1149491175 17:57085931-57085953 TGCGCCGGCGGGCGAGCCGAGGG - Exonic
1152141776 17:78540981-78541003 GGCGTGGGTGGGTGAGCGGATGG + Intronic
1152141780 17:78540997-78541019 CGGATGGGTGGGTGAGCAGATGG + Intronic
1152141790 17:78541026-78541048 GGCGTGGGTGGGTGAGCGGATGG + Intronic
1152141800 17:78541055-78541077 GGCGTGGGTGGGTGAGCGGATGG + Intronic
1152141805 17:78541071-78541093 CGGATGGGTGGGTGAGCGGATGG + Intronic
1155392467 18:25351041-25351063 CGCGAGGGAGGCCGAGCGGAGGG - Intronic
1156487620 18:37476650-37476672 CATGTGTGTGGGCGAGCAGAAGG - Intronic
1162033379 19:7926667-7926689 CGCGGGAGTGGCCGAGGCGATGG - Intergenic
1163104117 19:15113816-15113838 CGAGGAGGTCGGCGAGCCGAGGG + Exonic
1163312918 19:16524976-16524998 GCCGTGGGTGGGCGTGGCGAGGG - Intronic
1163390163 19:17026168-17026190 CCCGTGGGTGGGCGTGGTGAGGG - Intronic
1163720503 19:18896169-18896191 CGCGCGGGCGGGAGAGCGGAGGG + Intronic
1165145093 19:33725622-33725644 AGAGTGGGTGGGAGAGCCAAGGG - Intronic
1166986268 19:46661387-46661409 CGCGTGGGGGGGCGTGGCCAGGG - Intergenic
925024131 2:594591-594613 CGCATGTGTGGGCCAGCCCACGG - Intergenic
935696654 2:105776491-105776513 CGGGTGGGTAGGCTAGCAGATGG - Intronic
943767596 2:191678803-191678825 CACGTGGGTGGGGGAGGGGAGGG - Intronic
946288883 2:218728155-218728177 TGGGTGGGTGGGGGAGGCGATGG + Intronic
948641690 2:239379292-239379314 CGCGCAGGTGGGCGAGCCCCGGG + Intronic
1168830364 20:842187-842209 CGGGCGGGTGGGCGAGCCGAAGG + Intronic
1169005965 20:2207464-2207486 CGAGTGGGTGGGGGAGCCGCCGG + Intergenic
1173848375 20:46202178-46202200 CACGTGGCTGGGCAAGCAGAAGG - Intronic
1176157098 20:63627297-63627319 CGCGCGGGCGGCCGGGCCGAGGG + Intergenic
1179623634 21:42634607-42634629 CGGGTGGGTGGGTGAGCAGATGG - Intergenic
1179800265 21:43808452-43808474 CGCGGGGGTGGCAGAGCCGAAGG - Intergenic
1179912371 21:44456949-44456971 CGCGAAGGTGGCGGAGCCGATGG - Exonic
1181312398 22:21952483-21952505 CGGGGGTGTGGCCGAGCCGAGGG - Intronic
1182716078 22:32356987-32357009 CCTGTGGGTGGGCGAGCGGCAGG + Intronic
1183547110 22:38460254-38460276 AGGGTGGGTGGGTGAGCCTAGGG - Intergenic
1183834664 22:40442525-40442547 TGGGTGGGTGGGCGGGCAGATGG - Intronic
1184164983 22:42721712-42721734 CGGGTGGGTGGGGGAGCTGGTGG - Intergenic
968503454 4:961431-961453 CGAGTGGGCGGGCGAGCCCAGGG - Intronic
969694233 4:8725719-8725741 CAAGTGGGTGGCTGAGCCGAGGG - Intergenic
972333280 4:38082726-38082748 GGCCTGGGTGGGCGAGCCCAGGG - Intronic
985588557 5:753216-753238 CGCGAGGGAGGCCGAGCTGATGG - Intronic
985603224 5:845655-845677 CGCGAGGGAGGCCGAGCTGATGG - Intronic
985723891 5:1505646-1505668 CGTGGGGGTGCGCGAGCCGAGGG - Intronic
986313720 5:6572569-6572591 CGAGGGTGTGGGAGAGCCGAAGG - Intergenic
1003133263 6:3413533-3413555 CAGGTGGGTGGGAGGGCCGATGG - Intronic
1006154781 6:32008192-32008214 CGTGTGCCTGGGCGAGCCGCTGG + Intergenic
1006161093 6:32040927-32040949 CGTGTGCCTGGGCGAGCCGCTGG + Exonic
1007644511 6:43369675-43369697 CGCGAGGCTGGGCGAGGGGAGGG + Intergenic
1017738025 6:157381308-157381330 CGCGGGGATGCGCGGGCCGAGGG - Exonic
1019342806 7:516647-516669 CGGGTGGGTGGGAGGGGCGAGGG - Intronic
1019536196 7:1530989-1531011 CGCCTGGGGGCGCGGGCCGAGGG + Intronic
1019693941 7:2434098-2434120 CGGGCGGGTGGGCGGGCGGAGGG - Exonic
1020274356 7:6615648-6615670 CGGGCGGGCGGGCGAGCCCAGGG + Exonic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1061497015 9:130980913-130980935 CGGGGGGGTGGGCGTGCAGATGG + Intergenic
1191641615 X:63433551-63433573 CAAGGGGGTGGGGGAGCCGAAGG + Intergenic
1195839217 X:109154441-109154463 CTTGTGGGTGGGCTAGCTGATGG + Intergenic