ID: 1091730882

View in Genome Browser
Species Human (GRCh38)
Location 12:2879245-2879267
Sequence CTGTGAAAGGTGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5657
Summary {0: 1, 1: 0, 2: 35, 3: 419, 4: 5202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091730882_1091730888 -8 Left 1091730882 12:2879245-2879267 CCTCCCACCTTCACCTTTCACAG 0: 1
1: 0
2: 35
3: 419
4: 5202
Right 1091730888 12:2879260-2879282 TTTCACAGTGTTGGCATTACAGG 0: 1
1: 4
2: 170
3: 4421
4: 59374
1091730882_1091730889 11 Left 1091730882 12:2879245-2879267 CCTCCCACCTTCACCTTTCACAG 0: 1
1: 0
2: 35
3: 419
4: 5202
Right 1091730889 12:2879279-2879301 CAGGCATGAGCCACTGTGCGCGG 0: 35
1: 8067
2: 32660
3: 82763
4: 141295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091730882 Original CRISPR CTGTGAAAGGTGAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr