ID: 1091743109

View in Genome Browser
Species Human (GRCh38)
Location 12:2974098-2974120
Sequence CTAAGGCACCTTGAAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091743109_1091743111 -7 Left 1091743109 12:2974098-2974120 CCCAGGTTTTCAAGGTGCCTTAG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1091743111 12:2974114-2974136 GCCTTAGCCTCCCGAGTAGCTGG 0: 2386
1: 104165
2: 267180
3: 218728
4: 136381
1091743109_1091743114 2 Left 1091743109 12:2974098-2974120 CCCAGGTTTTCAAGGTGCCTTAG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1091743114 12:2974123-2974145 TCCCGAGTAGCTGGAATTACAGG 0: 2259
1: 55039
2: 219904
3: 255826
4: 192186
1091743109_1091743117 21 Left 1091743109 12:2974098-2974120 CCCAGGTTTTCAAGGTGCCTTAG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1091743117 12:2974142-2974164 CAGGCTTGAGCCACCACGCCTGG 0: 369
1: 16014
2: 88695
3: 162147
4: 215877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091743109 Original CRISPR CTAAGGCACCTTGAAAACCT GGG (reversed) Intronic
903812605 1:26043238-26043260 CTCTGGCACCTGGAACACCTGGG - Intronic
907424301 1:54369416-54369438 AAAAGGCATCTTGAAAACCAAGG + Intronic
909094633 1:71271574-71271596 CTCAGGCACCTTTAAAAGGTGGG - Intergenic
912122230 1:106485756-106485778 TTCAGGCAGCTTGGAAACCTTGG + Intergenic
915394312 1:155570916-155570938 CTAATGCAGCTTTAAAAGCTGGG + Intergenic
916964735 1:169925823-169925845 GTAAAGCACTTTGAAATCCTTGG + Intronic
918531557 1:185527845-185527867 CTAATACACCTTGCAAACTTTGG + Intergenic
921227613 1:213035790-213035812 CTATGTCACCATGACAACCTGGG - Intergenic
922366801 1:224873297-224873319 CTAGAGCACCTTGAAAGGCTAGG + Intergenic
923741691 1:236660356-236660378 TTAAGTCACTTTGAAAGCCTTGG + Intergenic
1066252729 10:33650057-33650079 GTAAGGGACCTGGAAAACTTTGG - Intergenic
1069836474 10:71311807-71311829 CTAAGGTACCTGCAACACCTGGG + Intergenic
1070729045 10:78812587-78812609 CTTAAGCACCCTGAACACCTAGG - Intergenic
1076470562 10:130715301-130715323 CAGAGGGACCTAGAAAACCTGGG + Intergenic
1078509126 11:11972781-11972803 CTGAGGCCCCTTTAACACCTTGG - Intronic
1082802360 11:57424563-57424585 CTAAGGGAGCCTGATAACCTTGG - Intronic
1085083070 11:73649380-73649402 GTAAGGCGCCGTGAAAACCGAGG - Intronic
1086199280 11:84181571-84181593 CTAATGTACTTTGAAAATCTTGG - Intronic
1090479118 11:127052451-127052473 ATAAGGCACCATGGAAAACTGGG + Intergenic
1091743109 12:2974098-2974120 CTAAGGCACCTTGAAAACCTGGG - Intronic
1097506200 12:60474850-60474872 GTAAGACACCGTGAAAAGCTAGG + Intergenic
1108033077 13:46257164-46257186 ATGAGGCAGCTTGAAAACCTGGG + Intronic
1108156731 13:47592599-47592621 CTGAGGCACCTTTGAAATCTAGG + Intergenic
1108984268 13:56563704-56563726 CTAATTCACCTTGAATTCCTGGG - Intergenic
1110376857 13:74803530-74803552 CTAGGTCCCCTTGAATACCTGGG + Intergenic
1111171496 13:84532418-84532440 CAAGGGCACATTGAAATCCTAGG - Intergenic
1112597619 13:100822975-100822997 CTAAAGTACTTTGAAATCCTTGG - Intergenic
1114337481 14:21706858-21706880 CAAAGGCCACTTGAAGACCTAGG - Intergenic
1114511921 14:23269370-23269392 ATAAGGCACATTGTAAACTTCGG - Intronic
1115114530 14:29863720-29863742 CCAAGGAAGCTTGAAAACCAAGG - Intronic
1120146224 14:80981929-80981951 CTAGGACACCTTGAGAACCAAGG + Intronic
1124414027 15:29459666-29459688 CCAAGGCACTATGCAAACCTTGG - Intronic
1125839290 15:42783755-42783777 AAAAAGCACCTTGAAAACTTAGG + Intronic
1127904557 15:63366634-63366656 CTCAGGCAAGTTGAAAACTTTGG + Intronic
1131556089 15:93400633-93400655 CTAAGGCACCTACAAAACGATGG - Intergenic
1133805454 16:9123283-9123305 CACAGCCAGCTTGAAAACCTGGG + Intergenic
1134478857 16:14600247-14600269 TTAAGACACCTTGAAAGACTTGG - Intronic
1139128335 16:64109169-64109191 ATAAGGCCCCTTGAAATCATGGG + Intergenic
1139884236 16:70197348-70197370 CTAAGCCACCTTTGCAACCTTGG - Intergenic
1140368279 16:74398148-74398170 CTAAGCCACCTTTGCAACCTTGG + Intergenic
1140697648 16:77550868-77550890 CAAAAGCACCTGGATAACCTAGG + Intergenic
1141494714 16:84400177-84400199 CTTAGGCTCCTTCCAAACCTTGG + Intronic
1143685008 17:8506810-8506832 CTGAGCCACTTTGCAAACCTGGG - Intronic
1143979254 17:10854155-10854177 CCAAGACACCTTGAGAACCACGG - Intergenic
1144265850 17:13568820-13568842 CTCAGGACCATTGAAAACCTTGG - Intronic
1146687011 17:34848025-34848047 CGAAGGCACCCTGACAACCCTGG - Intergenic
1149042114 17:52202535-52202557 TAATGACACCTTGAAAACCTGGG + Intergenic
1149295418 17:55257668-55257690 CCAATGCATCCTGAAAACCTGGG - Intergenic
1150889877 17:69135465-69135487 CTGTGGCATCTTGTAAACCTAGG - Intronic
1155167486 18:23243199-23243221 CTCAGGCACCTTGAAACCTGAGG - Intronic
1159185450 18:64966227-64966249 CTAAGGCTCCTTGCAGACCCAGG - Intergenic
1164841889 19:31398929-31398951 CCAAGGGACCTTGTAAACATGGG - Intergenic
931434900 2:62237665-62237687 CTACAGCAACTTCAAAACCTAGG - Intergenic
931919652 2:66999874-66999896 CTAAGGCACCTATATCACCTTGG + Intergenic
939024011 2:136990379-136990401 CTCAGGCATCTTGATCACCTTGG - Intronic
942789972 2:179749727-179749749 CAAAGGCATATTTAAAACCTTGG - Intronic
944099641 2:196009457-196009479 CTAGGCCAAGTTGAAAACCTTGG - Intronic
944217641 2:197271901-197271923 CTAAGACAGTTTTAAAACCTTGG - Intronic
944429408 2:199617029-199617051 CTAAAGAACCTTGAAATCCCAGG - Intergenic
944589513 2:201203835-201203857 CCAAGTCACCTTGAATTCCTTGG - Intronic
1169497792 20:6131878-6131900 CTAAGGCAAGTTGAAAATCAAGG + Intergenic
1172514905 20:35526662-35526684 CTGAGGCACCTAAAAAAACTGGG + Intronic
1173163627 20:40670947-40670969 CTAAGGGACCTTGAGAGCCAGGG - Intergenic
1175387384 20:58605984-58606006 CCAAGGCACCCTGCAGACCTGGG + Intergenic
1177410076 21:20718524-20718546 CTCAGGTTCCTTGAAAGCCTGGG - Intergenic
1177567479 21:22843811-22843833 CTAAGGCATCCTGAACCCCTGGG - Intergenic
1179339140 21:40487965-40487987 CTAAGGCACATTCAAATCCCTGG + Intronic
1179481009 21:41678710-41678732 CTAAGGCACCTGGAAAACGGAGG - Intergenic
1179587375 21:42382295-42382317 CTCAGGTATCCTGAAAACCTAGG + Intronic
1179922610 21:44515342-44515364 CTAAGGCACCTTCAGGGCCTGGG + Intronic
951579997 3:24152665-24152687 CTAAGGCATTCTGAAATCCTGGG - Intronic
951791592 3:26491568-26491590 CTAGGACAGCTTGAAAAGCTGGG + Intergenic
953783992 3:45896831-45896853 CTAAGGCACAATGGAAGCCTTGG + Intronic
954829508 3:53407874-53407896 TTAAGGGACCTTGGAAACCTGGG - Intergenic
961330257 3:126134208-126134230 CTCAGGCCCCGTGAAGACCTGGG - Intronic
961836812 3:129668464-129668486 CTTACTAACCTTGAAAACCTGGG - Intronic
963008990 3:140751983-140752005 CTGAGGCATCTTAAAAACCTTGG - Intergenic
964524597 3:157605104-157605126 GGAAGGCACCTTGAATAACTGGG + Intronic
965787885 3:172355570-172355592 CTTATGAAACTTGAAAACCTTGG + Intronic
969153592 4:5191146-5191168 CTATGGCACCATGGAAACCAGGG - Intronic
970592802 4:17574225-17574247 CTTAAGCACCTTGTAAACTTAGG + Intergenic
971148927 4:24010311-24010333 CAAAGCCACCTTGAAAACTAAGG - Intergenic
974997125 4:69175256-69175278 CCATGGCACCTATAAAACCTGGG - Intronic
977894569 4:102348889-102348911 CTCAGGCACTTGGGAAACCTGGG + Intronic
978414989 4:108465358-108465380 CTAAGGCCCCTTTATACCCTGGG + Intergenic
981976487 4:150736048-150736070 CTGAGGTACTCTGAAAACCTGGG - Intronic
982965431 4:161900714-161900736 TTCAGGCACCTTGGCAACCTTGG - Intronic
987618620 5:20308798-20308820 CTATGCCACATTGAAAACCAAGG + Intronic
988234737 5:28527629-28527651 CCAGGGCACCTTCAAAATCTAGG + Intergenic
993085870 5:83363217-83363239 CTAAGCCTCCTGGAAAACCCTGG - Intergenic
995809532 5:116089201-116089223 GTATGGCAACTTGAAAACATAGG + Intronic
998365442 5:141627845-141627867 CCAAGGCCACTTAAAAACCTTGG + Intronic
1003800478 6:9659747-9659769 CTAAGTTGCCTTGAAACCCTTGG - Intronic
1007755539 6:44096825-44096847 CTATGGCACCATGACATCCTGGG - Intergenic
1008483953 6:52015182-52015204 CTAAGTCACCTTTAAAAATTAGG - Intronic
1011712442 6:90068400-90068422 CAAAAGCACTTTGAAAACCAAGG - Intronic
1013175774 6:107675362-107675384 CTAAGCCACCCTGAAGCCCTGGG + Intergenic
1013581260 6:111536836-111536858 CTAAGGAACCAAGAAAACCAGGG + Intergenic
1014837448 6:126175528-126175550 CTAAATCAACTTGAAAACTTTGG + Intergenic
1016079182 6:139834915-139834937 CTTAGGAAACTTGAAAACCTGGG - Intergenic
1016447584 6:144149822-144149844 GTAAAGCACCTTGAAAAACAAGG - Intergenic
1016840938 6:148524861-148524883 CTCAGGCATCCTGAAAACCCAGG - Intronic
1017417504 6:154236775-154236797 CTGAGGCTCCTTGACAATCTAGG - Intronic
1022263780 7:28733328-28733350 CTCAGGTACCTTGGAAACATGGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1038648085 8:29377908-29377930 CAAAGGAACATTGAGAACCTTGG + Intergenic
1039735759 8:40330714-40330736 CTAAGTGAACTTGAAAATCTTGG - Intergenic
1041673147 8:60512999-60513021 CTAAGGAACCATGGAAACCAAGG + Intergenic
1042778325 8:72460907-72460929 CTAAGCCACTTTGAATTCCTGGG + Intergenic
1042806638 8:72777477-72777499 CTAAGGCACATTGAACCCTTAGG - Intronic
1050015771 9:1232320-1232342 CAAATGCACCTTGAAAACTGTGG + Intergenic
1050410220 9:5356346-5356368 CTAAGGCCCCTAGAGAACATGGG - Intergenic
1056021493 9:82442616-82442638 CTAAAGTACCATGGAAACCTGGG + Intergenic
1058716619 9:107728015-107728037 CTAAGGTAACATGAAAAACTTGG + Intergenic
1062554241 9:137106851-137106873 CTCAGGCACCTTGGAAGCCAAGG - Intronic
1187081703 X:15996735-15996757 CAAAGGCACATAGAAAATCTGGG - Intergenic
1187363628 X:18649707-18649729 AAAGTGCACCTTGAAAACCTTGG + Intronic
1188833048 X:34924461-34924483 CCCTGGCACTTTGAAAACCTTGG - Intergenic