ID: 1091743908

View in Genome Browser
Species Human (GRCh38)
Location 12:2978747-2978769
Sequence GAAGAGAGACTATCAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091743908_1091743914 17 Left 1091743908 12:2978747-2978769 CCAACCCCTGATAGTCTCTCTTC 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1091743914 12:2978787-2978809 TGCATATTCTCAGTACTTCATGG 0: 1
1: 0
2: 0
3: 17
4: 199
1091743908_1091743913 -9 Left 1091743908 12:2978747-2978769 CCAACCCCTGATAGTCTCTCTTC 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1091743913 12:2978761-2978783 TCTCTCTTCGGCTGTCTCTATGG 0: 1
1: 0
2: 0
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091743908 Original CRISPR GAAGAGAGACTATCAGGGGT TGG (reversed) Intronic
901395401 1:8977384-8977406 AAGGATAGACTTTCAGGGGTGGG - Intergenic
902686477 1:18080747-18080769 GAGGAGAGACTGTCAGGGGCTGG + Intergenic
903999696 1:27331958-27331980 GAAGAGGGTATGTCAGGGGTGGG - Intronic
905202035 1:36322150-36322172 GAAGGGAGCCTCTCAGGGGGTGG + Exonic
905361553 1:37424245-37424267 CAAGAGAAACTGTCAGGGCTGGG - Intergenic
905394047 1:37655966-37655988 GCAGGAAGACTCTCAGGGGTTGG - Intergenic
909936347 1:81555562-81555584 AAGTAGAGACTATCAGGGCTGGG - Intronic
913962085 1:143348063-143348085 GAAGAGTGGCTACCAGGGGCTGG - Intergenic
914056441 1:144173638-144173660 GAAGAGTGGCTACCAGGGGCTGG - Intergenic
914122705 1:144792724-144792746 GAAGAGTGGCTACCAGGGGCTGG + Intergenic
916445494 1:164868242-164868264 GAAGAGAGAATATCTCGGGGCGG - Intronic
917152751 1:171962364-171962386 GAATAGAGGTTACCAGGGGTTGG + Intronic
917380722 1:174404247-174404269 GAGGAGAGAATATCTGAGGTGGG + Intronic
919034780 1:192292802-192292824 GAAGAATGACTACCAGGGGCTGG - Intergenic
920093833 1:203472863-203472885 GAAGAGAGAGTATAAGGTTTGGG - Intergenic
922182309 1:223244898-223244920 GAAGAGAGACTAACAGCACTGGG + Intronic
922238042 1:223736239-223736261 GAAGAGAGATCCTCAGGGGCTGG + Intronic
922286113 1:224172175-224172197 TAATAGAGATTAACAGGGGTTGG - Intergenic
923276342 1:232400180-232400202 GAAGTGAGTCTATCCAGGGTGGG - Intronic
923496395 1:234529285-234529307 AAAGAGAGATTATCCTGGGTGGG + Intergenic
923969537 1:239184219-239184241 GAAGACAGCCTATAAGGGCTGGG + Intergenic
924365918 1:243293464-243293486 GAAGAGAGGTCATCAGGGGTTGG - Intronic
924448567 1:244157161-244157183 GAATAGAGGCTATCGGGGGCGGG - Intergenic
924598000 1:245464056-245464078 GAAGAAAGACTAGAAAGGGTGGG - Intronic
1063002620 10:1939127-1939149 GAAGAGAGGCTCACAGGAGTGGG - Intergenic
1064339850 10:14476086-14476108 GAGGAGAGAATATAAGGGGGTGG + Intergenic
1065696811 10:28388068-28388090 GAAGAGAGAGAAAGAGGGGTGGG + Intergenic
1065827026 10:29582035-29582057 GAAGGGAGTTTATCAGGGGCTGG + Intronic
1065950822 10:30649147-30649169 GAAGGGAGTTTATCAGGGGCTGG - Intergenic
1066424657 10:35295592-35295614 GAATAGAGGTTATCAGGGGCTGG - Intronic
1067573586 10:47389435-47389457 GAATAGAGATTACCAGGGTTTGG - Intergenic
1068460891 10:57326994-57327016 GAAGAGAGAGAAGCAGGGGAGGG - Intergenic
1069237696 10:66098026-66098048 CAAGAGAGACTTTCAGGGTCTGG + Intronic
1069606627 10:69742982-69743004 AAAGAGAGACTAACTGGGGTTGG + Intergenic
1072770180 10:98131555-98131577 GAAGAGAGGCCAACATGGGTGGG + Intergenic
1073004444 10:100311973-100311995 GAGGAGTGACTGTCAGGGGAGGG - Intronic
1074070695 10:110065834-110065856 GAAGAGAGGCTAAAAGAGGTCGG - Intronic
1074911310 10:117911876-117911898 AAAGAGAGATTATCCTGGGTGGG - Intergenic
1075193181 10:120330107-120330129 GAGGAGAGGCTAGCAGGGCTGGG + Intergenic
1076480572 10:130782661-130782683 GCAGAGAGACCAGCAGGGGGAGG + Intergenic
1077095259 11:796373-796395 GAGGAGAGATGAGCAGGGGTGGG + Intronic
1077304392 11:1862652-1862674 GAGGTGAGATTACCAGGGGTAGG - Intronic
1077322591 11:1948964-1948986 GATGAGAGGCTGGCAGGGGTTGG - Intronic
1077741418 11:4849587-4849609 GAAGTCAGACTGTCTGGGGTTGG - Intronic
1078598425 11:12709822-12709844 AAAAAGAAACTATCAGGGCTGGG - Intronic
1078723229 11:13903167-13903189 GAAGAAAGGCTTTCAGAGGTTGG + Intergenic
1079265028 11:18922489-18922511 GAAGAAAGAATATCAGAGGTTGG + Intergenic
1079267204 11:18944634-18944656 GAAGAAAGAATATCAGAGGTTGG + Intergenic
1080750643 11:35147303-35147325 GAAAAGAGGCTGTCAGGAGTAGG + Intronic
1081039160 11:38189406-38189428 TAAGAGAGATTATCCTGGGTGGG - Intergenic
1081763210 11:45591516-45591538 GAAGAGAGACTCTGGGGGCTGGG - Intergenic
1081796939 11:45826954-45826976 GTAGTTAGACTAACAGGGGTAGG + Intergenic
1082887298 11:58100083-58100105 GATGAGAGACTACCTGGCGTGGG - Intronic
1083925434 11:65803331-65803353 GAAGAAATACTAACACGGGTGGG + Intergenic
1084068686 11:66720165-66720187 GAAGAGAGACTCCAAGGGGGAGG - Intronic
1084176067 11:67422985-67423007 GCAGAGAAACTACCAGGGCTGGG - Intronic
1085183628 11:74557136-74557158 CAAGAGAGATTATCTTGGGTGGG + Intronic
1085938984 11:81185607-81185629 AAGGAGAGACTAAAAGGGGTAGG - Intergenic
1086089260 11:82988897-82988919 CAAGAGAGACTGTGTGGGGTGGG - Intronic
1088715207 11:112543002-112543024 GAAGAGAGAATGTTGGGGGTGGG - Intergenic
1202805608 11_KI270721v1_random:4277-4299 GATGAGAGGCTGGCAGGGGTTGG - Intergenic
1091743908 12:2978747-2978769 GAAGAGAGACTATCAGGGGTTGG - Intronic
1091858391 12:3757047-3757069 GAAGAGCCAGTGTCAGGGGTCGG + Intronic
1092168588 12:6359065-6359087 GAAGAGTGGCTCTCAGGGCTTGG + Intronic
1092332293 12:7595584-7595606 GAAGAAAGAATATCAGTGATTGG + Intergenic
1092546321 12:9454769-9454791 GAAGAGTGATTGTCAGGGGCTGG + Intergenic
1093821273 12:23621267-23621289 GAATAGAGCTTATCAGGGGATGG + Intronic
1094298623 12:28936110-28936132 CAATAGAGACTATCTGGTGTGGG + Intergenic
1094506621 12:31067305-31067327 GAAGAGTGATTGTCAGGGGCTGG - Intergenic
1094594520 12:31852568-31852590 GATTAGAGATTATCAGAGGTTGG + Intergenic
1096449409 12:51724824-51724846 GAAGAGAGATGATCAGGTTTAGG + Intronic
1096771717 12:53939616-53939638 GAAGGGAGACTTCCAGAGGTGGG - Exonic
1097070495 12:56350962-56350984 GAAGAGGGATTATAAGAGGTAGG + Intronic
1097148651 12:56959626-56959648 GAAGAAAGAATATCAGTGATTGG + Intergenic
1098521670 12:71440318-71440340 GGAGAGAGACTAAGAGGGGAAGG + Intronic
1100521707 12:95381577-95381599 GAACAGAGACTGGGAGGGGTGGG + Intergenic
1103713003 12:122927089-122927111 GAAGAGAAACTGTGAGGGGTGGG + Intronic
1103747144 12:123132687-123132709 GAATAGTGTTTATCAGGGGTTGG - Intronic
1104730202 12:131101179-131101201 GAGCAGAGATGATCAGGGGTGGG + Intronic
1106312805 13:28568495-28568517 TAAGAGATACTATCAGGCCTTGG - Intergenic
1106405448 13:29469266-29469288 AAAGAGAGATTAGAAGGGGTGGG - Intronic
1106995566 13:35476410-35476432 GAAGAGAGACAAGCAGAGGGGGG - Exonic
1108040845 13:46338341-46338363 GAAGAGAGAGGGGCAGGGGTTGG - Intergenic
1109307212 13:60654119-60654141 GGAGAGAGATGATCAGAGGTAGG + Intergenic
1111899480 13:94183225-94183247 GAATAGAGATTACCAGGGGTTGG - Intronic
1112636080 13:101219542-101219564 GCACAGAGACTATCAGGTGCTGG + Intronic
1115798221 14:36962503-36962525 GAACAGTGGCTACCAGGGGTGGG - Intronic
1116529737 14:45955291-45955313 GAAGAGAGACAATAAAGGGAAGG - Intergenic
1118304513 14:64644587-64644609 GAAGAGAGCCTACCAGGAGCTGG + Intergenic
1119490974 14:75032907-75032929 GGAGAGAAACTAGGAGGGGTGGG + Intronic
1120418579 14:84252825-84252847 GAAAAGAGACAAACAGGGGAGGG + Intergenic
1120843713 14:89108403-89108425 GTAGAGATACCACCAGGGGTTGG + Intergenic
1122114466 14:99520764-99520786 GAAGTGAGGCTCACAGGGGTGGG - Intronic
1125715409 15:41817179-41817201 GAACAGAGACTCTCAGTGCTGGG + Intronic
1125757420 15:42072888-42072910 GAAGAGGGACGATGAGGGGGAGG - Intronic
1125832291 15:42725554-42725576 GAAGGAAGACTTTCAGGGGCCGG - Exonic
1126112020 15:45181013-45181035 GTGGGGAGACTATCGGGGGTTGG - Intronic
1126901752 15:53321668-53321690 CAAGAGAAAATATCAGGGGCCGG - Intergenic
1127556499 15:60092758-60092780 GAACAGAGTCTAGCAGGGGTAGG + Intergenic
1128186588 15:65647923-65647945 GAAGTCAGAATATCTGGGGTGGG + Intronic
1128414685 15:67434247-67434269 GATGAGTGATTACCAGGGGTCGG - Intronic
1128884607 15:71275104-71275126 GAATAGAGACTCACAGGGGTAGG + Intronic
1129831519 15:78674075-78674097 CAACAGAGTCTCTCAGGGGTGGG - Intronic
1130628955 15:85545992-85546014 GAACAGAGGTTATCAGGGGCTGG - Intronic
1131395777 15:92084856-92084878 GAAGAGATACTATCACTGGCTGG - Intronic
1131685281 15:94760642-94760664 GACAAGAGACTCTCAAGGGTAGG - Intergenic
1132080120 15:98856415-98856437 GCAGAGAGACTATCAGAGTGAGG + Intronic
1133289524 16:4710103-4710125 GAATAGTGATTATCAGAGGTTGG + Intronic
1133415912 16:5606876-5606898 GAAGAGGGGATGTCAGGGGTTGG + Intergenic
1135055652 16:19230029-19230051 GAATAGAGATTATCAGGGGCTGG + Intronic
1136590611 16:31215685-31215707 GAAGGGAGACTGTAAGGGCTAGG + Intronic
1137342023 16:47617457-47617479 GAATAGAGATTACCAGGGGCTGG - Intronic
1137379182 16:47981823-47981845 GAGGAGGGGCCATCAGGGGTGGG - Intergenic
1137400515 16:48150180-48150202 GAAGAGAGGCTAGCAGGGGCAGG - Intronic
1138412491 16:56851234-56851256 GGAGGGAGACTGTCAGGGGCTGG + Intergenic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1140611398 16:76603214-76603236 GAAGAGTGGCTACCAGGGGATGG - Intronic
1141230500 16:82162686-82162708 GAGGAGAGACTATCAAGGTGTGG - Intronic
1144196691 17:12901557-12901579 GGAGGGAGAGTATCAGGGCTTGG + Intronic
1144683843 17:17213516-17213538 GAAGGGAAACCATCAGGGCTGGG - Exonic
1146464889 17:33078657-33078679 GAAGAGGGAGAATCAGGAGTTGG - Intronic
1146555877 17:33823564-33823586 GAAGAGACACTATCAGTGTAAGG - Intronic
1147646757 17:42038929-42038951 GAAGAGACACTGCCAGGAGTGGG + Intronic
1148215103 17:45830035-45830057 GGAGAGAGAGGATGAGGGGTAGG - Intronic
1152094950 17:78267424-78267446 GAAGAGAGAGTCTGTGGGGTGGG + Intergenic
1152372654 17:79899625-79899647 AAAGAGAGAATAACAAGGGTTGG + Intergenic
1153111944 18:1601429-1601451 GAAGACAGACAGTGAGGGGTAGG + Intergenic
1155766349 18:29638227-29638249 GAAGAAAGACAAACATGGGTTGG + Intergenic
1156590068 18:38477391-38477413 GAACAGAGGTTATCAGGGGCTGG - Intergenic
1156906880 18:42363392-42363414 GAAGAGAGAATAACAGGGATTGG + Intergenic
1157592094 18:48842179-48842201 GAAGAGAAACAACCAGGGGATGG + Intronic
1160189069 18:76699969-76699991 GAACAGTGATTGTCAGGGGTGGG - Intergenic
1162459894 19:10808641-10808663 GAACAGGGAATATTAGGGGTGGG - Intronic
1163393605 19:17045831-17045853 GAAGCGAGACTCCCAGGGGCTGG - Intergenic
1163455083 19:17401814-17401836 GCAGAGAGACTCTCTGGGGGAGG + Intergenic
1164819467 19:31235359-31235381 GAATGGTGCCTATCAGGGGTTGG - Intergenic
1167067223 19:47195629-47195651 GAAGAGAGATGATAAGGAGTGGG - Intronic
1167392046 19:49201937-49201959 GAAGAGAGACATTCAGAGATGGG - Intronic
1202695922 1_KI270712v1_random:126315-126337 GAAGAGTGGCTACCAGGGGCTGG - Intergenic
925835646 2:7943731-7943753 CAAGTGAGGCTATCAGGGATTGG + Intergenic
925914038 2:8591965-8591987 GAAGAGTAATTATAAGGGGTGGG - Intergenic
927693355 2:25223607-25223629 GAAGAAAGTCTATCAGGGCCGGG - Intergenic
928436874 2:31260481-31260503 GCAGAGGGACAATCAGGGGCTGG - Intronic
928797990 2:35047788-35047810 GAATAGTGATTATGAGGGGTTGG + Intergenic
929700214 2:44156253-44156275 GCAGAGAGACTTAAAGGGGTAGG - Intergenic
932727410 2:74191368-74191390 GCAGAAAGACTAGCTGGGGTGGG + Intergenic
935111547 2:100098953-100098975 GAAGAGAGGCTTCCAGGGCTAGG - Intronic
935627597 2:105184220-105184242 GCAAAGAGAATGTCAGGGGTGGG + Intergenic
935783813 2:106531282-106531304 GAAGAGATACTCTCAGTGTTGGG + Intergenic
936102009 2:109590380-109590402 GAAGGGAGACTATCCTGGTTGGG + Intronic
936439735 2:112541547-112541569 AAGGAGGGACTATCAGGGGCAGG + Exonic
936848942 2:116872959-116872981 GAAGAAAGAATATCAGAGTTTGG - Intergenic
937200428 2:120200605-120200627 GAATAGAGGTTACCAGGGGTTGG + Intergenic
937994247 2:127680960-127680982 GAAGAGATACTCTCAGAGGCAGG - Intronic
938912646 2:135899257-135899279 GGAGAGAGAGCATCAGGGGCTGG + Intergenic
940261754 2:151788070-151788092 GAACAGAAACTTTCAGGGTTTGG - Intergenic
941035982 2:160569763-160569785 TAAGAGAGACTAACGGGGCTCGG - Intergenic
941046436 2:160680946-160680968 GAATTGTGGCTATCAGGGGTTGG - Intergenic
942153755 2:173105731-173105753 GAATAGAGATTACCAGGGGCTGG + Intronic
942372966 2:175306034-175306056 GAAGAGAGAATAACAGAAGTGGG - Intergenic
942492059 2:176499279-176499301 GCAGAGAGGCCAGCAGGGGTGGG - Intergenic
942929709 2:181475000-181475022 AGAGAGAGACAATCAGTGGTTGG + Exonic
943308113 2:186292335-186292357 CAATAGTGACTATCAGAGGTTGG + Intergenic
943900931 2:193435171-193435193 CAGGAGAGAATATCGGGGGTGGG - Intergenic
1168737145 20:150365-150387 GACCAGTGATTATCAGGGGTGGG - Intergenic
1173340218 20:42146530-42146552 GAAGTCAGACTCTCTGGGGTGGG + Intronic
1174143094 20:48430706-48430728 CAGGAGAGACTTTGAGGGGTGGG + Intergenic
1174901502 20:54505659-54505681 AAAGAGAGAGTATAGGGGGTGGG + Intronic
1175205227 20:57306065-57306087 GAAGAAAGAGTAGCAGGTGTTGG - Intergenic
1176597060 21:8757426-8757448 GAAAAGAGAATATCAGGGATAGG + Intergenic
1176642877 21:9323371-9323393 GAAAAGAGAATACCAGGGATAGG + Intergenic
1178279524 21:31269377-31269399 TAAGAGAAACTCTCAGGGGATGG + Intronic
1178901236 21:36600859-36600881 AAAGAGAGAGTTGCAGGGGTAGG - Intergenic
1179066453 21:38029059-38029081 GAAGAGTGACTATCAGGATGGGG - Intronic
1179477580 21:41657663-41657685 AAAGAGAGAGTATGTGGGGTGGG + Intergenic
1180351898 22:11812774-11812796 GAAAAGAGAATACCAGGGATAGG + Intergenic
1180370058 22:11975828-11975850 GAAAAGAGAATACCAGGGATAGG - Intergenic
1180376194 22:12096293-12096315 GAAAAGAGAATACCAGGGATAGG + Intergenic
1180386308 22:12179296-12179318 GAAAAGAGAATACCAGGGATAGG - Intergenic
1180421380 22:12817406-12817428 GAAAAGAGAATACCAGGGATAGG - Intergenic
1180670322 22:17548168-17548190 GAAGAGAAACCACCAGGTGTTGG + Exonic
1183417495 22:37690949-37690971 GGTCAGACACTATCAGGGGTGGG - Intronic
1183540308 22:38426134-38426156 GAGGAGGGACTCTGAGGGGTGGG - Intergenic
1183977757 22:41523167-41523189 GAAGACAGAATGTCAAGGGTGGG - Intronic
1184266253 22:43348208-43348230 GAAAACAGACTAGCAGAGGTGGG - Intergenic
949912972 3:8929595-8929617 AAAGACAGACTAACAGGTGTTGG + Intronic
950509328 3:13416225-13416247 CAGGAGAGACTGTCAGGGGCAGG + Intronic
951375838 3:21915718-21915740 GAAGGTAGAATATCAAGGGTAGG + Intronic
953473985 3:43190522-43190544 GAAGAGAGCGTGTCAGTGGTAGG - Intergenic
954012582 3:47655046-47655068 GTAGAGAGAACAACAGGGGTAGG + Intronic
954493285 3:50928317-50928339 GAATAGAGATTACCAGGGGCTGG - Intronic
954897519 3:53988999-53989021 GAATAGAGGTTACCAGGGGTTGG + Intergenic
955216719 3:56990185-56990207 GAAAAGAGAATACCAGAGGTGGG + Intronic
956391993 3:68784199-68784221 TAAGAGAGATTATGAGGGGAAGG + Intronic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
956940401 3:74153944-74153966 GAATAGAGGTTATCAGGGGCTGG + Intergenic
959292036 3:104486332-104486354 GAAGAAAGAATATCAGAGATTGG + Intergenic
959538525 3:107514036-107514058 GAAGTGAGATTTTCAGGGCTTGG - Intergenic
959810425 3:110612830-110612852 GAGGAGAGATTTTCAGGGTTGGG - Intergenic
960162964 3:114370494-114370516 GCAGAGAGACCATCAGGGAGAGG - Intronic
961014907 3:123460146-123460168 GGAGAGAGATTATCCGGGTTTGG - Intergenic
961444369 3:126972286-126972308 GAAGAGAGGCTGGCAGGGGGAGG + Intergenic
961713595 3:128844788-128844810 GAAGACAGACTCTGAGGGGCCGG + Intergenic
962186875 3:133269619-133269641 GAAACCAAACTATCAGGGGTTGG - Intronic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
965758372 3:172048932-172048954 GAATAGAGATTACCAGGGCTTGG + Intronic
967796200 3:193601447-193601469 CAATAGAGACCCTCAGGGGTTGG + Intronic
968348014 3:198027525-198027547 GAATAGAGGCTGTCAGGGCTGGG - Intronic
1202744008 3_GL000221v1_random:81642-81664 GAAAAGAGAATACCAGGGATAGG - Intergenic
969405560 4:6989245-6989267 GAGGAGAGACTATGAGGTATGGG - Intronic
969454726 4:7294730-7294752 GAAGAGAGAGGATGAGGGGGAGG - Intronic
969520093 4:7672637-7672659 GAAGTGAGACTGTCAGGGAAGGG - Intronic
973360360 4:49159648-49159670 GAAAAGAGAATACCAGGGATAGG + Intergenic
973399727 4:49628261-49628283 GAAAAGAGAATACCAGGGATAGG - Intergenic
976200167 4:82570187-82570209 AAAGAGAGAGTATTAGGGGAGGG - Intergenic
976200231 4:82570659-82570681 GAAGAGATAGGATCAGGCGTAGG - Intergenic
978332821 4:107633569-107633591 GGACAGAGATTATCTGGGGTGGG + Intronic
979274794 4:118803064-118803086 GAACAGAGTCTACCAGGGGCTGG + Intronic
979327626 4:119397882-119397904 CAAGAGAGAGCATCAGGGCTGGG - Intergenic
980988319 4:139717257-139717279 GAAGTGAGACAGACAGGGGTGGG - Exonic
982424036 4:155235919-155235941 GAAGAGAGAGAATCTGGGGAAGG - Intergenic
982648283 4:158051725-158051747 GAGATGAGACTCTCAGGGGTGGG - Intergenic
983245378 4:165281608-165281630 CAAGAGAGAGCATCAGGGCTGGG - Intronic
983620892 4:169759522-169759544 GAAGAGATACGATGGGGGGTGGG - Intergenic
983888061 4:173002947-173002969 GAATAGACAGTACCAGGGGTTGG + Intronic
985131986 4:186748007-186748029 GAAAAGAGAATAGCTGGGGTAGG + Intergenic
985301764 4:188497668-188497690 GAAGAGAAACTATAAGGATTTGG - Intergenic
1202757794 4_GL000008v2_random:81733-81755 GAAAAGAGAATACCAGGGATAGG + Intergenic
985945754 5:3181627-3181649 GGAGAGAGAGAATCAGAGGTGGG - Intergenic
986828479 5:11548282-11548304 GAAGAGAGACAATGAGGAGGGGG + Intronic
987667989 5:20969578-20969600 GAAGAGAGAATAGCAGGTATAGG - Intergenic
988602585 5:32653758-32653780 TAAGAGGAAATATCAGGGGTCGG - Intergenic
989400766 5:41005418-41005440 GAAGAGAGACTTCAAGGGGGGGG - Intronic
989543116 5:42641131-42641153 AAGGAGAGTCTATCAGGGGAAGG - Intronic
991778291 5:70107122-70107144 GAAGAGAAGTTATCAGGGGCTGG + Intergenic
991857581 5:70982588-70982610 GAAGAGAAGTTATCAGGGGCTGG + Intronic
991870739 5:71107467-71107489 GAAGAGAAGTTATCAGGGGCTGG + Intergenic
992214881 5:74516163-74516185 GAAGAGAGAGTAGCAAGTGTGGG - Intergenic
993498164 5:88631848-88631870 CAAGAGAGACTAGAAAGGGTAGG - Intergenic
995359942 5:111284547-111284569 CAAGAGAGACTATCTGAGGCTGG - Intronic
996803297 5:127427422-127427444 GAGGAGAGACTATCAAGGCATGG + Intronic
996960730 5:129245877-129245899 GTAGAGAGAGTTTCAGGAGTGGG - Intergenic
997456307 5:134020073-134020095 GAAGAGAGACTGTGTGGGGAGGG + Intergenic
998719234 5:144924801-144924823 AAAGAGAAACTTGCAGGGGTTGG + Intergenic
999425437 5:151484206-151484228 GATGACAGACTCTCAGGGCTGGG + Intronic
999759721 5:154690962-154690984 CAAGAAAGAGTATCAGGGCTGGG + Intergenic
1000380990 5:160629199-160629221 GCAGAGAGTCTGTCAGGAGTGGG + Intronic
1000965970 5:167657129-167657151 GAAGAGAGAATACCAGAGGCTGG - Intronic
1002545871 5:179944824-179944846 GAAAGGGGACTAGCAGGGGTAGG - Intronic
1002794559 6:461803-461825 GAAGGGTGATTATCATGGGTTGG - Intergenic
1005361851 6:25038440-25038462 AAAGAGAGATTATCCTGGGTGGG + Intronic
1005876715 6:30016225-30016247 GAATAGAGATTACCAGGGGCTGG + Intergenic
1005885027 6:30091168-30091190 GAGGTGAGCCTACCAGGGGTTGG + Intergenic
1007043027 6:38742920-38742942 CAAGATATACTATCAGGGGTGGG - Intronic
1007693144 6:43715858-43715880 GAGGACAGAATATCAGAGGTTGG + Intergenic
1010413294 6:75585374-75585396 GAACAGTGACTATCTGGGGCTGG - Intergenic
1011349780 6:86409703-86409725 GAGAAGAGACTCACAGGGGTGGG + Intergenic
1013029346 6:106316686-106316708 GAGGAGAAACTATCTGGAGTAGG - Intronic
1013591779 6:111624879-111624901 GAACAGAGGCTACCAGGGGCTGG + Intergenic
1014328260 6:120027141-120027163 GAAGACAGATTATCCTGGGTGGG - Intergenic
1015675626 6:135744288-135744310 GAAGAAAGATTATCATGGGCTGG - Intergenic
1016723601 6:147332590-147332612 GAAGAGAGAGTACCAGTGGTGGG + Intronic
1017200138 6:151743922-151743944 GATGAGTGATTATCAGGGGCCGG - Intronic
1021643561 7:22765084-22765106 AAAGAGAGGCTATGAGGAGTTGG - Intergenic
1022125124 7:27349169-27349191 GAAGGGAGATAATCACGGGTGGG + Intergenic
1022857255 7:34327344-34327366 GATGAGCGACTAACAGGGATGGG - Intergenic
1023270981 7:38462464-38462486 GAAGAGAAACAATAAGGGCTGGG - Intronic
1024124405 7:46277441-46277463 GATGAGTGATCATCAGGGGTTGG - Intergenic
1025970878 7:66324223-66324245 GAATGGAGGTTATCAGGGGTGGG + Intronic
1026019313 7:66695418-66695440 GAAGAGAGACCGTCATGGGCAGG + Intronic
1029007732 7:97228183-97228205 GAAGAAAGACTATGACAGGTAGG - Intergenic
1029919798 7:104251168-104251190 GCAGAGAGACTAGCAGGTGGTGG - Intergenic
1030842375 7:114371688-114371710 TAAAAGATACTCTCAGGGGTGGG - Intronic
1031043749 7:116864254-116864276 GAAGAGAGACTACTCGGTGTGGG + Intronic
1031527738 7:122841980-122842002 GAAGAGAAACCATTAGGGATGGG + Intronic
1031880759 7:127195754-127195776 GAAGAGAGATGCTCAGGGTTTGG - Intronic
1032134238 7:129260440-129260462 GAGAAGAGACTATCTGGGGTAGG - Intronic
1032805867 7:135353693-135353715 CAGGAGAGAGTAGCAGGGGTGGG - Intergenic
1038694054 8:29789877-29789899 GAATAGAGATTACCAGGGGCTGG + Intergenic
1039085791 8:33778204-33778226 GAAGAGAGACATCCAGTGGTAGG + Intergenic
1039842259 8:41302688-41302710 GAGGAGAGACTCTCAGGGTGTGG + Intronic
1041231388 8:55756737-55756759 GAAGAGAGCCTATCACAGGTTGG + Intronic
1041745984 8:61210003-61210025 AAAGAAAGATTATCATGGGTGGG + Intronic
1042112852 8:65399469-65399491 GAATAGAGGCTAGCAGGGGTTGG + Intergenic
1042222168 8:66484452-66484474 GAGGAGAGAATATGAGGGGTTGG - Intronic
1042420989 8:68589398-68589420 GAAGAGAGAAAATAAGAGGTGGG + Intronic
1042577360 8:70235264-70235286 GAACATAGATTATCAGGGGCTGG + Intronic
1043227841 8:77755217-77755239 GAATGGAGAGTTTCAGGGGTGGG - Intergenic
1045296113 8:100872881-100872903 GAATAGGGAGTGTCAGGGGTGGG + Intergenic
1046473270 8:114707854-114707876 AAAGAGAGATCATCTGGGGTAGG - Intergenic
1047841045 8:128753839-128753861 AAAGATAGTCTATCAGGGTTTGG - Intergenic
1048222951 8:132560289-132560311 GAGGAAAGACTCACAGGGGTGGG + Intergenic
1048397271 8:134025834-134025856 GAAAACAGACTATTAGGGGATGG - Intergenic
1048795173 8:138143116-138143138 GAAGAGAGAGGAACAGGTGTTGG + Intronic
1049553032 8:143269436-143269458 GATGAGAGACTGACAGGGGACGG - Exonic
1049984581 9:937014-937036 GAAGAGAGATTACCAGGGGCAGG - Intronic
1052510927 9:29419099-29419121 GAAGAGAAAATATGAGGTGTTGG - Intergenic
1055125555 9:72715517-72715539 GAAGAAAGGCTATCAGAGATTGG - Intronic
1055699881 9:78932358-78932380 CAAGAGAGACTAAGAAGGGTGGG + Intergenic
1055733458 9:79303228-79303250 GAACAGAGTCTATCAGGAGCAGG + Intergenic
1056033597 9:82580711-82580733 GAACAGAAACTACCAGGGGCTGG + Intergenic
1057416431 9:94867750-94867772 GAACAGATCCTATCAGGGCTGGG - Intronic
1059341740 9:113601239-113601261 GCAGAGAGGCCTTCAGGGGTGGG - Intergenic
1059650303 9:116309991-116310013 GAAGAAAGAGTACCATGGGTGGG - Intronic
1060385456 9:123222767-123222789 TAAGAGAAACTATCTGGGTTTGG - Intronic
1060937964 9:127526910-127526932 GAAGAGAGATTAGGAGGGATGGG + Intronic
1061328346 9:129877535-129877557 AAAAAGAGACTGTCAGGGCTGGG + Intronic
1203689399 Un_GL000214v1:28741-28763 GAAAAGAGAATACCAGGGATAGG + Intergenic
1203712640 Un_KI270742v1:111608-111630 GAAAAGAGAATACCAGGGATAGG - Intergenic
1203538582 Un_KI270743v1:66597-66619 GAAAAGAGAATACCAGGGATAGG + Intergenic
1203556236 Un_KI270743v1:209927-209949 GAAAAGAGAATACCAGGGATAGG - Intergenic
1203646876 Un_KI270751v1:75312-75334 GAAAAGAGAATACCAGGGATAGG - Intergenic
1186360163 X:8832715-8832737 GATGAGAGGCTATCAGGGGCTGG + Intergenic
1187493891 X:19777725-19777747 GAAGAGGGGCAATGAGGGGTGGG + Intronic
1191254712 X:58274749-58274771 GAAGCCAGACTTTCAGGGGGAGG - Intergenic
1191833240 X:65437311-65437333 GAAGAATTATTATCAGGGGTTGG - Intronic
1193450576 X:81659783-81659805 AAAGGGAGACTATCCTGGGTAGG - Intergenic
1193536396 X:82721314-82721336 TAAAAGATACTATCAGGGTTGGG + Intergenic
1193776837 X:85652811-85652833 GAAGGGTAACTACCAGGGGTTGG - Intergenic
1195067396 X:101250187-101250209 AAAGAGAGAATATCAGGGGGAGG - Intronic
1196712464 X:118777157-118777179 GAATAGAGGCTACCAGGGGTGGG - Intronic
1197852622 X:130879396-130879418 GAAGAGAGATTATCAGTACTAGG - Intronic
1198282881 X:135159678-135159700 GAGAAGAGACTATGAGGGGAAGG - Intronic
1199307472 X:146283767-146283789 GAAGAGTGGTTACCAGGGGTGGG - Intergenic